Enterococcus hisei SL-5 and application thereof

Abstract

The invention provides an enterococcus hisei SL-5 strain and an application thereof. The enterococcus hirae SL-5 is preserved in the China Center for Type Culture Collection on October 21, 2024, and the preservation number of the enterococcus hirae SL-5 is CCTCC (China Center for Type Culture Collection) M 20242284. According to the invention, a new lactic acid bacterium is separated from trachemys scripta elegans from a flower bird market in a Qinnan region in Qinzhou city in Guangxi Zhuang Autonomous District, and the new lactic acid bacterium is classified and named as Enterococcus hirae SL-5. The enterococcus haiseri SL-5 provided by the invention belongs to lactic acid bacteria, and compared with an existing lactic acid bacteria strain, the enterococcus haiseri SL-5 has relatively strong capabilities of degrading uric acid, inhibiting xanthine oxidase activity and degrading purine and purine nucleoside, can be applied to relieving hyperuricemia, and is of great significance in prevention and treatment of hyperuricemia.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Enterococcus hirae SL-5 and an application thereof. Background Art

[0002] Hyperuricemia is a metabolic disease caused by an increase in uric acid in the blood due to metabolic disorders of purine substances in the body. Hyperuricemia has harmful effects on multiple tissues and organs of the human body. For example, excessive uric acid deposits in bones and joints can cause gout, and deposits in the kidneys can cause kidney disease, kidney stones and induce kidney failure. High uric acid will also greatly increase the risk of a variety of metabolic-related diseases (such as obesity, diabetes, hypertension, dyslipidemia, etc.) and cardiovascular and cerebrovascular diseases (such as arteriosclerosis, coronary heart disease, and stroke). It can be seen that hyperuricemia has seriously affected people's health and quality of life.

[0003] At present, the treatment and prevention measures for hyperuricemia are mainly divided into two approaches: exogenous drug therapy and restriction of dietary purine intake. The drugs used in exogenous drug therapy mainly include xanthine oxidase inhibitors (such as allopurinol and febuxostat), uricosuric drugs (such as benzbromarone and sulfopyranolone), and uricases (such as rasburicase and pegolase), but these drugs are often accompanied by serious side effects, such as hypersensitivity, skin reactions, cardiovascular side effects, liver toxicity, renal hypersensitivity, etc. Restricting dietary purine intake to reduce the level of uric acid in food during consumption, thereby reducing uric acid in the blood, this measure will not produce toxic side effects, but this method will easily exclude the intake of nutritious foods, including most meats, seafood and some vegetables, which is not conducive to nutritional balance. In addition to the above two approaches, a very promising and creative method is to develop dietary supplements, such as probiotics, which can absorb or degrade purines from foods rich in nutrient purines during food intake and digestion to reduce the absorption of purines in the human intestine, thereby reducing serum uric acid levels. Intervening and improving hyperuricemia through probiotics and probiotic fermentation products is a simple, economical and effective measure.

[0004] Lactic acid bacteria have been used as probiotics to exert anti-inflammatory effects, nutrient metabolism, and the adjustment of intestinal flora structure. It has been reported that some lactic acid bacteria strains are involved in purine metabolism and degradation, which suggests that lactic acid bacteria have potential benefits in the prevention and treatment of hyperuricemia and gout. However, the direct degradation of uric acid by existing lactic acid bacteria is ineffective. Therefore, it is urgent to find a new lactic acid bacteria strain that can efficiently degrade uric acid, which will be of great significance for the prevention, relief and treatment of hyperuricemia. Summary of the invention

[0005] The present invention provides a strain of Enterococcus hirae SL-5 and an application thereof. The Enterococcus hirae SL-5 has strong abilities to degrade uric acid, inhibit xanthine oxidase activity, and degrade purine and purine nucleosides, and can be used to alleviate hyperuricemia, which is of great significance for the prevention and treatment of hyperuricemia.

[0006] According to the first aspect of the present invention, a strain of Enterococcus hirae SL-5 is provided, which was deposited in the China Center for Type Culture Collection on October 21, 2024, with the deposit number CCTCC M20242284.

[0007] The present invention isolates a new lactic acid bacteria from red-eared turtles from the flower and bird market in Qinnan District, Qinzhou City, Guangxi Zhuang Autonomous Region, and classifies and names it Enterococcus hirae SL-5. The Enterococcus hirae SL-5 provided by the present invention belongs to lactic acid bacteria. Compared with existing lactic acid bacteria strains, the Enterococcus hirae SL-5 has a stronger ability to degrade uric acid, inhibit xanthine oxidase activity, and degrade purine and purine nucleosides, and has good prebiotic properties, fermentation properties and antioxidant properties, and can be used to alleviate hyperuricemia, which is of great significance for the prevention and treatment of hyperuricemia.

[0008] According to a second aspect of the present invention, there is provided a use of the Enterococcus hirae SL-5 in the preparation of a medicament for preventing or treating hyperuricemia.

[0009] According to a third aspect of the present invention, a drug for preventing or treating hyperuricemia is provided, the drug comprising the above-mentioned Enterococcus hirae SL-5 or a culture of the above-mentioned Enterococcus hirae SL-5.

[0010] According to a fourth aspect of the present invention, there is provided use of the above-mentioned Enterococcus hirae SL-5 in the preparation of a drug for degrading uric acid.

[0011] According to a fifth aspect of the present invention, there is provided use of the Enterococcus hirae SL-5 in the preparation of a medicament for degrading purine and purine nucleosides.

[0012] According to a sixth aspect of the present invention, there is provided use of the above-mentioned Enterococcus hirae SL-5 in the preparation of a drug for inhibiting the activity of xanthine oxidase.

[0013] The present invention uses three major indicators of uric acid degradation, purine and purine nucleoside degradation, and inhibition of xanthine oxidase activity to evaluate its uric acid-lowering ability. Experimental results show that the Enterococcus hirae SL-5 provided by the present invention has strong abilities to degrade uric acid, degrade purine and purine nucleoside, and inhibit xanthine oxidase activity. Therefore, the Enterococcus hirae SL-5 provided by the present invention is applied to the preparation of a drug for degrading uric acid, purine and purine nucleoside, and inhibiting xanthine oxidase activity, thereby giving the drug strong abilities to degrade uric acid, purine and purine nucleoside, and inhibit xanthine oxidase activity, and can be applied to the prevention, relief, and treatment of hyperuricemia.

[0014] According to a seventh aspect of the present invention, there is provided a use of the Enterococcus hirae SL-5 in the preparation of antioxidant foods or health products.

[0015] Through experimental verification, it was found that the Enterococcus hirae SL-5 provided by the present invention has a high scavenging rate for DPPH, ABTS, and OH free radicals and has good antioxidant properties. Therefore, applying the Enterococcus hirae SL-5 provided by the present invention to the preparation of antioxidant foods or health products can make the foods or health products have high antioxidant effects.

[0016] According to an eighth aspect of the present invention, there is provided use of the Enterococcus hirae SL-5 as a fermentation agent in the preparation of fermented food or feed.

[0017] The Enterococcus hirae SL-5 provided by the present invention belongs to lactic acid bacteria, and the present invention has found through experimental research that the Enterococcus hirae SL-5 has good fermentation acid production characteristics and can be used as a fermentation agent in the preparation of fermented food or feed.

[0018] According to a ninth aspect of the present invention, there is provided use of the above-mentioned Enterococcus SL-5 as a fermentation agent in the preparation of a probiotic product.

[0019] According to the tenth aspect of the present invention, a solid culture medium for isolating the above-mentioned Enterococcus hirae SL-5 is provided, and the solid culture medium comprises the following components: 16-18 g / L Na2HPO4, 2-4 g / L KH2PO4, 0.1-1 g / L NaCl, 0.1-1 g / L MgSO4, 0.001-0.02 g / L CaCl2, and 1-3 g / L uric acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a graph showing the results of culturing the Enterococcus hirae SL-5 isolated in Example 1 for 36 hours in a solid culture medium with uric acid as the sole carbon and nitrogen source.

[0021] Figure 2 This is a graph showing the Gram staining results of Enterococcus hirae SL-5 provided in Example 1.

[0022] Figure 3 The phylogenetic tree of Enterococcus hirae SL-5 provided in Example 1.

[0023] Figure 4 This is a graph showing the degradation rate of uric acid by Enterococcus hirae SL-5 provided in Example 2.

[0024] Figure 5 This is a graph showing the inhibition rate of xanthine oxidase by Enterococcus hirae SL-5 provided in Example 4.

[0025] Figure 6 This is a graph showing the acid and bile resistance results of Enterococcus hirae SL-5 provided in Example 5.

[0026] Figure 7 This is a graph showing the salt and nitrite resistance results of Enterococcus hirae SL-5 provided in Example 6.

[0027] Figure 8 This is a graph showing the growth curve and pH value measurement results of the Enterococcus hirae SL-5 with strong salt tolerance screened out in Example 6.

[0028] Fig. 9 This is a graph showing the results of the scavenging rate of DPPH, ABTS, and OH free radicals by Enterococcus hirae SL-5 provided in Example 7.

[0029] Fig.10 This is a graph showing the therapeutic efficacy of the SL-5 fermented fish supernatant provided in Example 8 on hyperuricemia. DETAILED DESCRIPTION

[0030] The following is a further clear and complete description of the technical features in the technical solution provided by the present invention in conjunction with the specific implementation methods. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0031] Example 1 Isolation, purification and identification of Enterococcus hirae SL-5

[0032] In this example, a new lactic acid bacteria was isolated from a red-eared turtle from the flower and bird market in Qinnan District, Qinzhou City, Guangxi Zhuang Autonomous Region. The lactic acid bacteria was identified as Enterococcus hirae by morphological characteristics, culture traits and genetic characteristics 16S rRNA, and named Enterococcus hirae SL-5. The strain of Enterococcus hirae SL-5 was deposited in the China Center for Type Culture Collection on October 21, 2024, and the preservation address is Room 211, China Center for Type Culture Collection, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. It was classified and named Enterococcus hirae, and the preservation number is CCTCC M 20242284.

[0033] The specific steps for the isolation, purification and identification of Enterococcus hirae SL-5 are as follows:

[0034] 1. Isolation of bacterial strains

[0035] (1) Red-eared turtles were obtained from the flower and bird market in Qinnan District, Qinzhou City, Guangxi Zhuang Autonomous Region. The large and small intestines of the red-eared turtles were taken, and the fat on the surface of the large and small intestines was washed with 0.9% sterile saline. The intestines were evenly divided into several sections, each of which was about 3 to 4 cm long.

[0036] (2) taking the contents from the intestine with a length of about 3 to 4 cm and diluting them with 1% saline to obtain intestinal content solutions of different concentrations;

[0037] (3) Weigh 17.1 g Na2HPO4, 3 g KH2PO4, 0.5 g NaCl, 0.5 g MgSO4, 0.01 g CaCl2, 2 g uric acid, and 12 g agar, dissolve them in 1000 mL distilled water, and sterilize them at 121°C for 15 min to prepare a solid culture medium with uric acid as the only carbon and nitrogen source (final uric acid concentration is 11 mmol / L);

[0038] (4) 0.1 mL of each intestinal content solution of different concentrations was taken and spread on the solid culture medium prepared above with uric acid as the only carbon and nitrogen source, and cultured at 37°C for 36 h. The culture results were as follows: Figure 1 As shown;

[0039] Depend on Figure 1 It can be seen that an obvious transparent zone is formed around the positive strain of Enterococcus hirae SL-5, which indicates that Enterococcus hirae SL-5 can degrade the solid culture medium with uric acid as the only carbon and nitrogen source.

[0040] 2. Purification of bacterial strains

[0041] (1) Weigh 63.3 g of MRS agar and dissolve it in 1000 mL of distilled water, and sterilize it at 121° C. for 15 min to prepare MRS solid medium;

[0042] (2) Select the strains with good growth from the above-isolated bacteria, inoculate them on MRS solid medium, and culture them at 37°C for 36 h;

[0043] (3) Pick a typical single colony (round or irregularly round, milky white, opaque, tight texture, flat edges, rough surface, dry and dull, thin colonies and small colonies) on the plate, streak it on an MRS solid plate for purification for 2 to 3 generations, and then isolate a pure colony.

[0044] 3. Morphological observation and preservation of strains

[0045] The bacterial morphology of the isolated and purified Enterococcus hirae SL-5 was observed and stained by Gram staining. Figure 2 shown.

[0046] Depend on Figure 2 It can be seen that the SL-5 strain of Enterococcus hirsutum turns blue-purple under the action of Gram staining reagent, indicating that the bacteria obtained after separation and purification are Gram-positive bacteria, and the colony morphology in the microscopic field of view is uniform, and the cell morphology is spherical, and the arrangement is single or chain-like. Combined with the Gram staining results and bacterial morphology, it is preliminarily determined that the isolated and purified strain is suspected to be lactic acid bacteria.

[0047] 4. Molecular biological identification of bacterial strains

[0048] Table 1 Primers used to amplify 16S rDNA

[0049] Primer name Sequence number Specific nucleotide sequence (5'→3') Forward primer 27F SEQ ID NO: 1 AGAGTTTGATCCTGGCTCAG Reverse primer 1492R SEQ ID NO: 2 GGTTACCTTGTTACG ACTT

[0050] SEQ ID NO: 3

[0051]

[0052]

[0053] In order to further identify the isolated and purified strains, DNA was extracted from the activated strains using a bacterial genomic DNA extraction kit from Shanghai Jierui Biotechnology Co., Ltd., and then the 16S rRNA sequence was amplified using the forward primer 27F and the reverse primer 1492R as shown in Table 1. The amplified fragment was sequenced by Sangon Biotech (Shanghai) Co., Ltd. (Sangon Biotech Company, Shanghai, China) (the nucleotide sequence is shown in SEQ ID NO: 3). Then, the BLAST algorithm in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) was used to identify the isolates, and the differences between the strains were identified based on the sequence differences of 16S rDNA. The phylogenetic tree was constructed using MRGA11, and the results are shown in Figure 2 . Figure 3 shown.

[0054] Depend on Figure 3 It can be seen that the sequencing results of the Enterococcus hirae SL-5 provided by the present invention have a sequence homology of 99% with the 16S rRNA of Enterococcus hirae. The SL-5 strain was identified as Enterococcus hirae and named SL-5, which is the Enterococcus hirae SL-5 obtained by separation and purification of the present invention.

[0055] Example 2 Determination of uric acid degradation ability

[0056] This example aims to verify the in vitro degradation ability of Enterococcus hirae SL-5 on uric acid (UA). The specific steps are as follows:

[0057] (1) 200 μL of activated Enterococcus hirae SL-5 bacterial solution was inoculated into 8 mL of MRS liquid medium and cultured at 37°C for 24 h and 48 h;

[0058] (2) Take bacterial liquid from two different time periods for the experiment, centrifuge at 8000 rpm for 10 min at 4°C, collect the bacterial precipitate and wash it twice with 1 mL of 0.9% sterile saline, resuspend it in 0.5 mL of 2 mmol / L uric acid solution and react at 37°C and 220 rpm for 12 h;

[0059] (3) The reaction solution was collected and centrifuged at 4°C and 8000 rpm for 10 min. The supernatant was collected and a uric acid kit (purchased from Nanjing Jiancheng Bioengineering Institute Co., Ltd.) was used. Reagent 1 (reagent I contains Tris-HCl buffer, peroxidase and uricase) was added to the supernatant according to the operating instructions of the uric acid kit. The mixture was incubated at 37°C for 10 min and the absorbance OD was measured at 510 nm. 500 Calculate the uric acid concentration C in the supernatant according to the following formula: 尿酸:

[0060] C 尿酸 (μmol / L)=(A 测定 ﹣A 空白 ) / (A 标准 ﹣A 空白 )×C 校准品 ;

[0061] Where:

[0062] A 测定 ——Indicates the absorbance OD measured at 510nm after 12μL PBS buffer + 8μL supernatant + 150μL reagent I was incubated at 37℃ for 10min 500 ;

[0063] A 空白 ——Indicates the absorbance OD measured at 510nm after 20μL PBS buffer + 150μL reagent I was incubated at 37℃ for 10min 500 ;

[0064] A 标准 ——Indicates the absorbance OD measured at 510nm after incubating 20μL of the standard in the uric acid kit + 150μL of reagent I at 37℃ for 10min 500 ;

[0065] C 校准品 ——Indicates the concentration of the calibrant UA solution, which is 400μmol / L;

[0066] The results of degradation rate of uric acid by Enterococcus hirae SL-5 are as follows Figure 4 As shown. Figure 4 It can be seen that the degradation rates of the Enterococcus hirae SL-5 strains collected and cultured for 24h and 48h for uric acid with a concentration of 2mmol / L in 12h were 21.57% and 80.91%, respectively, which indicates that the Enterococcus hirae SL-5 strain provided by the present invention has a strong ability to degrade uric acid.

[0067] Example 3 Determination of Purine and Purine Nucleoside Degradation Ability

[0068] This example aims to verify the in vitro degradation ability of Enterococcus hirae SL-5 on purine and purine nucleosides. The specific steps are as follows:

[0069] 1. Preparation of Purine Nucleoside Standard Curve

[0070] The contents of guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine were detected by high performance liquid chromatography (HPLC). The retention time of the standard was determined by the external standard method, and the standard curve was drawn.

[0071] Standard solutions of guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine were prepared at a concentration of 0.1 mmol / L respectively, and filtered through a water filter membrane with a pore size of 0.22 μm. Then, samples were injected to determine their retention times. 5, 8, 11, 14 and 17 μL of the standard solutions were injected into a chromatographic column equipped with an ultraviolet wavelength detector, and the standard curve was determined based on the external standard method.

[0072] In the process of detecting the contents of guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine by HPLC: the chromatographic column used is Agilent ZORBAX Eclipse Plus C18 chromatographic column (4.6×25mm, 5μm); the mobile phase is prepared by mixing 10mmol / L sodium phosphate buffer (pH=4.7) and methanol in a volume ratio (v / v) of 9:1; the flow rate is 0.5mL / min; the column temperature is 37℃; the content of purine nucleosides is identified at a wavelength of 254nm.

[0073] The standard curve was drawn with the standard concentration x (unit μg / mL) as the abscissa and the HPLC peak area y as the ordinate. The linear regression equations and correlation coefficients of the standard curves of guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine were calculated and shown in Table 2.

[0074] Table 2 Linear regression equation and correlation coefficient of standard curve of purine and purine nucleoside

[0075] Standards Linear regression equation Correlation coefficient Guanosine y=83955x-51984 <![CDATA[R 2 =1]]> Inosine y=91111x-58557 <![CDATA[R 2 =0.9999]]> Adenosine y=53372x-226685 <![CDATA[R 2 =0.9998]]> Xanthine y=20985x-25980 <![CDATA[R 2 =0.9996]]> Hypoxanthine y=7378.7x-35649 <![CDATA[R 2 =1]]> Guanine y=69985x-55177 <![CDATA[R 2 =0.9994]]> Adenine y=18823x-48602 <![CDATA[R 2 =0.999]]>

[0076] 2. Purine and purine nucleoside degradation ability determination

[0077] The activated Enterococcus hirae SL-5 strain was centrifuged at 4°C and 8000 rpm for 10 min, the bacterial precipitate was collected and washed twice with 1 mL of 0.9% sterile saline, the supernatant was discarded, and appropriate amounts of 1 mmol / L guanosine solution, inosine solution, adenosine solution, xanthine solution, hypoxanthine solution, guanine solution and adenine solution were added respectively to make the absorbance of the reaction system at a wavelength of 600 nm OD 600=1.5, react at 37°C, 220rpm for 1h, collect the reaction solution and centrifuge at 4°C, 8000rpm for 10min, collect the supernatant, then add 0.1mol / L HClO4 to the supernatant at a volume ratio of 9:1 (v / v) to terminate the reaction, filter through a filter with a pore size of 0.22μm, take 20μL of the filtered solution for HPLC analysis, and calculate the contents of residual guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine in the supernatant using the standard curve in Table 2.

[0078] According to the formula V = (C1-C2) / 60, D = (C1-C2) / C1*100%, the degradation rate (V) and degradation ratio (D) of different strains for guanosine, inosine, adenosine, xanthine, hypoxanthine, guanine and adenine were calculated. The calculation results are shown in Table 3.

[0079] Where:

[0080] V——degradation rate (μg / L / min);

[0081] C1——indicates the initial amount of purine or nucleoside (g / L);

[0082] C2——Indicates the residual amount of purine or purine nucleoside (g / L).

[0083] Table 3 Degradation results of purine and purine nucleoside by Enterococcus hirae SL-5 strain

[0084] Purine and purine nucleoside types Degradation rate D(%) Degradation rate V (μg / L / min) Inosine 39.66±1.61 4.31±0.76 Guanosine 25.14±4.37 0.42±0.09 Adenosine 95.73±0.11 11.52±0.01 Xanthine 15.88±4.88 0.12±0.06 Adenine 36.05±5.55 0.29±0.09 Guanine - - Hypoxanthine - -

[0085] As can be seen from Table 3, the degradation rate of inosine by Enterococcus hirae SL-5 strain is 39.66%, and the degradation rate is 4.31 μg / L / min. The degradation rate of guanosine is 25.14%, and the degradation rate is 0.42 μg / L / min. The degradation rate of adenosine is 95.73%, and the degradation rate is 11.52 μg / L / min. The degradation rate of xanthine is 15.88%, and the degradation rate is 0.12 μg / L / min. The degradation rate of adenine is 36.05%, and the degradation rate is 0.29 ug / L / min. It can be seen that Enterococcus hirae SL-5 strain has a degradation effect on both purine and purine nucleosides, and the degradation rate of adenosine by Enterococcus hirae SL-5 is the highest, and the degradation rates of hypoxanthine and guanine are relatively low.

[0086] Example 4 Xanthine oxidase inhibition experiment

[0087] This example aims to verify the inhibitory effect of Enterococcus hirae SL-5 on xanthine oxidase (XOD). The specific steps are as follows:

[0088] The activated Enterococcus hirae SL-5 strain was centrifuged at 4°C and 8000 rpm for 10 min, the bacterial precipitate was collected and washed twice with 1 mL of 0.9% NaCl solution by mass, the supernatant was discarded, 1 mL of PBS buffer (pH = 7.0) was added to resuspend the bacterial precipitate, and incubated at 37°C and 220 rpm for 48 h. The reaction solution was collected and centrifuged at 4°C and 8000 rpm for 10 min, and the supernatant was collected for analysis of XOD inhibitory activity.

[0089] Table 4 Xanthine oxidase inhibition rate reaction determination system

[0090]

[0091] 212 μL PBS buffer (0.2 mol / L, pH=7.4), 10 μL xanthine oxidase (0.1 u / mL) and 20 μL Enterococcus hirae SL-5 bacterial suspension were mixed, and incubated with 8 μL xanthine solution (5 mmol / L) at 37°C for 15 min. After the two temperatures were consistent, the two were mixed, the reaction was started, and the change in absorbance within 10 min was recorded under ultraviolet conditions with a wavelength of 293 nm. Allopurinol was used as a positive control. In the positive control, allopurinol solution (327 mol / L) was used to replace the Enterococcus hirae SL-5 bacterial suspension. In the blank control, PBS buffer was used to replace the Enterococcus hirae SL-5 bacterial suspension. The above xanthine oxidase inhibition reaction determination system is shown in Table 4.

[0092] The activity of xanthine oxidase is expressed by the inhibition rate of xanthine oxidase. Since xanthine has absorbance at a wavelength of 293nm, the absorbance values ​​of the sample and the enzyme must be deducted. Three parallel experiments are performed for each sample, and the reaction solution at a wavelength of 293nm is detected by an ELISA instrument. The xanthine oxidase inhibition rates of the experimental group, positive group, and blank group are calculated according to the following formula:

[0093] XOD inhibition rate (%) = [1-(A s -A s0 ) / (A b -A b0 )]×100%;

[0094] Where:

[0095] A s ——Indicates the absorbance value of the sample group and the positive group measured at a wavelength of 293nm after 10 minutes;

[0096] A s0 ——Indicates the absorbance value of the sample group and the positive group measured at a wavelength of 293nm at 0min;

[0097] A b ——Indicates the absorbance value of the blank group measured at a wavelength of 293nm at 10min;

[0098] A b0 ——Indicates the absorbance value of the 0min blank group measured at a wavelength of 293nm.

[0099] The results of xanthine oxidase inhibition rate determination in the sample group and the positive group are as follows Figure 5 As shown. Figure 5 It can be seen that the inhibition rate of the positive group on XOD is as high as 94.14%, while the inhibition rate of the Enterococcus hirae SL-5 strain on XOD is 75.32%, which shows that the Enterococcus hirae SL-5 strain provided by the present invention has a strong ability to inhibit the activity of xanthine oxidase.

[0100] Example 5 Study on the probiotic properties of Enterococcus hirae SL-5 lactic acid bacteria

[0101] Enterococcus hirae SL-5 belongs to lactic acid bacteria. This example aims to study the probiotic properties of lactic acid bacteria of Enterococcus hirae SL-5, mainly focusing on the acid and bile resistance and antibiotic sensitivity of Enterococcus hirae SL-5.

[0102] 1. Acid and bile salt resistant

[0103] Take 500 μL of the solution with a concentration of 1.0×10 9 The activated Enterococcus hirae SL-5 strain with a CFU / mL was inoculated into 1 mL MRS liquid medium (pH 3.0) and 1 mL MRS liquid medium with a 0.3% ox bile salt content, respectively, and cultured at 37°C. Samples were taken at 0h and 3h, and the number of viable bacteria was determined by the dilution coating method, with 1g CFU / mL recorded. The number of viable bacteria was determined, and the viability of Enterococcus hirae SL-5 under acidic and bile salt conditions was compared with the inoculation of conventional MRS liquid medium as a control. The above experiment was repeated three times. The results of the acid and bile salt resistance determination are shown in Figure 2. Figure 6 shown.

[0104] Depend on Figure 6 It can be seen that the survival rate of the Enterococcus hirae SL-5 strain in the acidic MRS liquid culture medium (pH 3.0) is 57.14%, and the survival rate in the MRS liquid culture medium with 0.3% ox bile salt content is 88.72%. The above results show that the Enterococcus hirae SL-5 provided by the present invention has good acid and bile salt resistance and can survive under acidic and bile salt conditions.

[0105] 2. Antibiotic sensitivity

[0106] The antimicrobial susceptibility test was performed according to the Clinical and Laboratory Standards Institute (CLSI) standard procedure. The specific experimental steps were as follows: Enterococcus hirae SL-5 strain was inoculated in MRS liquid culture medium and cultured at 37°C for 24 h. The culture medium was then diluted to 6 × 10 8 The concentration of CFU / mL was measured, and then a sterile cotton swab was used to spread it over the entire surface of the dry MRS agar plate. At the same time, the antibiotics were placed on the surface of each MRS plate. After incubation at 37°C for 48 hours, the diameter of the inhibition zone around each disk was measured (in mm) to classify the antibiotic sensitivity of each isolate. The above experiment was repeated three times. The results of the sensitivity test of Enterococcus hirae SL-5 strain to different antibiotics are shown in Table 5, where "S" means sensitive, and the diameter of the inhibition zone is ≥17 mm; "R" means resistant, and the diameter of the inhibition zone is ≤12 mm.

[0107] Table 5 Results of sensitivity test of Enterococcus hirae SL-5 strain to different antibiotics

[0108] Types of antibiotics Dosage (μg / tablet) Sensitivity Penicillin (P) 10 S Cefazolin (CZ) 30 S Erythromycin (E) 15 S Tetracycline (TE) 30 S Gentamycin (CN) 10 R

[0109] As shown in Table 5, the SL-5 strain of Enterococcus hirae is sensitive to penicillin, cefazolin, erythromycin and tetracycline, but has a certain resistance to gentamicin.

[0110] Example 6 Study on the fermentation characteristics of Enterococcus hirae SL-5

[0111] Enterococcus hirae SL-5 belongs to lactic acid bacteria. This example aims to study the fermentation characteristics of Enterococcus hirae SL-5. The specific experimental operation steps are as follows:

[0112] 1. Salt and nitrite resistance

[0113] Enterococcus hirae SL-5 strain was inoculated at 1% in MRS liquid medium containing 6% salt (w / v) and MRS liquid medium containing 150 mg / L NaNO2, respectively, and cultured at 37°C for 24 h. Samples were taken and the absorbance OD was measured at a wavelength of 600 nm. 600 The above was used as the experimental group, and the MRS liquid culture medium without inoculation of Enterococcus hirae SL-5 was used as the blank control group to screen out the strains with strong salt tolerance. The above experiment was repeated three times. The results of salt and nitrite tolerance of Enterococcus hirae SL-5 are as follows Figure 7 shown.

[0114] 2. Determination of the growth and acid production of Enterococcus hirae SL-5

[0115] The Enterococcus hirae SL-5 with strong salt tolerance selected above was transferred to MRS liquid medium at a 1% inoculation rate for culture, and samples were taken at 0h, 6h, 21h, 27h, and 50h, and the absorbance OD was measured at a wavelength of 600nm. 600 The growth curve was determined by taking the MRS liquid culture medium without inoculation of Enterococcus hirae SL-5 as the control. Meanwhile, the pH value of the MRS liquid culture medium inoculated with Enterococcus hirae SL-5 was measured by using a pH meter. The above experiment was repeated three times and the results were averaged. The growth curve and pH value determination results of Enterococcus hirae SL-5 are shown in FIG. Figure 8 shown.

[0116] Depend on Figure 8 It can be seen that the screened Enterococcus hirae SL-5 strain with strong salt tolerance has a fast growth rate within the range of 0 to 21 hours as the culture time increases. After the culture time reaches 21 hours, the growth rate of Enterococcus hirae SL-5 strain slows down. Moreover, as the culture time increases, the pH value of the MRS liquid culture medium shows a downward trend, which indicates that Enterococcus hirae SL-5 has a strong acid production ability, which causes the pH value of the culture system to gradually decrease.

[0117] Example 7 Study on the Antioxidant Activity of Enterococcus hirae SL-5

[0118] This example aims to study the antioxidant properties of Enterococcus hirae SL-5. The specific experimental steps are as follows:

[0119] 1. Preparation of Enterococcus hirae SL-5 fermentation supernatant and bacterial suspension

[0120] Enterococcus hirae SL-5 cells were inoculated into MRS liquid culture medium at a 1% inoculation rate, cultured at 37°C for 24 h, and after three generations, centrifuged at 10,000 r / min for 10 min, and the supernatant was collected as the fermentation supernatant of Enterococcus hirae SL-5 cells. Enterococcus hirae SL-5 cells were washed twice with a 0.9% NaCl solution, and the washed cells were resuspended with a 0.9% NaCl solution, and the cell count was adjusted to OD 600 =1.0, and obtain bacterial suspension.

[0121] 2. Determination of the free radical scavenging effect of 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH)

[0122] After mixing 1 mL of the sample to be tested (fermentation supernatant and bacterial suspension with OD600 = 1.0) and 1 mL of DPPH solution (containing 0.2 mmol / L anhydrous ethanol), the mixture was reacted at room temperature in the dark for 30 min. The mixture was centrifuged at 4 °C and 8000 rpm for 10 min, and the supernatant was collected. The absorbance change was measured at a wavelength of 517 nm. The above experiment was repeated three times, and the DPPH free radical scavenging rate was calculated according to the following formula:

[0123] DPPH free radical scavenging rate (%) = [1-(A i -A j ) / A c ]×100%

[0124] Where:

[0125] A i ——Indicates the absorbance of the supernatant collected after 1mL DPPH + 1mL sample reacted for 30min at a wavelength of 517nm;

[0126] A j ——Indicates the absorbance of the supernatant collected after 1mL of anhydrous ethanol + 1mL of the sample to be tested reacted for 30 minutes at a wavelength of 517nm;

[0127] A c ——Indicates the absorbance of the supernatant collected after 1mL DPPH + 1mL 0.9% NaCl solution reacted for 30 minutes and measured at a wavelength of 517nm.

[0128] 3. Determination of free radical scavenging ability of 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS)

[0129] The ABTS stock solution was prepared by mixing a 7 mmol / L ABTS solution with a 2.45 mmol / L potassium persulfate solution. After being placed in the dark for 12 to 16 hours, the ABTS stock solution was diluted with anhydrous ethanol to an absorbance of OD 734 =0.7 (absorbance at a wavelength of 734 nm) to prepare an ABTS working solution, then 0.15 mL of the sample to be tested was mixed with 2 mL of the ABTS working solution, reacted at room temperature in the dark for 6 min, and then centrifuged at 4 ° C and 8000 rpm for 10 min, the supernatant was collected, and the absorbance was measured at a wavelength of 734 nm. The above experiment was repeated three times, and the ABTS free radical scavenging rate was calculated according to the following formula:

[0130] ABTS free radical scavenging rate (%) = [1-(A sample / A blank )]×100%

[0131] Where:

[0132] A sample ——Indicates the absorbance of the supernatant collected after 0.15mL of the sample to be tested + 2mL of ABTS working solution reacted at room temperature in the dark for 6 minutes, measured at a wavelength of 734nm;

[0133] A blank ——Indicates the absorbance of the supernatant collected after 0.15mL distilled water + 2mL ABTS working solution reacted at room temperature in the dark for 6 minutes measured at a wavelength of 734nm.

[0134] 4. Determination of OH free radical scavenging ability

[0135] Take 2 mL of the sample to be tested and add 1 mL each of 5 mmol / L ferrous sulfate solution, 5 mmol / L salicylic acid-ethanol solution, and 3 mmol / L H2O2, in a water bath at 37°C for 20 min, centrifuge at 4°C and 8000 rpm for 10 min, collect the supernatant, and measure the absorbance at a wavelength of 510 nm. Repeat the above experiment three times, and calculate the hydroxyl (OH) free radical scavenging rate according to the following formula:

[0136] OH radical scavenging rate (%) = [1-(A1-A 10 ) / A0]×100%

[0137] Where:

[0138] A1——represents the absorbance of the supernatant collected after the sample was incubated in a water bath at 37°C for 20 minutes at a wavelength of 510nm;

[0139] A 10 ——Indicates the absorbance of the supernatant collected after replacing H2O2 solution with the same volume of pure water at 37℃ for 20 minutes measured at a wavelength of 510nm;

[0140] A0——represents the absorbance of the supernatant collected after replacing the sample with the same volume of pure water in a water bath at 37°C for 20 minutes and measured at a wavelength of 510nm.

[0141] The calculation results of scavenging rate of DPPH, ABTS and OH free radicals by Enterococcus hirae SL-5 are as follows: Fig. 9 As shown. Fig. 9 It can be seen that the scavenging rates of DPPH, ABTS and OH free radicals of Enterococcus hirae SL-5 suspension were 12.56%, 49.02% and 21.95% respectively, and the scavenging rates of DPPH, ABTS and OH free radicals in the fermentation supernatant were 62.40%, 93.81% and 99.32% respectively. The above results show that Enterococcus hirae SL-5 has good antioxidant properties.

[0142] Example 8 Treatment of hyperuricemic Caenorhabditis elegans with fish fermented by Enterococcus hirae SL-5

[0143] Caenorhabditis elegans has the advantages of being transparent, small in size, short in lifespan, and easy to culture and manipulate. It is a widely used new model organism. Caenorhabditis elegans has become the most ideal model for studying lifespan, disease, and toxicology. As a model organism, Caenorhabditis elegans has high value in identifying the active effects of traditional Chinese medicine and natural medicines. Most mammals, including rodents, can produce urease to break down uric acid, but humans lack this ability due to the lack of the corresponding gene. Similarly, there is no uricase in Caenorhabditis elegans.

[0144] In this example, the Caenorhabditis elegans hyperuricemia model was used to evaluate the therapeutic efficacy of SL-5 fermented fish supernatant on hyperuricemia.

[0145] This example aims to study the therapeutic effect of the supernatant collected after fermenting fish meat with Enterococcus hirae SL-5 on hyperuricemia Caenorhabditis elegans. The specific experimental steps are as follows:

[0146] 1. Configuration of materials and solvents

[0147] NGM medium: 1.5 g NaCl, 8.5 g agar powder, 1.25 g tryptone, 488.5 mL distilled water, sterilize at 121°C for 20 min, add 0.5 mL each of 1 mol / L CaCl2, 1 mol / L MgSO4, and 5 mg / mL cholesterol (dissolved in anhydrous ethanol) and 12.5 mL of 1 mol / L potassium phosphate buffer (pH 6.0) under sterile conditions, mix well and dispense into plates as soon as possible.

[0148] M9 buffer: KH2PO4 1.5g, Na2HPO4 3g, NaCl 2.5g, MgSO4 0.06g, add distilled water 500mL, sterilize at 121℃ for 20min.

[0149] S Medium (SM): SB 200 mL, 1 mol / L potassium citrate buffer 2 mL, TMS 2 mL, 1 mol / L CaCl2 and 1 mol / L MgSO4 0.6 mL each.

[0150] S Basal (SB): NaCl 1.19 g, K2HPO4 0.262 g, KH2PO4 1.2 g, 5 mg / mL cholesterol 0.2 mL, add distilled water to 200 mL, mix well, and sterilize at 121°C for 20 min.

[0151] 1 mol / L potassium citrate buffer: 0.2 g citric acid monohydrate, 2.94 g potassium citrate monohydrate, add 10 mL of distilled water, and sterilize at 121°C for 20 min.

[0152] TMS solution: 0.372 g ethylenediaminetetraacetic acid, 0.138 g FeSO4, 0.04 g MnCl2, 0.058 g ZnSO4, 0.005 g CuSO4, 200 mL distilled water, sterilize at 121°C for 20 min.

[0153] 1 mol / L potassium phosphate buffer (pH 6.0): K2HPO4 2.33 g, KH2PO4 5.42 g, add 50 mL of distilled water, sterilize at 121°C for 20 min.

[0154] 2. Cultivation of Caenorhabditis elegans

[0155] C. elegans (N2 wild type) were grown on nematode growth medium (NGM) plates with Escherichia coli OP50 as the food source. Worms were transferred to new NGM plates every five days and synchronized by the sodium hypochlorite method to obtain age-synchronized larvae.

[0156] 3. Establishment of the hyperuricemia model in Caenorhabditis elegans

[0157] A 0.25 mg / mL xanthine-induced hyperuricemia model of Caenorhabditis elegans was established. All groups consisted of 300 nematodes and were cultured at 20°C in a six-well plate containing 3.6 mL SM and 1.2 mL xanthine for 12 h. A control group was also set up, using an equal amount of nematode M9 buffer.

[0158] 4. Preparation of fish supernatant from Enterococcus hirae SL-5 fermentation

[0159] Enterococcus hirae SL-5 cells were inoculated into MRS liquid medium and cultured at 37°C for 24 h. After three generations, the cells were centrifuged at 10,000 r / min for 10 min, the supernatant was removed, the cell pellet was collected and washed twice with a 0.9% NaCl solution, and the cell count was adjusted to OD 600 =2.0 (absorbance at a wavelength of 600 nm), and a bacterial suspension was obtained.

[0160] The fish meat and the bacterial suspension were mixed in a ratio of fish meat: bacterial suspension = 1:1 (w / v), and 4% sugar was added according to the weight of the fish meat. The mixture was fermented at 37°C for 24 hours, centrifuged at 10000 r / min for 10 minutes, the supernatant was collected, and filtered through a 0.22 μm filter.

[0161] 5. Treatment of hyperuricemia in Caenorhabditis elegans

[0162] The nematodes in the high uric acid environment were transferred to a centrifuge tube, centrifuged at 4000r / min for 3min, the supernatant was discarded, and the tube was rinsed twice with M9 buffer to remove the xanthine solution. The supernatant was then discarded and the precipitate was retained. The precipitate was then transferred to 3mL of fermented fish supernatant for treatment at 0h and 24h as the experimental group. At the same time, a positive group was set up, in which allopurinol was used instead of fermented fish supernatant.

[0163] 6. HPLC method for detecting uric acid content

[0164] Referring to Example 3, the uric acid content was detected by HPLC. Samples from the modeling group and the treatment group were centrifuged at 4000r / min for 3min, the supernatant was discarded, and the samples were rinsed twice with M9 buffer, and the supernatant was discarded to retain the precipitate. Grind completely with a handheld grinding rod, and add 3mL of 1mol / LNaOH to obtain the grinding liquid to make a mixed solution. The mixed solution was vortexed for 3min and ultrasonically vibrated for 5min, and centrifuged at 4000r / min for 3min. Take the supernatant and filter it through a filter with a pore size of 0.22μm, and take 20μL of the filtered solution for HPLC analysis.

[0165] Uric acid degradation rate (%) = [(C0-C 24 ) / C0]×100%

[0166] Where C0 is the concentration of uric acid after 0h of treatment; C 24 It is the uric acid concentration after 24 hours of treatment.

[0167] The results of SL-5 fermented fish supernatant on the treatment of hyperuricemia are as follows Fig.10 As shown, after 24 hours of treatment, the degradation rate of uric acid in Caenorhabditis elegans by the SL-5 fermented fish supernatant in the experimental group was 17.73%, and the result in the positive group was 37.8%.

[0168] In summary, the Enterococcus hirae SL-5 obtained by separation and purification of the present invention has the ability to efficiently degrade uric acid, degrade purine nucleosides and inhibit xanthine oxidase. Therefore, Enterococcus hirae SL-5 is a good strain for the development and application of microecological agents to assist in the prevention and treatment of hyperuricemia.

[0169] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the technical solutions of the present invention can be modified or equivalently replaced, but these modifications or replacements are all within the protection scope of the present invention.

Claims

1. A strain of Enterococcus hirae SL-5, deposited in the China Center for Type Culture Collection on October 21, 2024, with the deposit number CCTCC M 20242284.

2. Use of Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of a medicament for preventing or treating hyperuricemia.

3. A drug for preventing or treating hyperuricemia, characterized in that: The medicament comprises the Enterococcus hirae SL-5 according to claim 1 or a culture of the Enterococcus hirae SL-5 according to claim 1 .

4. Use of Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of a medicament for degrading uric acid.

5. Use of Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of a medicament for degrading purine and purine nucleoside.

6. Use of the Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of a medicament for inhibiting the activity of xanthine oxidase.

7. Use of the Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of antioxidant foods or health products.

8. Use of the Enterococcus hirae SL-5 as claimed in claim 1 as a fermentation agent in the preparation of fermented food or feed.

9. Use of Enterococcus hirae SL-5 as claimed in claim 1 in the preparation of probiotic products.

10. A solid culture medium for isolating the Enterococcus hirae SL-5 according to claim 1, characterized in that: The solid culture medium comprises the following components: 16-18 g / L Na2HPO4, 2-4 g / L KH2PO4, 0.1-1 g / L NaCl, 0.1-1 g / L MgSO4, 0.001-0.02 g / L CaCl2, and 1-3 g / L uric acid.

Images