High-stability and low-sensitization 3D cell culture meat scaffold and preparation method thereof

Abstract

The invention discloses a high-stability and low-sensitization 3D cell culture meat scaffold and a preparation method thereof, and belongs to the field of future food science and technology processing. The fish gelatin sodium alginate cell culture meat scaffold is prepared through covalent modification of sodium alginate with different concentrations, the problem that fish gelatin gel is unstable at 37 DEG C is remarkably improved, the gel strength is improved by about 282.42%, the hydrophilicity is remarkably improved, and the cell culture meat scaffold is suitable for being used for preparing the fish gelatin sodium alginate cell culture meat scaffold. Meanwhile, the release amount of mouse plasma histamine of intragastric sodium alginate covalently modified group fish gelatin is reduced by about 54.35%, and the release rate of beta-hexosaminidase of RBL-2H3 cells is reduced from 27.50% to 11.31%. The high-stability and low-sensitization cell culture meat scaffold is prepared from fish gelatin, sodium alginate and calcium chloride, the problem of low stability of a single fish gelatin cell scaffold is solved, and the potential sensitization risk of the cell culture meat scaffold is reduced.

Description

Technical Field

[0001] The present invention belongs to the field of future food technology processing, and specifically relates to a high-stability, low-allergenic 3D cell culture meat scaffold and a preparation method thereof. Background Art

[0002] In the face of today's ever-changing technology and severe domestic and international situations, especially unpredictable climate change, natural disasters and other issues, cell-cultured meat is an important way to solve this problem. In addition, compared with traditional aquaculture, cell-cultured meat has a short growth cycle, a small carbon footprint, and consumes less natural resources. At the same time, the production process is clean and safe in the laboratory, which makes cell-cultured meat an important trend for future development.

[0003] Cell cultured meat refers to meat products obtained by obtaining "seed cells" in vitro, culturing and processing "seed cells" on a large scale to obtain muscle, fat and other tissues, and then processed through food technology and processing. Although its production process is safe and reduces zoonotic diseases, the risk factors such as allergens contained in cell cultured meat are still unclear, and there is an urgent need for efficient identification and safe control.

[0004] In recent years, domestic and foreign scholars have conducted extensive research on cell culture meat scaffold materials. By optimizing processing technology and different technologies, relatively stable cell culture meat scaffold materials have been formed, such as a method for manufacturing an edible sodium alginate / gelatin 3D gel scaffold coated with tea polyphenols for cell culture meat (publication number: CN113892643A), a method for continuously preparing an edible fibrotic scaffold for cell culture meat (publication number: CN114622296B), cell culture meat scaffolds and preparation methods thereof, cell cultured meat and preparation methods thereof, and cell cultured meat products (publication number: CN115747134A), an edible 3D cell culture scaffold and preparation method thereof (publication number: CN118421554A), and a method for preparing soybean protein amyloid fiber-cell culture meat scaffold based on ice template method (publication number: CN118620819A).

[0005] Compared with traditional livestock gelatin such as pigs and cattle, fish gelatin has the advantages of wide sources, low cost, and reduced risk of zoonotic diseases. At the same time, its excellent degradability and biocompatibility make it an excellent raw material for cell culture meat scaffolds. However, it is reported that fish gelatin, as an allergen, can cause allergic reactions and cause harm to the human body. Moreover, the current development of cell culture meat scaffolds mainly focuses on research on their stability and biocompatibility, and there are few studies on the preparation of low-allergenic cell scaffolds, especially to ensure the stability and biocompatibility of the scaffold while maintaining low immunogenicity. In addition, the preparation of the scaffold in the above-mentioned study requires special instruments and equipment, and the operation is cumbersome. Therefore, it is necessary to develop a method for preparing a high-stability, low-allergenic cell culture meat scaffold that is simple to operate. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a method for preparing a 3D cell culture meat scaffold with high stability and low allergenicity. The present invention utilizes environmentally friendly green materials, marine source food raw materials fish gelatin and sodium alginate, is simple and convenient to operate, and does not require volatile hazardous organic reagents. It breaks through the limitations of traditional preparation methods and achieves high stability and excellent biocompatibility of cell culture meat scaffolds. At the same time, a low-allergenic cell culture meat scaffold material is prepared for the first time. The present invention provides new technical means and ideas for the development of high-stability, low-allergenic or non-allergenic cell culture meat scaffolds, which is conducive to ensuring the high-quality and rapid development of the cell culture meat industry.

[0007] The present invention provides a method for preparing a high-stability, low-allergenic cell culture meat scaffold, comprising the following steps:

[0008] (1) dissolving fish gelatin at 40-70° C. to obtain a fish gelatin solution;

[0009] (2) mixing the fish gelatin solution obtained in step (1) with sodium alginate to obtain a mixed solution, stirring and mixing the solution thoroughly, and reacting the solution at a high temperature for 20-60 minutes to prepare a covalent complex of sodium alginate and fish gelatin;

[0010] (3) The sodium alginate and fish gelatin covalent complex obtained in step (2) is cooled and formed, and then a calcium chloride solution with a mass concentration of 2% is added for low-temperature solidification to obtain a cell culture meat scaffold.

[0011] In one embodiment of the present invention, in step (1), the fish gelatin solution is a transparent colorless liquid.

[0012] In one embodiment of the present invention, in step (1), the fish gelatin is facilitated to be fully dissolved at 40-70°C, and the structure of the fish gelatin is unfolded, which is conducive to the covalent modification of the fish gelatin by sodium alginate.

[0013] In one embodiment of the present invention, in step (1), the mass concentration of the fish gelatin solution is 6-15%.

[0014] In one embodiment of the present invention, in step (2), the mass concentration of sodium alginate in the mixed solution is 0.25-4.00%, and more preferably 1.00-2.00%.

[0015] In one embodiment of the present invention, in step (2), the fish gelatin solution is mixed with sodium alginate and then heated at 90° C. for 20-60 min.

[0016] In one embodiment of the present invention, in step (3), the cooling molding and low-temperature curing refer to ice water bath conditions at 4°C.

[0017] In one embodiment of the present invention, in step (3), the volume of the added calcium chloride solution is 3-6 times the volume of the covalent complex, to ensure that the calcium chloride can be fully cross-linked with the sodium alginate.

[0018] In one embodiment of the present invention, in step (3), the cooling molding refers to the sodium alginate and fish gelatin covalent complex presenting a non-flowing solid state.

[0019] The present invention provides a cell culture meat scaffold prepared by the above method.

[0020] The present invention provides a cell-cultured meat, which comprises the cell-cultured meat scaffold described above and cells attached thereto.

[0021] In one embodiment of the present invention, the cell is an animal cell, which is one or more of a muscle cell, a fat cell, a fibroblast, a mesenchymal stem cell, or a pluripotent stem cell, such as a muscle satellite cell or adipose-derived stem cell.

[0022] The present invention provides a method for preparing cell cultured meat, which specifically comprises the following steps:

[0023] (1) sterilizing the above-mentioned cell culture meat scaffold with high temperature and high pressure to obtain a sterile cell culture meat scaffold;

[0024] (2) adding high-glucose DMEM medium to the sterile cell culture scaffold to swell it, and after swelling equilibrium, aspirating the medium;

[0025] (3) Cells were inoculated on a cell culture meat scaffold, and cell adhesion, proliferation and differentiation were carried out in a 37° C. 5% carbon dioxide environment to prepare cell culture meat.

[0026] In one embodiment of the present invention, in step (1), high pressure sterilization refers to placing the cell culture scaffold in a sterilizer at 121° C. and 0.1 MPa for 20 minutes to kill microorganisms that affect cell growth.

[0027] In one embodiment of the present invention, in step (2), the volume ratio of the high-glucose DMEM culture medium to the scaffold is 3 to 6:1, until the color of the hydrogel scaffold is close to the color of the culture medium.

[0028] In one embodiment of the present invention, in step (3), the inoculation cell density is 2×10 5 -1×10 6 / mL, add 2mL of cells into a 6-well plate as a reference, and change the volume in proportion to the size of the well plate.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] (1) The present invention prepares a sodium alginate and fish gelatin covalent complex by mixing sodium alginate of different concentrations with fish gelatin solution, and performs covalent modification under high temperature conditions (90°C) to prepare a fish gelatin sodium alginate cell culture meat scaffold. The raw materials required for the preparation of the scaffold are green and environmentally friendly, and do not require cross-linking with volatile organic reagents such as glutaraldehyde. While ensuring stability and biocompatibility, a low-allergenic cell culture meat scaffold is prepared for the first time. Unlike existing reports, the present invention prepares a low-allergenic cell culture meat scaffold for the first time while ensuring high stability and excellent biocompatibility of the scaffold. The preparation method is simple and fast and can be achieved without expensive instruments and equipment. Unlike the prior art (CN113892643A), CN113892643A mainly obtains the complex by stirring the reaction at room temperature for more than 2 hours. It mainly prepares a porous scaffold material by cross-linking alginate and gelatin through electrostatic interaction. The main interaction between sodium alginate and gelatin is non-covalent interaction, which cannot shield allergen epitopes, and therefore cannot reduce allergenicity by shielding allergen epitopes.

[0031] (2) The sodium alginate fish gelatin cell culture meat scaffold prepared by the present invention has higher thermal stability and mechanical properties than the cell culture meat scaffold of fish gelatin alone. Fish gelatin alone is in a liquid state at 37°C and is insufficient to provide support for cells. Sodium alginate covalent crosslinking combined with calcium ion solidification makes the gel an irreversible gel.

[0032] (3) The gel strength of fish gelatin alone is 314.96 g, and the gel strength of the fish gelatin-based cell culture meat scaffold after sodium alginate covalent modification is about 889.50 g, and the gel strength is increased by about 282.42%.

[0033] (4) Sodium alginate covalent modification significantly improved the hydrophilicity of the cell culture scaffold material, and the contact angle decreased from 74.64° to 50.17°, which was more conducive to improving the adhesion of C2C12 cells on the scaffold.

[0034] (5) The gelatin-based cell culture scaffolds covalently modified with sodium alginate can ensure sufficient stability and excellent biocompatibility, providing a growth and metabolic environment for the normal adhesion, proliferation, and differentiation of C2C12 cells.

[0035] (6) Sodium alginate covalent modification can significantly reduce the allergenicity of fish gelatin while ensuring the performance of the scaffold, including the allergic symptoms of mice, specific IgE binding ability, and histamine release.

[0036] (7) Covalent modification of sodium alginate can protect the intestinal barrier function of mice and thus reduce the risk of allergies caused by fish gelatin.

[0037] (8) Covalent modification of sodium alginate can reduce sensitization by regulating the balance between Th1 and Th2 cytokines.

[0038] (9) The characteristic feature of low allergenicity of cell cultured meat scaffolds was further verified based on the RBL-2H3 cell degranulation model.

[0039] (10) The raw materials required for the cell culture meat scaffold are environmentally friendly, green, low-cost, simple to operate, and do not require special instruments and equipment. The preparation of high-stability and low-sensitivity cell culture meat scaffolds can be achieved. The present invention is conducive to ensuring the high-quality development of the cell culture meat industry, and its market is considerable and has huge potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 It is the physical pictures, gel strength and contact angle results of Examples 1-5 and Comparative Example 1 sodium alginate fish gelatin hydrogel;

[0041] Figure 2 The adhesion and proliferation behaviors of C2C12 cells on the hydrogel scaffold of Example 1-5;

[0042] Figure 3 is the differentiation behavior of C2C12 cells on the hydrogel scaffold of Example 1-5;

[0043] Figure 4 This is a morphology image of a printed scaffold prepared from a fish gelatin sodium alginate covalent complex in Example 1-5;

[0044] Figure 5 This is a laser confocal microscopy image of the cytoskeleton of the 3D printed scaffold prepared by the fish gelatin sodium alginate covalent complex in Example 1 after inoculation of cells;

[0045] Figure 6It is a diagram of the process of establishing the sensitization model of BALB / c mice;

[0046] Figure 7 The effect of sodium alginate covalent modification on the IgE binding capacity of fish gelatin-based cell culture meat scaffolds in Example 1-5;

[0047] Figure 8 The effect of sodium alginate covalent modification on histamine release in mice in Example 1-5;

[0048] Fig. 9 The effect of sodium alginate covalent modification on the balance of Th1 and Th2 cytokines in mouse spleen in Example 1-5;

[0049] Fig.10 The effect of sodium alginate covalently modified fish gelatin on the intestinal barrier function of mice in Example 1-5;

[0050] Fig.11 The effect of sodium alginate covalent modification on the release rate of β-hexosidase in RBL-2H3 cells in Example 1-5;

[0051] Fig.12 The covalent modification sites and shielding allergen epitopes of the major allergen Fibrillar collagen NC1 domain-containing protein in fish gelatin of Examples 1-5 are shown. DETAILED DESCRIPTION

[0052] In order to better understand the present invention, the high stability and low allergenicity characteristics of the present invention are further described below in conjunction with specific examples, but the protection scope of the present invention is not limited thereto.

[0053] Fish gelatin was purchased from Shanghai Yuanye Biotechnology Co., Ltd., sodium alginate was purchased from Aladdin Biochemical Technology Co., Ltd., C2C12 cells were purchased from Pronocell Life Science Co., Ltd., high-glucose DMEM medium, fetal bovine serum, and double-antibody were purchased from Wuhan Sewell Biotechnology Co., Ltd., and BALB / c mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd.

[0054] Example 1: Preparation and physical characterization of fish gelatin-based cell culture scaffold

[0055] (1) Preparation of gelatin solution: fish gelatin was used as raw material, fish gelatin was weighed and dissolved in deionized water, and heated to dissolve at 70° C. for 20-60 min to make the gelatin solution into a transparent and clear liquid state. The mass concentration of the prepared fish gelatin solution was 12%.

[0056] (2) Add 1 wt % sodium alginate powder to the fish gelatin solution, dissolve and mix, and heat at 90° C. for 30 min to obtain a fish gelatin sodium alginate covalent complex.

[0057] (3) Pour the fish gelatin sodium alginate covalent complex into a mold, cool it in an ice water bath at 4°C to form it, and then add 2% pre-cooled calcium chloride solution for solidification treatment. The calcium chloride solution is 3-6 times the volume of the covalent complex to obtain a sodium alginate fish gelatin cell culture meat scaffold.

[0058] Example 2

[0059] The preparation method is the same as that in Example 1, except that the addition amount of sodium alginate is 0.25 wt %.

[0060] Example 3

[0061] The preparation method is the same as that in Example 1, except that the addition amount of sodium alginate is 0.50 wt %.

[0062] Example 4

[0063] The preparation method is the same as that in Example 1, except that the addition amount of sodium alginate is 2.00 wt %.

[0064] Example 5

[0065] The preparation method is the same as that in Example 1, except that the addition amount of sodium alginate is 4.00 wt %.

[0066] Comparative Example 1

[0067] The preparation method is the same as that of Example 1, except that the addition amount of sodium alginate is 0%.

[0068] Comparative Example 2

[0069] Fish gelatin is used as a raw material, the fish gelatin is weighed and dissolved in deionized water, and heated and dissolved at 70° C. for 20-60 minutes to make the gelatin solution become a transparent and clear liquid state, and gel (FG) is obtained by cooling.

[0070] The gel strength of the cell culture meat scaffold was tested using a TA.XT.PLUS physical property analyzer, with a p / 0.5 probe, a test speed of 1 mm / s, a compression ratio of 50%, and a trigger force of 5 g.

[0071] The prepared cell culture meat scaffold was vacuum freeze-dried, ground into powder with a pulverizer, and prepared into round tablets with a diameter of 1 cm and a thickness of 2 mm using a thin film tablet press. The tablets were gently placed on the sample table, and 2 μL of water droplets were deposited on the surface of the tablets with a high-precision syringe. After balancing for 10 seconds, the contact angle of the cell culture meat scaffold sample was automatically obtained using an optical contact angle measurement profile analysis system (SCA20, DataPhysics Instruments, Germany).

[0072] The appearance of fish gelatin-based hydrogel cell culture scaffold is shown below Figure 1 As shown in a, the gel strength of the hydrogel scaffold is Figure 1 c, it can be seen that the gel strength of the fish gelatin cell culture meat scaffold alone is 314.96g, and the gel strength of the fish gelatin-based cell culture meat scaffold after sodium alginate covalent modification is as high as 889.50g, and the gel strength is increased by about 282.42%. It can be seen that sodium alginate covalent modification can significantly improve the mechanical strength of the cell culture meat scaffold and ensure the stability of the scaffold. In order to further analyze the effect of sodium alginate covalent modification on the cell adhesion properties of fish gelatin-based cell culture meat scaffolds, the contact angle results are presented in Figure 1 b and 1d, it can be seen that the contact angles of all samples are less than 90°, indicating that they are hydrophilic materials and can provide hydrophilic targets for cell adhesion. At the same time, it was found that sodium alginate covalent modification significantly reduced the contact angle of the cell culture meat scaffold, increased its hydrophilicity, and was more conducive to cell adhesion and proliferation. Example 1 confirms that sodium alginate covalent modification is an effective means to enhance and improve the performance of fish gelatin-based cell culture meat scaffolds.

[0073] Example 6: Evaluation of biocompatibility of fish gelatin-based cell culture scaffolds

[0074] (1) The scaffolds prepared in Examples 1 to 5 and Comparative Example 1 were placed in a high pressure sterilizer and sterilized at 121° C. and 0.1 MPa for 20 min to obtain a sterile cell culture scaffold.

[0075] (2) Adding high-glucose DMEM medium to the sterile cell culture meat scaffold obtained in step (1) to swell the scaffold, adding high-glucose DMEM medium more than three times the volume of the scaffold to the sterile cell culture meat scaffold to swell the scaffold, and aspirating the medium after swelling equilibrium.

[0076] (3) The hydrogel scaffold was prepared in a well plate, and C2C12 cells in the logarithmic growth phase were inoculated on the scaffold. The cell viability was measured using a CCK-8 kit for 24 hours.

[0077] (4) The hydrogel scaffold was placed in a sterile environment and C2C12 cells in the logarithmic growth phase were cultured at a density of 2×10 5 -1×106 Cells were inoculated with 100 μg / mL of culture medium on a cell culture scaffold, and proliferation medium (10% fetal bovine serum + 1% double antibody + 89% DMEM high glucose medium) was added for adhesion and proliferation culture. The medium was replaced every 24 hours in a culture environment of 37°C and 5% carbon dioxide.

[0078] When the confluence of C2C12 cells on the scaffold reached about 80%, Trizol lysis solution was added, and total mRNA was extracted according to the reagent instructions. After extraction, the concentration of mRNA was determined by NanoDrop (Thermo Fisher Scientific), and the concentration of mRNA was adjusted to be consistent using sterile enzyme-free water. Reverse transcription and amplification were performed according to the instructions of Evo M-MLV Reverse Transcription Kit II and SYBR GreenPro Taq HS Premixed qPCR Kit to detect the mRNA expression of N-Cadherin. N-Cadherin protein is an intercellular adhesion protein that mainly plays a role in intercellular connection. The forward sequence from the 5' end to the 3' end of the N-Cadherin primer is ACAATGGAATCCCGCCTATG, and the reverse sequence is GGTCTATGTCATAATCAAGTGCTGTG, which is normalized with GADPH.

[0079] Observation of cytoskeleton morphology: The cells on the scaffold were fixed with 4% paraformaldehyde fixative for 30-60 minutes, washed three times with PBS, and then permeabilized with 0.1% Trition X-100 in PBS buffer for 30 minutes. The cells were stained with FITC-labeled phalloidin for 30 minutes, and then the cell nuclei were counterstained with DAPI. After 10 minutes, the cells were observed using a fluorescent upright or inverted microscope.

[0080] In order to explore the cytotoxicity of cell culture scaffold materials, CCK-8 kit was used to detect cell viability. The results are as follows Figure 2 As shown in the results, the cell viability of all samples was basically maintained at around 95%, indicating that the cell culture fish meat scaffold material was non-toxic and harmless. Subsequently, RT-qPCR was used to characterize the expression level of N-cadherin mRNA in the cells, and it was found that 1% sodium alginate covalent modification could significantly increase the expression of N-cadherin and enhance the adhesion ability of cells. At the same time, the cytoskeleton staining results showed that the sodium alginate fish gelatin-based cell culture meat scaffold was suitable for cell adhesion and proliferation, showing an obvious cytoskeleton structure, especially when the sodium alginate addition was greater than 1%, the cytoskeleton structure was more obvious, and it was more suitable as a cell culture meat scaffold material.

[0081] When the cell confluence reached about 80%, the hydrogel cell culture scaffold was transferred to the differentiation medium (2% horse serum + 1% double antibody + 93% DMEM high glucose medium) to induce differentiation until obvious myotube structure was formed. Figure 3 This is a bright field microscope image of C2C12 cells after 7 days of differentiation on the scaffold. It can be seen that the differentiated cells adhere and fuse to form myotube structures. RT-qPCR found that sodium alginate covalent modification can significantly increase the mRNA expression level of differentiation-related gene desmin, confirming that the cell culture scaffold prepared by sodium alginate covalent modification can provide suitable conditions for cell differentiation.

[0082] Example 7: Proving that the fish gelatin sodium alginate covalent complex has excellent printability through 3D printing technology

[0083] The prepared fish gelatin sodium alginate covalent complex is poured into the biological ink container of the cell 3D printer as 3D printing ink. The nozzle temperature is set at about 25°C, the platform temperature is 10°C, the printing size is 18mm*18mm, the angle is 90°, the edge width is 1.5mm, the first layer height is 0.2mm, the spacing is 1.2mm*1.2mm, the printing speed is 700mm / min, the edge speed is 650mm / min, and the printing pressures of FG, 0.25%, 0.50%, 1.00%, 2.00% and 4.00% samples are 150KPa, 200KPa, 200KPa, 350KPa, 450KPa, and 700KPa respectively. After the automatic printing is completed, the calcium chloride is solidified to obtain the 3D printed cell scaffold. Figure 4 This is the appearance of the 3D printed scaffold. It can be seen that all samples are printable, and the scaffold structure is clear and the outline is stable, indicating that the sodium alginate fish gelatin scaffold can realize the 3D culture of cells and provide a growth and metabolic environment for cells. Taking 1% of the 3D printed scaffold as an example, after inoculating cells, the cells adhered and proliferated and the cytoskeleton was stained. The spatial distribution was scanned using a laser confocal microscope. The results are shown in Figure 2. Figure 5 As shown, it can be seen that cells can achieve three-dimensional distribution on the scaffold, proving that sodium alginate fish gelatin scaffold is expected to become an ideal material for cell culture meat scaffold.

[0084] Example 8: Evaluation of the allergenicity of fish gelatin-based cell culture scaffolds based on the BALB / c mouse sensitization model

[0085] (1) The prepared fish gelatin-based scaffold is freeze-dried, then pulverized using a grinder, and stored at -20°C for later use.

[0086] (2) The potential allergenicity of the cell cultured meat scaffolds was evaluated by establishing a BALB / c mouse sensitization model. The powdered scaffold samples dissolved in normal saline were used as allergens for gavage stimulation of BALB / c mice. The gavage dose was 6 mg of fish gelatin sample each time. The gavage regimen was as follows: Figure 6 BALB / c mice were randomly divided into groups and fed adaptively for one week before the formal experiment. Each group of mice was gavaged with fish gelatin five times on days 0, 7, 14, 21, and 28 of the formal experiment.

[0087] (3) On the 42nd day after sensitization, blood was collected from the medial canthal vein of the eye. After standing for 30 minutes, the blood was centrifuged at 5000 rpm and 4°C for 10 minutes. The upper layer of serum was aspirated for the determination of serum-specific IgE.

[0088] (4) Method for determination of serum specific IgE: Different concentrations of sodium alginate covalently modified fish gelatin were prepared into 10 μg / mL protein solution with 0.05 M sodium carbonate buffer (pH 9.6), and 100 μL of protein solution was coated on each well of a 96-well plate. After coating at 4°C for 12 h, the liquid in the well was poured out, and 250 μL of 0.1% BSA-Tween 20 PBS washing solution was added to each well. The well was shaken at room temperature for 5 min, and then dried and tapped on dust-free absorbent paper several times until there was no obvious liquid in the well. The above steps were repeated 3 times; 150 μL of 1% BSA-Tween 20 was added to the well plate. The plate was blocked with BSA-PBS buffer at 37°C for 2h, and the plate was washed 3 times; 100μL of the corresponding allergic mouse serum diluted 1:5 was added to each well, and the normal saline group mouse serum was added to the control group, incubated at 37°C for 2h, washed and patted dry 6 times; 100μL of biotin-labeled rat anti-mouse IgE (1:1000) was added to each well, incubated at 37°C for 1h, washed and patted dry 6 times; then 100μL of HRP-labeled streptavidin (1:2000) was added to each well, incubated at 37°C for 1h, washed and patted dry 6 times; 100μL of TMB colorimetric solution was added, and the plate was reacted at 37°C in the dark for 5min; 50μL of 2N H2SO4 stop solution was added, and the absorbance value was immediately measured at a wavelength of 450nm. The results of serum-specific IgE are shown in the figure. Figure 7 As shown in the figure, it can be seen that the IgE content in the serum of mice in the oral fish gelatin group was higher than that in the saline group, indicating that fish gelatin has potential allergenicity. Sodium alginate covalent modification of fish gelatin can significantly reduce the content of specific IgE in mouse serum, indicating that sodium alginate covalent modification is an effective technology to reduce the allergenicity of fish gelatin-based cell culture scaffolds.

[0089] (5) On the 43rd day of the sensitization model, the mice were gavaged with a 5-fold dose (0.030 g) for symptom observation. After 30 minutes, blood was collected from the medial canthal vein of the eye, centrifuged, and plasma was collected. The histamine content was determined according to the instructions. The mice were then euthanized by dislocation, and their spleens were taken for RT-qPCR to explore the balance of Th1 and Th2 cytokines. The primer sequences are shown in Table 1.

[0090] Table 1 Primer sequences

[0091]

[0092] The results of histamine determination were as follows Figure 8 As shown, it can be seen that sodium alginate covalent modification can significantly reduce the histamine content in mouse plasma. Compared with the fish gelatin group, when the sodium alginate addition amount was 1%, the release of mouse histamine decreased by about 54.35%. When an allergic reaction occurs, the homeostasis of the mouse body is broken, which is usually manifested as excessive secretion of Th2 antibodies and insufficient secretion of Th1 antibodies. Fig. 9 It can be seen that sodium alginate covalent modification can significantly reduce the mRNA gene expression of Th2 antibody (IL-4) and restore the expression of Th1 antibody (IFN-γ). Sodium alginate covalent modification can achieve the effect of reducing sensitization by regulating the balance of Th1 and Th2 cytokines in mice.

[0093] Example 9: Investigating the effect of sodium alginate covalent modification on the intestinal barrier function of mice based on the BALB / c mouse sensitization model

[0094] Three mice were randomly selected from different groups of mice and gavaged with 80 mg / kg body weight of FITC-labeled glucose (FITC-Dextran). Four hours later, five times the dose (0.030 g gelatin) was gavaged for a large stimulation. Four hours later, blood was collected from the orbits into a centrifuge tube containing EDTA-K2. After standing for 30 minutes, the plasma was collected by centrifugation. The serum of each group was drawn into a 96-well fluorescence enzyme plate, and the fluorescence values ​​at the excitation wavelength of 493 nm and the emission wavelength of 518 nm were measured. The remaining mice were subjected to the scheme of step (5) of Example 8 to obtain their jejunum for histopathological observation. The results of mouse intestinal wall permeability are shown in Figure 2. Fig.10 As shown in a, it can be seen that sodium alginate covalent modification can significantly reduce the permeability of the mouse intestinal wall and reduce the entry of allergens, thereby achieving the purpose of low sensitization. The results of mouse jejunum HE staining showed that the jejunal villi of the mice in the normal saline group were arranged tightly and orderly, while the jejunal villi of the mice in the gavage fish gelatin group were relatively sparse and slightly broken. The villi breakage phenomenon of the mice in the gavage fish gelatin group with sodium alginate covalent modification was significantly improved, further confirming that sodium alginate covalent modification can reduce sensitization by protecting the intestinal barrier of mice.

[0095] Example 10: Establishment of a degranulation model based on rat basophilic leukemia cells (RBL-2H3) to evaluate the sensitization of fish gelatin-based scaffolds

[0096] RBL-2H3 cells in the logarithmic growth phase were taken and 1×10 5 The cells were inoculated into a 96-well cell culture plate, and the cells were cultured for 24 hours. The cells were washed with PBS buffer, and then 100 μL of mouse allergic serum diluted with MEM without fetal bovine serum was added to each well of the 96-well plate. After 24 hours, the allergic serum was aspirated and washed three times with modified benchtop buffer (135 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 20 mM HEPES, 5.6 mM glucose, 0.05% bovine serum albumin [pH 7.4]), and 50 μL of allergens prepared with benchtop buffer solution were added in sequence, with concentrations of 0.01, 0.1, 1, 10 and 100 ng / mL, respectively. The reaction was carried out in a constant temperature incubator for 45 minutes, and the cells were immediately placed in an ice box to terminate the reaction. 30 μL of the supernatant after the reaction was terminated was taken and 50 μL of 1 mmol / L 4-nitrophenyl Nacetyl-β-D-glucosaminide citric acid buffer solution was added to react at 37°C for 1 hour. The negative control group was the absorbance obtained after the cells were treated with modified benchtop buffer instead of the corresponding allergens, and the positive control group was the absorbance value obtained after the cells were treated with 1% Trition X-100 instead of the allergens. β-hexosaminidase release rate = [absorbance of the sample group - absorbance of the negative control group) / (absorbance of the total release group - absorbance of the negative control group)] × 100%. The results of β-hexosaminidase release rate are shown in Fig.11 As shown, the release rate of β-hexosaminidase from RBL-2H3 cells decreased from 27.50% to 11.31% after sodium alginate covalent modification, with a decrease of 243.10%. This step confirms that sodium alginate covalent modification is an effective means to reduce the sensitization of cell culture scaffolds.

[0097] Example 11: Identification of the shielding of fish gelatin allergen epitopes by sodium alginate based on LC-MS / MS technology combined with bioinformatics analysis

[0098] Taking the fibrillar collagen NC1 domain-containing protein in fish gelatin as an example, the covalent modification of sodium alginate to mask allergen epitopes was explored. The fish gelatin sodium alginate covalent modification sample with pH = 8 was prepared with 8M urea and 1M triethylammonium bicarbonate buffer (TEAB). 100 microliters of sample was added with 2μL 0.5M trichloroethyl phosphate (TCEP) and reacted at 37°C for 1h, followed by 4μL 1M iodoacetamide (IAM) and reacted at room temperature in the dark for 40min. Then, pre-cooled acetone was added according to the sample: acetone (volume ratio) of 1:5, and precipitation was carried out at -20°C overnight. Then, high-speed centrifugation (12000g, 20min, 4°C) was performed and the supernatant was discarded. 1mL of -20°C pre-cooled 90% acetone solution was added, and the sample was vortexed and washed, and then high-speed centrifugation (12000g, 20min, 4°C) was performed again to discard the supernatant, and the washing step was repeated twice. After drying at room temperature until the acetone on the surface of the precipitate is completely evaporated, it is redissolved in 100 μL 100 mM triethylammonium bicarbonate buffer (TEAB), and pancreatin is added at an enzyme: protein (mass ratio) of 1:50, and enzymatic hydrolysis is carried out at 37°C overnight. Desalting is performed using a C18 desalting column and then freeze-dried. The mass spectrometer is operated in data-dependent acquisition mode, automatically switching between MS and MS / MS acquisition. The mass spectrometry parameters were set as follows: (1) MS: scan range (m / z): 350-1500; resolution: 60,000; Normalized AGC target: 300%; maximum injection time: 25 ms; (2) HCD-MS / MS: resolution: 15,000; Normalized AGC target: 50%; maximum injection time: 22 ms; collision energy: 30%; dynamic exclusion time: 30 s. The tandem mass spectra were analyzed by PEAKS Studio version 10.6 (Bioinformatics Solutions Inc., Waterloo, Canada). The database was uniprot-Oreochromis_niloticus (version 2023, 28040 entries), and trypsin digestion and semi-enzyme digestion were set. The search parameters were fragment ion mass tolerance: 0.02 Da, parent ion mass tolerance: 10 ppm, protein card value was 1% FDR, containing at least 1 unique peptide; peptide card value was 1% FDR. A series of covalent modification sites were obtained by utilizing the mass-to-charge ratio shift of proteins.The protein sequences obtained by LC-MS / MS were used to predict allergen epitopes by using five bioinformatics softwares, DNAStar, AntheProt, BCpred, Immunomedicine Group, and BepiPred 1.0. The epitopes predicted by more than or equal to three softwares were regarded as allergen linear antigen epitopes, and the predicted allergen epitopes were marked by gray shading. Fig.12 The results of the allergen linear epitopes were compared with the covalent modification sites to obtain the number of allergen epitopes shielded by sodium alginate covalent modification. Fig.12 As shown, the circle represents the covalent modification site of the sample with 0.50% sodium alginate addition, the star represents the covalent modification site of the sample with 1.00% sodium alginate addition, the triangle represents the covalent modification site of the sample with 2.00% sodium alginate addition, and the rectangle represents the covalent modification site of the sample with 4.00% sodium alginate addition. Fig.12 It can be seen that the addition of 0.50%, 1.00%, 2.00% and 4.00% sodium alginate successfully achieved covalent modification on fish gelatin, and the number of covalent modification sites located on the allergen epitope was 41, 54, 44 and 35, respectively. When the addition amount of sodium alginate was 1.00% and 2.00%, there were relatively more shielding sites, so its allergenicity was relatively low.

[0099] The embodiments provided above are not intended to limit the scope of the present invention, and the steps described are not intended to limit the execution order thereof. Those skilled in the art may make obvious improvements to the present invention in combination with existing common knowledge, which also fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for preparing a cell culture meat scaffold, characterized in that: The steps include: (1) dissolving fish gelatin in deionized water to obtain a fish gelatin solution; (2) mixing the fish gelatin solution with sodium alginate to obtain a mixed solution, and reacting the solution at 90° C. to prepare a covalent complex of sodium alginate and fish gelatin; (3) The sodium alginate and fish gelatin covalent complex obtained in step (2) is cooled and formed, and then a calcium chloride solution is added to solidify it to obtain a cell culture meat scaffold.

2. The method for preparing a cell culture meat scaffold according to claim 1, characterized in that: In step (1), fish gelatin is dissolved at 40-70°C.

3. The method for preparing a cell culture meat scaffold according to claim 1, characterized in that: In step (1), the mass concentration of the fish gelatin solution is 6-15%.

4. The method for preparing a cell culture meat scaffold according to claim 1, characterized in that: In step (2), the mass concentration of sodium alginate in the mixed solution is 0.25-4.00%.

5. The method for preparing a cell culture meat scaffold according to claim 1, characterized in that: In step (2), the fish gelatin solution is mixed with sodium alginate and then heated at 90° C. for 20-60 minutes.

6. The method for preparing a cell culture meat scaffold according to claim 1, characterized in that: In step (3), the mass concentration of the calcium chloride solution is 2%; the volume of the added calcium chloride solution is 3-6 times the volume of the covalent complex.

7. A cell culture meat scaffold prepared by the method according to any one of claims 1 to 6.

8. A cell cultured meat, characterized in that: The cell-cultured meat comprises the cell-cultured meat scaffold of claim 7 and cells attached thereto.

9. The cell cultured meat according to claim 8, characterized in that: The cells are animal cells.

10. The cell cultured meat according to claim 9, characterized in that: The animal cells are one or more of muscle cells, fat cells, fibroblasts, mesenchymal stem cells, and pluripotent stem cells.

Images