Application of bacillus vallismortis, complex microbial inoculant and preparation method of complex microbial inoculant

Abstract

The invention discloses application of bacillus vallismortis as well as a complex microbial inoculant and a preparation method of the complex microbial inoculant, and belongs to the technical field of microorganisms, the bacillus vallismortis is used for degrading straw and inhibiting plant pathogenic fungal diseases, the bacillus vallismortis is bacillus vallismortis JLHT37, and the preservation number is CGMCC NO.21871. The invention further discloses a preparation method of the complex microbial inoculant. The strain is used for preparing a microbial preparation for degrading straws and inhibiting plant pathogenic fungal diseases at the same time. The complex microbial inoculants comprise trichoderma asperellum, bacillus vallismortis and bacillus mojavensis. The bacillus vallismortis provided by the invention has an efficient cellulose degradation effect, and the strain has a relatively high capability of inhibiting the growth of plant pathogenic fungi, does not pollute the environment and is ecological and safe. The prepared microbial preparation also has the cellulose degradation effect and the capability of inhibiting the growth of plant pathogenic fungi.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to Bacillus valerianus capable of degrading straw and inhibiting plant pathogenic fungi and application thereof. Background Art

[0002] Straw is an important biological resource in crop production, an important material for industrial and agricultural production, and the fourth largest energy source in the world after coal, oil and natural gas. Straw has a complex composition, mainly composed of cellulose, hemicellulose and lignin as basic components, which are cross-linked with a small amount of crude protein and crude fat. Under natural conditions, straw has a strong ability to resist decomposition, which affects resource regeneration and utilization.

[0003] In nature, some microorganisms produce a variety of enzymes such as cellulose and lignin through their own metabolism, which enables them to efficiently degrade straw. With the advantages of mild reaction conditions and high degradation efficiency, they have become the first choice for straw degradation. However, the growth and reproduction of microorganisms require suitable external environmental conditions, but the natural environmental conditions cannot meet their number growth needs, so they cannot quickly degrade straw, which has become the main problem in the process of returning straw to the field. Therefore, screening microorganisms that can quickly decompose straw and developing efficient biological agents to shorten the decomposition time of straw has become one of the effective ways to return straw to the field.

[0004] In addition, the residual pathogens in straw will cause a new round of crop diseases, which will seriously threaten the growth of crops and affect the effect of returning straw to the field. Therefore, screening strains that can not only efficiently degrade crop straw but also antagonize and inhibit the growth of pathogenic fungi has important production and practical significance for the efficient and safe return of straw to the field and its resource development and reuse.

[0005] Bacillus vallismortis is a Gram-positive bacterium belonging to the Bacillus subtilis group. It is currently reported that Bacillus vallismortis has the ability to inhibit the growth of plant pathogenic fungi and can also effectively inhibit the growth of weeds.

[0006] The inventors of the present application have discovered through research a strain of Bacillus dysenteriae that can not only efficiently degrade straw but also efficiently inhibit a variety of plant pathogenic fungi. Summary of the invention

[0007] One of the purposes of the present invention is to provide a Bacillus vallismortis, which is classified and named Bacillusvallismortis. Another purpose of the present invention is to provide a microbial liquid obtained by fermenting Bacillus vallismortis. Depository: General Microbiology Center of China Microbiological Culture Collection Administration; taxonomic name of the Bacillus vallismortis: Bacillus vallismortis, deposit number: CGMCCNO.21871; deposit date: March 5, 2021; deposit address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. Trichoderma aculeatus and Bacillus mojavei are from the Laboratory of Mycotoxins and Plant Molecular Pathology of Hebei Agricultural University.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0009] The invention discloses an application of Bacillus vallismortis for degrading straw and inhibiting plant pathogenic fungal diseases. The Bacillus vallismortis is Bacillus vallismortis JLHT37, and its preservation number is CGMCC NO.21871.

[0010] A further improvement of the technical solution of the present invention is that it is used to prepare a microbial preparation for degrading straw and inhibiting plant pathogenic fungal diseases at the same time.

[0011] A composite bacterial agent comprises Trichoderma aculeatus, Bacillus valerianus and Bacillus mojavei.

[0012] A further improvement of the technical solution of the present invention is that the ratio of Trichoderma acanthosporum, Bacillus valerianus and Bacillus mojavei in the composite bacteria is 1:1:1.

[0013] The further improvement of the technical solution of the present invention is that it also includes a carrier, a wetting agent, a dispersant, and a protective agent; the carrier is selected from one or more of white carbon black, diatomaceous earth, activated white clay, and bentonite; the dispersant and the wetting agent are selected from one or more of SDS, sodium dodecyl sulfate, DBS, PEG8000, pull-opening powder, NNO, and sodium lignin sulfonate; the protective agent is selected from one or more of ascorbic acid, humic acid, dextrin, and CK.

[0014] The further improvement of the technical solution of the present invention is that: the carrier is selected as white carbon black, the dispersant and wetting agent are selected as PEG8000 and sodium lignin sulfonate, and the protective agent is selected as ascorbic acid.

[0015] A method for preparing a composite bacterial agent comprises adding 31.8% of a composite bacterial solution to 60.1% white carbon black, 4% sodium lignin sulfonate, 4% PEG8000, and 0.1% ascorbic acid according to a mass ratio, stirring and mixing, drying in an oven at 50°C, and sieving to obtain a wettable powder. The composite bacterial solution comprises 1×10 7 CFU / ml, Bacillus mojavei 1×10 7 CFU / ml, Bacillus dysenteriae 1×10 7 CFU / ml.

[0016] Due to the adoption of the above technical solution, the technical progress achieved by the present invention is:

[0017] The Bacillus dysvalleyi in the present application has a highly efficient cellulose degradation effect and the strain has a high ability to inhibit the growth of plant pathogenic fungi, does not pollute the environment, and is ecologically safe. The prepared microbial preparation also has a cellulose degradation effect and the ability to inhibit the growth of plant pathogenic fungi. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a schematic diagram of the dilution separation process of the Bacillus strain of the present invention;

[0019] Figure 2 is the determination of the cellulose degradation ability of the Bacillus strain of the present invention;

[0020] Figure 3 is a cluster analysis of 16S rDNA of the Bacillus strains of the present invention;

[0021] Figure 4 This is a diagram showing the disease resistance effect of the composite bacterial agent of Example 13 on corn stalk rot. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with embodiments:

[0023] The present invention discloses a Bacillus of the dead valley that can not only efficiently degrade straw but also efficiently inhibit a variety of plant pathogenic fungi, as well as a mixed bacterial liquid containing the Bacillus of the dead valley. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and these are considered to be included in the invention. The Bacillus described in the present invention has been described through relatively standardized embodiments, and relevant personnel can obviously modify and appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the invention to implement and apply the technology of the present invention.

[0024] The present invention will be further illustrated below in conjunction with the embodiments.

[0025] Example 1 Isolation of microorganisms from soil samples

[0026] The samples for strain isolation were collected from the rural areas of Yingkou, Liaoning, Suihua, Harbin, Heihe and other cities and counties in Heilongjiang, and the soil in the crop growing areas. Take 1g of rhizosphere soil and add it to a 50mL EP tube containing 9mL of sterile distilled water. Vortex and mix well. Let it stand for 1h. Take 100μL of the supernatant and add it to a 1.5mL EP tube containing 900μL of sterile distilled water for gradient dilution. At this time, the dilution degree is 10 -1 ; Take 100 μL of the diluted solution and add it to a 1.5 mL EP tube containing 900 μL of sterile distilled water, and continue to perform gradient dilution. At this time, the dilution degree is 10 -2 , and so on; take the dilution as 10 -3 , 10 -4 , 10 -5 The solution was spread on a sodium carboxymethyl cellulose plate and incubated at 24°C until a large number of colonies were produced (eg Figure 1 As shown); pick a few strains from the plate colonies, preliminarily classify the strain types according to their colony morphology, and inoculate them into the corresponding culture medium and culture them upside down at 37°C; perform multiple transfers according to the characteristics of the strains until pure culture colonies are obtained, and number them.

[0027] Example 2 Screening of cellulose degrading bacteria

[0028] Screening of cellulose-degrading bacteria: Take the above pure cultured monoclonal strain and inoculate it into 5 mL LB liquid culture medium, and shake and culture it at 37°C and 200 rpm for 24 hours. Take 5 μL of bacterial solution and spot it into CMC-Na culture medium, dry it, and invert and culture it at 24°C for 24 to 48 hours until the colony grows to an appropriate size. Stain the above plate with 1% Congo red stain for 15 minutes, and discard the Congo red stain. Decolorize the plate with 0.9% NaCl solution for 15 minutes, and discard the NaCl solution (such as Figure 2 Record whether there is an obvious discoloration and hydrolysis zone in the colony growth area and its surroundings.

[0029] Example 3 Sequence determination and homology comparison analysis of 16S rDNA of strains

[0030] The 16S rDNA fragment was amplified from the genome of the strain by PCR using universal primers: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT). The PCR reaction system (20 μL) was: template (bacterial solution) 1.0 μL, primer R (10 μM) 1.0 μL, primer R (10 μM) 1.0 μL, 2xTaqMasterMix (DyePlus) 10 μL, ddH2O 7 μL. The PCR amplification program was 95°C for 5 min, 94°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 34 cycles, and 72°C for 5 min. The amplified product was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing.

[0031] The sequenced 16S rDNA sequences were input into GenBank and BLAST software was used for homology search. The 16S rDNA sequences of different strains were selected and compared with the known 16S rDNA in GenBank for homology.

[0032] The 16S rDNA of the screened strains with antagonistic function and capable of simultaneously degrading cellulose was sequenced, and sequence comparison analysis was performed using the NCBI (http: / / www.ncbi.nlm.nih.gov) database. One to three sequences with high similarity among different strains were downloaded, and a phylogenetic tree was constructed using MEGAX software.

[0033] The homology comparison results are as follows:

[0034] The PCR amplification product was subjected to BLAST comparison in GenBank. The comparison results showed that the strain JLHT37 of the present invention and its highly homologous strains were all from the genus Bacillus (such as Figure 3 shown).

[0035] Example 4 Preparation of crude enzyme solution of Bacillus thuringiensis JLHT37

[0036] The activated bacterial suspension was inoculated into the enzyme production medium (the medium composition was: peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 0.5 g / L, CMC-Na 10 g / L, (NH4)2SO4 4 g / L, pH 7.0) at a concentration of 1×10 7 CFU / mL, liquid fermentation was carried out in a constant temperature shaker at 30°C for 5 days, the culture was taken out for centrifugation, and the supernatant was taken as the crude enzyme solution.

[0037] Example 5 Determination of endonuclease activity (CMCase) of Bacillus thuringiensis JLHT37.

[0038] The crude enzyme solution prepared in Example 4 was added to 1.5 mL of 1% CMC-Na solution. After adding the crude enzyme solution, the test tube was placed at 50° C. for 30 min. After 30 min, the test tube was taken out and 1.5 mL of DNS was added. The color reaction was carried out in a 100° C. water bath for 10 min. After 10 min, it was cooled to room temperature. 10 mL of distilled water was added and mixed evenly. The absorbance value was measured at a wavelength of 540 nm to calculate the average value. The endonuclease activity was calculated to be 140 U / ml based on the glucose standard curve.

[0039] Example 6 Determination of filter paper enzyme activity (FPA) of Bacillus thuringiensis JLHT37

[0040] Add 1.5mL, 0.05mol / L pH4.8 citric acid buffer and a treated filter paper strip (1cm×6cm) to the test tube, preheat all the test tubes at 50℃ for 5min and take them out, add 0.5mL of crude enzyme solution to the test tube, put the test tube at 50℃ and keep it warm for 30min after adding the crude enzyme solution, take out the test tube and add 1.5mL DNS reagent after 30min. Boil in water bath for 10min to carry out color reaction, take it out after the reaction is completed and cool it, add 10mL of distilled water and mix it evenly before testing, take the control test tube as blank control, and measure the absorbance value at 540nm wavelength. Take the average value to calculate the filter paper enzyme activity as 115U / ml.

[0041] Example 7 Determination of β-glucosidase activity (β-Gase) of Bacillus thuringiensis JLHT37.

[0042] 1.5 mL of 1% salicin solution was added to the control test tube and the test test tube respectively, and 0.5 mL of the crude enzyme solution prepared in Example 4 was added to each test tube. All the test tubes were placed in a 50°C water bath for 30 min. 0.5 mL of inactivated crude enzyme solution was added to the control test tube as a blank control. After 30 min, the test tube was taken out and 1.5 mL of DNS was added to stop the reaction. The tube was placed in a boiling water bath for 10 min to perform a color development reaction. After the reaction was completed, the tube was taken out and cooled, and 10 mL of distilled water was added to dilute and mix evenly. The absorbance was measured at a wavelength of 549 nm, and the β-glucosidase activity was calculated to be 132 U / ml based on the glucose standard curve.

[0043] Example 8 Determination of hemicellulase activity of Bacillus thuringiensis JLHT37.

[0044] The hemicellulase activity was determined by the DNS method. 1.8 mL of 1% xylan solution was added to a test tube, and the mixture was incubated at 50°C for 5 minutes. After 5 minutes, the test tube was taken out and the crude enzyme solution prepared in Example 4 was added as required, and the mixture was incubated at 50°C for 10 minutes. After 10 minutes, 0.75 mL of DNS reagent was added to terminate the reaction, and the mixture was in a boiling water bath for 10 minutes for color development. After 10 minutes, the test tube was taken out and cooled, and the absorbance was measured at a wavelength of 540 nm to find the corresponding xylose content. The enzymatic activity of the xylanase was calculated to be 107 U / ml based on the xylose content.

[0045] Example 9 Determination of ligninase activity of Bacillus thuringiensis JLHT37

[0046] Ligninase activity is measured as laccase: The determination of ligninase activity at 25°C is mainly based on the oxidation rate of ABTS under the conditions of . Add 100μL of 0.005mol / L ABTS solution, pH 3.0, 2.5mL of 50mol / L sodium tartrate buffer, and 400μL of crude enzyme solution to the test tube to start the reaction, and measure the change of absorbance at 420nm. It takes 3min to measure, and 3 times with an interval of 30s. The ligninase activity of Bacillus thuringiensis JLHT37 is 20U / ml.

[0047] Example 10 Preparation of JM17 composite bacteria wettable powder

[0048] 1. Bacillus valerianus and Bacillus mojavei were cultured in beef extract peptone medium (the medium composition was: beef extract 3 g / L, peptone 10 g / L, sodium chloride 5 g / L) at 37°C for 24 h at a speed of 180 rpm to obtain a microbial culture solution (the number of bacterial colonies was determined by plate colony counting method). The culture solution was diluted with water to a concentration of 1×10 7 CFU / ml. Trichoderma spinulosa was inoculated into Sabouraud medium (the medium composition was: peptone 10g, glucose 40g, water 1L) at 25℃ for 5 days at 200rpm (the number of bacterial colonies was determined by the hemocytometer method). Water was added to dilute the culture to 1×10 7 CFU / ml. The prepared Trichoderma aculeatus, Bacillus vallisneri and Bacillus mojavei were mixed in a ratio of 1:1:1 to form the JM17 composite bacteria.

[0049] 2. Experimental Methods

[0050] 2.1 Biocompatibility determination

[0051] Determination of daily growth of Bacillus dysvalles, Bacillus mojavei and Trichoderma aculeatus: 1 g / mL carrier, 0.12 mg / mL wetting agent and 0.25 mg / mL dispersant were mixed with fungal culture medium and bacterial culture medium respectively, and plated after sterilization. 4 CFU / mL) 0.05mL, spore suspension of Bacillus dysvalbardi and Bacillus mojavei (10 8 CFU / mL) 0.2mL, respectively, were evenly spread on the treated culture medium plates, untreated culture medium was used as control, each treatment was repeated 3 times, placed in 28℃ and 37℃ incubators for culture, the colony diameter of Trichoderma aculeatus was measured once every 6h, and the number of Bacillus spores was calculated every 24h. The daily growth of the colony diameter of Trichoderma aculeatus (mm / d) = (final colony diameter - initial colony diameter) / colony growth days.

[0052] 2.2 Screening of carriers and preparation of mother powder

[0053] Weigh 50.0g of carrier and place it in a beaker, add a certain amount of composite bacterial solution and stir, stir to make the carrier and composite bacterial solution fully adsorbed, stop adding composite bacterial solution when there is no dry powder in the carrier, dry it in a 50℃ oven overnight, sieve, and measure the wetting time and suspension rate of each carrier preparation. Select the carrier of wettable powder according to cost, adsorption amount, suspension rate, and wetting time.

[0054] Preparation of standard hard water: 0.139 g of magnesium chloride and 0.304 g of anhydrous calcium chloride are weighed and placed in a 1L measuring cylinder, and water is added to dissolve and the volume is fixed to 1L.

[0055] Wettability determination: refer to national standards. Add 100 mL of standard hard water to a 250 mL beaker and place it in a water bath for 20 minutes. After 20 minutes, take 5.0 g of sample and add it to the beaker. Calculate the wetting time of the sample. Repeat each treatment 6 times.

[0056] Suspension rate determination: refer to national standards. Weigh 1.0g of sample and place it in a beaker containing 50mL of standard hard water, then place the beaker in a shaker at 120r / min for 2min. After 2min, place it in a 30℃ water bath for 13min. After 13min, transfer the liquid to two stoppered barrels, invert and mix, keep the frequency of 2s, and place the stoppered measuring cylinder in a water bath for 30min and let it stand. After 30min, keep one tenth of the mixed liquid, and suck out the rest. After drying, determine the suspension rate:

[0057] Suspension rate (%) = (m1-m2) / m2×10 / 9×100%

[0058] Where: m1-sampling mass (g); m2-mass of the active ingredient of the 25mL suspension at the bottom of the measuring barrel (g)

[0059] 2.3 Screening of wetting agents

[0060] At an addition amount of 10%, various wetting agents and dispersants such as SDS, sodium dodecyl sulfate, DBS, PEG8000, pull open powder, NNO, sodium lignin sulfonate, etc. were mixed evenly with the mother powder, and the wetting time and suspension rate of each preparation were measured.

[0061] 2.4 Optimization of the optimal ratio of wetting agent to dispersant

[0062] The wetting agents and dispersants obtained by the previous screening were mixed in different proportions, and the suspension rate and wetting time of the preparations with different proportions were measured.

[0063] 2.5 Optimization of additive dosage

[0064] The screened wetting agents and dispersants were mixed evenly according to the ratio optimized in the early stage, and the dosage was screened according to a double value based on 2%, and the suspension rate and wetting time of preparations with different contents were measured.

[0065] 2.6 Screening of protective agents

[0066] Sodium lignin sulfonate, pull-opening powder, NNO and other three protective agents were mixed with the preparation at an addition amount of 0.1%, diluted and coated on the plate after mixing, one part of the bacterial culture plate was placed under ultraviolet light for 1 hour, and the other part was directly placed in an incubator for static culture. The bacterial culture medium without protective agent was used as the control group, and the survival rate was calculated based on the plate data.

[0067] 3. Experimental Results

[0068] 3.1 Vector screening

[0069] The adsorption capacity of different strains by the carriers was different. It can be seen that the carrier with the highest adsorption capacity of strains was white carbon black (Table 1). In order to ensure the accuracy of the carrier selection, the number of live bacteria and daily growth of the bacterial agents using different carriers were measured. The results showed that the number of live bacteria of Bacillus dysvalbardi using white carbon black as the carrier was 0.9×10 5 CFU, Bacillus mojavei was 0.52×10 5 CFU, Trichoderma spinulosa was 25.33×10 5 CFU, the daily growth rate of Trichoderma aculeatus was 2.97 (Table 2). The wetting time and suspension rate of the composite bacterial agent JM17 after adding different carriers showed that white carbon black was superior to other carriers in terms of adsorption capacity, colony count, daily growth rate, wetting time, and suspension rate (Table 3). Therefore, white carbon black was selected as the superior carrier for subsequent experiments.

[0070] Table 1 Adsorption capacity of different carriers

[0071]

[0072] Table 2 Effect of carrier on the number of bacterial colonies

[0073]

[0074] Table 3 Wetting time and suspension rate of carrier

[0075]

[0076] 3.2 Selection of wetting agents and dispersants

[0077] The effects of wetting agents and dispersants on the number of viable bacteria, wetting time, and suspension rate were analyzed, and then the dominant wetting agents and dispersants were selected. Through data analysis, it was found that the wetting agent PEG8000 and the dispersant sodium lignin sulfonate had little effect on the number of viable bacteria and daily growth of the five strains, and the effects of wetting time and suspension rate were dominant compared with other dispersants and wetting agents (Tables 4 and 5). Considering the effects of various wetting agents and dispersants on the wetting time, suspension rate, and colony survival rate of the preparation, PEG8000 was selected as the wetting agent and sodium lignin sulfonate as the dispersant.

[0078] Table 4 Suspension rate and wetting time of dispersants and wetting agents

[0079]

[0080]

[0081] Table 5 Effect of dispersants and wetting agents on colony count

[0082]

[0083] 3.2 Optimization of the optimal ratio of wetting agent and dispersant

[0084] Finally, PEG8000 was selected as the wetting agent and sodium lignin sulfonate was selected as the dispersant for compounding, and the screening results of the optimal ratio are shown in Table 6. From the results in Table 6, it can be seen that when the compounding ratio of PEG8000 and sodium lignin sulfonate is 5:5, the suspension rate of the preparation is the highest and the wetting time is the shortest, so 5:5 is used as the mass ratio of PEG8000 and sodium lignin sulfonate.

[0085] Table 6 Screening of different ratios

[0086]

[0087] 3.3 Optimization of additive dosage

[0088] The results of screening for the optimal dosage of adjuvants showed that with the increase in the dosage of adjuvants, the wetting time and suspension rate of the dosage form changed, and the quality of the preparation was improved (Table 7). However, the increase in the dosage of adjuvants would also increase the cost of the preparation. Therefore, considering the quality and cost of the preparation, the optimal dosage of this preparation was finally determined to be 8%.

[0089] Table 7 Screening of optimal dosage of additives

[0090]

[0091]

[0092] 3.4 Screening of protective agents

[0093] Adding protective agents to the formulation can improve the resistance of strains in wettable powders to sunlight ultraviolet rays, improve the use effect of wettable powders, and be more conducive to the prevention and control of field diseases. In wettable powders, ascorbic acid is added as a UV protective agent, and the number of colonies is the largest (Table 8), so ascorbic acid is selected as a UV protective agent.

[0094] Table 8 Screening of protective agents

[0095]

[0096] The preparation method of 3.5JM17 composite bacteria wettable powder is as follows: 60.1% white carbon black, 4% sodium lignin sulfonate, 4% PEG8000, 0.1% ascorbic acid, and 31.8% bacterial liquid.

[0097] According to the mass ratio, 31.8% of the composite bacterial solution was added to 60.1% white carbon black, 4% sodium lignin sulfonate, 4% PEG8000, and 0.1% ascorbic acid, stirred and mixed, and then dried in an oven at 50°C overnight, sieved, and a wettable powder was prepared. 7 CFU / ml, Bacillus mojavei 1×10 7 CFU / ml, Bacillus dysenteriae 1×10 7 CFU / ml.

[0098] Example 11 Determination of straw weight loss rate, hemicellulose, cellulose and lignin degradation rate of JM17 composite bacteria

[0099] Cut corn stalks and wheat stalks into pieces, weigh 10.0 g of stalks, add them into Hutcheson's enzyme production medium, add cellulose degrading bacteria JM17 into the corresponding medium at a 1% inoculation rate, and incubate at 28°C.

[0100] Constant temperature culture, total sampling time is 40 days, sampling once every 5 days, and the weight loss rate of straw samples is determined by washing and drying the straw. Changes in the components of cellulose, hemicellulose and lignin According to the processing steps of the kit of Solebaugh Technology Co., Ltd., the straw is processed as required. Static culture for 40 days was carried out under 25℃ culture conditions. First, the temperature environment was suitable. Secondly, static culture was closer to the natural degradation process. Finally, more and more stable data were obtained by monitoring the straw degradation rate during continuous long-term fermentation. The results are shown in Table 9. The addition of the composite microbial agent helps the degradation of straw. Both the degradation of straw weight and the changes in the components of straw are related to whether the microbial agent is added or not.

[0101] Table 9 Degradation rate of corn and wheat straw and changes in each component

[0102] Time (day) 5 10 15 20 25 30 35 40 Wheat straw degradation rate (%) 6 8 11 20 22 25 28 31 Corn straw degradation rate (%) 2 8 11 22 31 38 4 42 Wheat straw lignin content (mg / g) 181 175 161 162 153 146 140 130 Corn straw lignin content (mg / g) 225 214 212 204 201 198 195 192 Wheat straw hemicellulose content (mg / g) 241 236 231 225 216 212 206 203 Corn straw hemicellulose content (mg / g) 220 126 209 203 195 191 189 186 Wheat straw cellulose content (mg / g) 343 342 341 337 336 327 325 322 Corn straw cellulose content (mg / g) 343 340 338 334 325 319 316 311

[0103] Example 12: Potted plant simulation experiment of straw degradation using JM17 composite bacterial agent

[0104] Wheat and corn straw were mainly used in this study. One treatment and one control were set up, and each treatment was repeated 3 times. Treatment 1 was the compound bacterial agent JM17, and straw not treated with the bacterial agent was used as the control. Each seedling pot had 2 kg of soil and 10.0 g of straw. Each 2.0 g of straw was bagged and placed in the seedling pot at a depth of about 3 cm. The bacterial suspension (10 9 CFU / mL) to straw in a ratio of 1:1, and adjust C / N to 25:1 to keep the soil moist. Sampling began at 10 days and was taken every 10 days. Each time a portion of straw was taken to determine the weight loss rate of the straw in the nylon bag, the degradation rate of cellulose, hemicellulose and lignin. The degradation rate of the straw was calculated by the weight loss method. The results showed (Table 10) that the degradation rate of the straw treated with the composite microbial agent gradually increased, which showed that the use of the microbial agent was beneficial to the decomposition of the straw compared with the control. In the potted simulation experiment, the wheat and corn straws were treated with the composite microbial agent, and the various components changed. The change trends of the various components of the wheat and corn straws were significantly higher than those of the control.

[0105] Table 10 Degradation rate of wheat and corn straw and changes in each component

[0106]

[0107] Example 13: Control of corn stalk rot by JM17 composite bacterial agent

[0108] A bacterial disk of 8 mm in diameter was made from Fusarium graminearum (from the Laboratory of Mycotoxins and Plant Molecular Pathology, Hebei Agricultural University) and placed in the center of the PDA plate. Cut a toothpick in half and sterilize it. Use tweezers to pick up the toothpick, with the tip pointing to the bacterial disk, and place it evenly around the bacterial disk on the edge of the culture dish. Culture for 6 days until the mycelium covers the surface of the toothpick and set aside. The inbred line B73 was selected as the experimental material, and the specific planting method was the same as above. When the corn grows to three leaves and one heart, take 5 mL of the optimized composite fermentation bacterial solution and water the roots of the seedlings. After 7 days, water it for the second time. With clean water as the control, each treatment was designed with 10 parallels. When the corn grows to a stem thickness of about 1 cm, insert the toothpick with Fusarium graminearum hyphae at a 45° angle downward into the base of the corn stem, and the control group is a sterile toothpick. After 3 days, the disease condition of the stem was observed, and the incidence rate and prevention effect were calculated. The effect of the composite bacterial agent cultivated after the optimized fermentation system on the disease resistance of corn was verified by pot experiments ( Figure 4 , Table 11), the corn stalks treated with the JM17 composite fungicide inhibited the occurrence of corn stalk rot, among which the lesion control effect of the corn stalks treated with the fungicide JM17 was 34.29%.

[0109] Table 11 The efficacy of the composite bacterial agent against stem base rot

[0110]

Claims

1. An application of Bacillus dysvalleyi, characterized in that: The invention is used for degrading straw and inhibiting plant pathogenic fungal diseases. The Bacillus vallismortis is Bacillus vallismortis JLHT37, with a preservation number of CGMCC NO.21871.

2. The use of Bacillus dysvalleyi according to claim 1, characterized in that: Used for preparing microbial preparations for degrading straw and inhibiting plant pathogenic fungal diseases at the same time.

3. A composite bacterial agent, characterized in that: These include Trichoderma aculeatus, Bacillus valerianus and Bacillus mojavei.

4. A composite bacterial agent according to claim 3, characterized in that: The ratio of Trichoderma acanthosporum, Bacillus valerianus and Bacillus mojavei in the composite bacteria is 1:1:

1.

5. A composite bacterial agent according to claim 3, characterized in that: It also includes a carrier, a wetting agent, a dispersant, and a protective agent; the carrier is selected from one or more of white carbon black, diatomaceous earth, activated white clay, and bentonite; the dispersant and wetting agent are selected from one or more of SDS, sodium dodecyl sulfate, DBS, PEG8000, pull-opening powder, NNO, and sodium lignin sulfonate; the protective agent is selected from one or more of ascorbic acid, humic acid, dextrin, and CK.

6. A composite bacterial agent according to claim 5, characterized in that: The carrier is selected as white carbon black, the dispersant and wetting agent are selected as PEG8000 and sodium lignin sulfonate, and the protective agent is selected as ascorbic acid.

7. A method for preparing a composite bacterial agent, characterized in that: 31.8% of the composite bacterial solution was added to 60.1% white carbon black, 4% sodium lignin sulfonate, 4% PEG8000, and 0.1% ascorbic acid according to the mass ratio, stirred and mixed, and then dried in an oven at 50°C at low temperature, sieved, and a wettable powder was prepared. The composite bacterial solution included 1×10 7 CFU / ml, Bacillus mojavei 1×10 7 CFU / ml, Bacillus dysenteriae 1×10 7 CFU / ml.

Images