In vivo differentiable CAR stem cells and uses thereof

Abstract

The invention provides a CAR stem cell capable of being differentiated in vivo. The CAR stem cell comprises an antigen binding structural domain, a hinge structural domain, a signal peptide, a transmembrane structural domain and a signal activation structural domain, the antigen binding structural domain comprises scFv of NCAM (Non-Content Addressable Memory), Caveolin-3, LHFPL5, FAP (Fibroblast Amplification Protein 5) or CD248; the hinge structural domain comprises CD8, IgG1, IgG4 or CD28; the signal peptide, the transmembrane domain and the signal activation domain comprise FGFR1 (Fibroblast Growth Factor Receptor), VEGFR2 (Vascular Endothelial Growth Factor Receptor), EGFR (Epidermal Growth Factor Receptor), NGFR (Natural Growth Factor The stem cells are subjected to gene editing so as to express CAR, and the stem cells can be endowed with the ability of targeted localization of deleted cells; an intracellular activation structural domain for enhancing stem cell differentiation capability is matched, and a gene for increasing stem cell activity and service life is introduced; and the in-vivo differentiation of the stem cells can be realized by depending on the specific growth environment of the target cells.

Description

Technical Field

[0001] The present invention relates to the technical field of medical immunology, and more specifically, to CAR stem cells that can be differentiated in vivo and uses thereof. Background Art

[0002] Stem cells are a type of primitive undifferentiated cells with self-renewal and differentiation potential. They can differentiate into specific types of functional cells to supplement and repair missing cells in the human body. They can also secrete exosomes to regulate various physiological processes such as repair, regeneration, and anti-inflammation. Mesenchymal stem cells, induced pluripotent stem cells, and embryonic stem cells are several commonly used types of stem cells. Among them, mesenchymal stem cells have a slightly weaker differentiation ability, mainly differentiating into mesoderm lineage cells, and have a certain cross-germ layer ability; but its excellent safety and exosome secretion ability make it widely used in clinical practice. Induced pluripotent stem cells and embryonic stem cells have excellent differentiation ability and can differentiate into cells of any germ layer lineage; but their safety is not as good as mesenchymal stem cells, and they are mainly in the exploration stage in clinical practice.

[0003] Although stem cells can differentiate into a variety of functional cells in vitro, only a very small number of stem cells directly injected back into the body can differentiate into target cells, and most of them rely on exosomes secreted by stem cells to stimulate the repair and regeneration of original cells. The therapeutic effect on cells that cannot regenerate, such as myocardium and neurons, is weak. This may be due to the weak targeting ability and short lifespan of stem cells, which make it impossible for them to be located at the target cells for a long time; and differentiation is a slow process, making it difficult to achieve differentiation in vivo. Cells that have been successfully differentiated in vitro have disadvantages such as poor infiltration, low integration, and low similarity, making it difficult for them to infiltrate into the site where cells are missing and perform normal functions.

[0004] Chimeric antigen receptor (CAR) is an artificially designed structure that is synthesized and anchored on the cell membrane, which includes an antigen binding domain, a hinge domain, a transmembrane domain, and an intracellular activation domain. The antigen binding domain is specific, allowing cells to specifically target target cell antigens; the transmembrane domain can anchor the CAR structure on the cell membrane; the hinge domain is used to connect the antigen binding domain and the transmembrane domain; the intracellular activation domain is used to transmit signals and activate cells. Therefore, introducing the CAR structure into stem cells can enable it to be localized in the target cell for a long time, which is beneficial to the differentiation of stem cells. However, CAR is currently mainly used in immune cells, and its intracellular activation domain is mainly used to induce immune processes such as cell killing and antigen presentation. Stem cells are mainly used for repair, regeneration, and differentiation, and do not have immune killing capabilities, nor do they express the intracellular domains commonly used by CAR immune cells. Directly applying the CAR structure of immune cells has poor results. Summary of the invention

[0005] On the one hand, the present invention provides the following technical solutions:

[0006] CAR stem cells that can be differentiated in vivo, including an antigen binding domain, a hinge domain, a signal peptide, a transmembrane domain, and a signal activation domain;

[0007] The antigen binding domain includes scFv of NCAM, Caveolin-3, LHFPL5, FAP or CD248;

[0008] The hinge domain includes CD8, IgG1, IgG4 or CD28;

[0009] The signal peptide, transmembrane domain and signal activation domain include FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR or HGFR.

[0010] On the other hand, the present invention provides the following technical solution:

[0011] Method for preparing CAR stem cells that can differentiate in vivo,

[0012] 1) Obtaining stem cells; the stem cells include mesenchymal stem cells or induced pluripotent stem cells;

[0013] 2) introducing a nucleic acid encoding CAR into stem cells to obtain CAR stem cells; wherein the CAR stem cells include an antigen binding domain, a hinge domain, a signal peptide, a transmembrane domain and a signal activation domain;

[0014] The antigen binding domain includes scFv of NCAM, Caveolin-3, LHFPL5, FAP or CD248;

[0015] The hinge domain comprises CD8, IgG1, IgG4 or CD28.

[0016] The signal peptide, transmembrane domain and signal activation domain include FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR or HGFR.

[0017] On the other hand, the present invention provides the following technical solution: the use of the above-mentioned in vivo differentiated CAR stem cells in the treatment of heart disease, muscle injury, neurodegenerative disease, diabetes, lung injury, liver disease or kidney disease.

[0018] The present invention develops a new CAR structure adapted to stem cells, and genetically edits stem cells to express CAR, which can give stem cells the ability to target missing cells and stably anchor them to the target cells; it is combined with an intracellular activation domain that enhances the differentiation ability of stem cells, and genes that increase stem cell activity and lifespan are introduced; and relying on the unique growth environment of the target cells, in vivo differentiation of stem cells can finally be achieved; in addition, the targeting target of CAR is determined by artificial design, so CAR stem cells have the potential to accurately locate any intended target cell, thereby treating a variety of cell loss diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Design and preparation of CAR stem cells of the present invention;

[0020] A: Schematic diagram of the structural design of the new CAR; B: The preparation process of CAR stem cells: After extracting mesenchymal stem cells or induced pluripotent stem cells, NK cells are expanded using culture medium; then lentivirus or LNP containing CAR nucleic acid is added to transfect stem cells, and CAR stem cells are finally obtained after further culture and expansion;

[0021] Figure 2 The CAR mesenchymal stem cells of the present invention successfully differentiate into cardiomyocyte-like cells in vivo and significantly improve ischemia-related heart diseases.

[0022] A: Representative images of Masson staining (red: cytoplasm, blue: collagen fibers); B: Quantitative analysis of the proportion of myocardial infarction area. MI: myocardial ischemia group; MSC: common mesenchymal stem cell treatment group; FAP-CAR-MSC-FGFR1: FAP-CAR mesenchymal stem cell group with FGFR1 signal activation domain; FAP-CAR-MSC-VEGFR2: FAP-CAR mesenchymal stem cell group with VEGFR2 signal activation domain; FAP-CAR-MSC-LRP5: FAP-CAR mesenchymal stem cell group with LRP5 signal activation domain; *P<0.05. DETAILED DESCRIPTION

[0023] The present invention will be further described with reference to the accompanying drawings.

[0024] This embodiment provides a CAR stem cell that can be differentiated in vivo. The CAR stem cell can be localized at different target cells according to the different antigen domain targets, and can differentiate into different types of cells by relying on the activation of the intracellular domain and the specific growth microenvironment of the target cells to treat a variety of cell loss diseases.

[0025] In some embodiments, CAR stem cells can differentiate into a variety of non-renewable cells. Neurons can be targeted by targeting NCAM (neuronal marker) to induce stem cells to differentiate into neurons; cardiomyocytes can be targeted by targeting Caveolin-3 (cardiomyocyte marker) to induce stem cells to differentiate into cardiomyocytes; auditory hair cells can be targeted by targeting LHFPL5 (hair cell marker) to induce stem cells to differentiate into auditory hair cells.

[0026] In other embodiments, CAR stem cells can also differentiate into a variety of regenerative cells by targeting other cell membrane-specific markers, such as lung, kidney, liver, skin, etc.

[0027] For tissues and organs that develop fibrotic lesions due to cell damage and loss, a large number of activated fibroblasts will appear at the site of cell damage and loss (i.e., the site of fibrosis), which can be specifically recognized by stem cells targeting FAP and CD248, thereby directly positioning at the site of cell damage and loss and differentiating into missing cells, which is more conducive to integration with the original tissue.

[0028] On the other hand, the present invention also develops a new CAR structure design adapted to CAR stem cells.

[0029] In some embodiments, the antigen binding domain is composed of a scFv of one of the above targets, which can specifically recognize and bind to target cells expressing the corresponding antigen; the hinge domain is composed of one of CD8, IgG1, IgG4, and CD28.

[0030] In addition, the signal peptide, transmembrane domain and signal activation domain are composed of the corresponding domains of tyrosine kinase receptors such as FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR, HGFR, and the corresponding domains of important signal transduction receptors such as LRP5, ER, and Notch. These structures can promote the differentiation of CAR stem cells, but there is a certain tendency. Among them, FGFR1, VEGFR2, EGFR and IGFR are more conducive to the differentiation of stem cells into myocardial, skeletal muscle, endothelial cells, etc.; NGFR is more conducive to the differentiation of stem cells into neural cells; HGFR is more conducive to the differentiation of stem cells into hepatocytes.

[0031] It should be noted that in the above technical solution, each protein includes all the domains. For example, FGFR1 has a signal peptide, a transmembrane domain and a signal activation domain in its protein structure, and the required fragments can be cut and used.

[0032] Preferably, activation genes that enhance cell viability and function and promote exosome secretion are added after the CAR structure, including one or more of HIF-1α, TFAM, miR-223-5p, CXCR4, and TSG-6.

[0033] Preferably, a suicide gene is added after the CAR structure, including one of herpes simplex virus thymidine kinase (HSV-TK), inducible caspase 9 (iCasp-9), and rituximab binding epitope.

[0034] On the other hand, the present invention provides a method for preparing CAR stem cells.

[0035] In some embodiments, the sources of stem cells include, but are not limited to, mesenchymal stem cells, induced pluripotent stem cells, embryonic stem cells, and other stem cells. Mesenchymal stem cells have a slightly weaker differentiation ability, mainly differentiating into mesoderm lineage cells, and have a certain ability to cross germ layers, but they have very good safety; induced pluripotent stem cells have a strong differentiation ability and can differentiate into cells of any germ layer lineage, but have a certain risk of tumorigenesis and pose a safety hazard; embryonic stem cells are currently less used in clinical practice due to ethical issues.

[0036] In other embodiments, mesenchymal stem cells are derived from human umbilical cord, umbilical cord blood, placenta, bone marrow and fat; induced pluripotent stem cells are derived from various human somatic cells and are obtained after reprogramming with Krüppel-like factor 4 (KLF4), SRY box transcription factor 2 (SOX2), octamer binding transcription factor (OCT4), c-Myc, NANOG and Lin28.

[0037] CAR stem cells can be obtained by introducing nucleic acid encoding CAR into stem cells using stable transfection such as lentivirus or retrovirus transfection, or transient transfection such as electroporation, LNP transduction, and chemical transfection.

[0038] Using stable transfection such as lentivirus or retrovirus transfection, or transient transfection such as electroporation, LNP transduction, or chemical transfection, one or more of the nucleic acids encoding HIF-1α, TFAM, miR-223-5p, CXCR4, and TSG-6 can be introduced into CAR stem cells to enhance cell viability and function and promote exosome secretion.

[0039] Using stable transfection such as lentivirus or retrovirus transfection; or transient transfection such as electroporation, LNP transduction, and chemical transfection, one of the nucleic acids encoding herpes simplex virus thymidine kinase (HSV-TK), inducible caspase 9 (iCasp-9), and rituximab binding epitopes is introduced into CAR stem cells, which can serve as a suicide gene.

[0040] On the other hand, the present invention also provides a method for using CAR stem cells.

[0041] Preferably, the specific method of use is as follows: CAR stem cells are transported into the body by intravenous injection: the injection volume is 1*10 5 -1*10 7 / kg; injection frequency is 1-4 times, injection cycle is 1-6 months / time. It can also be injected into the diseased area by in situ injection, the injection volume is 1*10 5 -1*10 7 The number of injections is 1-4 times, and the injection cycle is 1-6 months / time.

[0042] Preferably, after using small molecule induction drugs such as AP1903, the suicide gene induces apoptosis of CAR stem cells, thereby enhancing the safety of CAR stem cells and preventing safety hazards such as tumor formation.

[0043] In summary, the present invention has the following beneficial effects:

[0044] 1. The present invention provides a design and preparation method of a CAR stem cell that can be differentiated in vivo, and provides a corresponding target; it can be differentiated into various types of cells according to different targets;

[0045] 2. The present invention has developed various novel domains that promote CAR stem cell differentiation and distinguished them according to the differentiation tropism of different cell types;

[0046] 3. The present invention also provides activation genes that enhance the activity and function of CAR stem cells and promote exosome secretion, and designs suicide genes for CAR stem cells to increase safety.

[0047] 4. The CAR stem cells prepared by the present invention can undergo specific differentiation in vivo to supplement the body's missing renewable and non-renewable cells, thereby treating various tissue cell damage diseases such as heart disease, muscle injury, neurodegenerative diseases, diabetes, lung injury, liver disease, and kidney disease.

[0048] The specific embodiments of the present invention mainly include the preparation of CAR stem cells and corresponding treatment methods.

[0049] 1. Preparation of CAR stem cells (e.g. Figure 1 (shown)

[0050] 1. Obtaining stem cells

[0051] Acquisition of mesenchymal stem cells: Mesenchymal stem cells are extracted using the tissue block method. For umbilical cord, placenta and fat, cut into small pieces after collagenase digestion and evenly inoculate in cell culture bottles; culture them using STEMPRO MSC SFM mesenchymal stem cell GMP-grade culture medium. After one week, mesenchymal stem cells can crawl out of the tissue block and then undergo normal passage and expansion. For umbilical cord blood and bone marrow, single nuclei are extracted using lymphocyte separation fluid and directly inoculated into cell culture bottles, and cultured using STEMPRO MSC SFM mesenchymal stem cell GMP-grade culture medium; after 48 hours, non-adherent cells (various white blood cells) are removed to obtain high-purity mesenchymal stem cells. The culture environment is 37°C, 95% air, and 5% CO2.

[0052] Obtaining induced pluripotent stem cells: Dermal fibroblasts (or peripheral blood T cells, hematopoietic stem cells, bone marrow cells, renal tubular epithelial cells, keratinocytes and mesenchymal stem cells, etc.) are inoculated in Matrigel (1:200) coated cell plates, and six nucleic acids encoding reprogramming factors KLF4, SOX2, OCT4, c-Myc, NANOG and Lin28 are introduced into the source somatic cells using Sendai virus. After 24 hours, the cells are cultured in mTeSR1 medium containing 10μM ROCK inhibitor (Y27632), and 50nM miR-302 / miR-372 mimics are added to transfect the cells for 1 week. After removing the microRNA mimics, continue to culture for 2 weeks to obtain induced pluripotent stem cells. After that, monoclonal cells of iPSC are selected, and the expression of reprogramming factors is detected after amplification, and high-expressing cells are retained to purify induced pluripotent stem cells.

[0053] 2. Obtaining nucleic acid encoding novel CAR

[0054] The antigen binding domain of the new CAR is composed of single-chain antibodies (scFv) of cell membrane surface specific markers such as FAP, CD248, NCAM, Caveolin-3, and LHFPL5. ScFv consists of a heavy chain and a light chain of the corresponding antibody variable region, and the heavy chain and light chain are connected by a connecting peptide; the connecting peptide is a polymer of glycine and serine. The hinge domain is composed of one of CD8, IgG1, IgG4, and CD28. The signal peptide, transmembrane domain, and signal activation domain are composed of the corresponding domains of tyrosine kinase receptors such as FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR, and HGFR; as well as the corresponding domains of signal transduction receptors such as LRP5, ER, and Notch.

[0055] 3. Insertion of activation genes and suicide genes

[0056] After using PCR technology to obtain the nucleic acid of the activation gene and the suicide gene, it is connected to the CAR nucleic acid sequence by enzyme cutting and ligation technology, and the CAR, activation gene, and suicide gene are translated and expressed separately using T2A and P2A sequences to obtain nucleic acid encoding a new CAR. The activation gene includes: one or more of HIF-1α, TFAM, miR-223-5p, CXCR4, and TSG-6. The suicide gene includes: herpes simplex virus thymidine kinase (HSV-TK), inducible caspase 9 (iCasp-9), and one of the rituximab binding epitopes.

[0057] 4. Introducing CAR-encoding nucleic acid into stem cells

[0058] Stable transfection:

[0059] After obtaining the nucleic acid encoding the novel CAR, it is introduced into the transfer plasmid of the lentivirus or retrovirus (containing the genomic sequence of the lentivirus or retrovirus, etc.) by enzyme cutting and ligation, and then the virus is packaged. The transfer plasmid, packaging plasmid (containing lentivirus or retrovirus capsid protein, structural protein, etc.) and membrane protein plasmid (containing lentivirus or retrovirus outer membrane, etc.) are transfected into 293T cells together, and finally a packaged lentivirus or retrovirus containing the nucleic acid of the novel CAR is obtained.

[0060] Induce pluripotent stem cells or 3rd generation mesenchymal stem cells into 24-well plates. Add viruses containing the nucleic acid of the new CAR and Polybrene (7μg / ml) to transfect stem cells, and then place the cells in an incubator. After incubation overnight, replace with fresh culture medium to expand CAR stem cells. After the expansion is completed, the CAR mesenchymal stem cells do not exceed the 6th generation, and the CAR induced pluripotent stem cells can be passaged indefinitely.

[0061] Transient transfection:

[0062] After obtaining the nucleic acid encoding CAR, the novel CAR mRNA is obtained by in vitro transcription. Then, the ionizable cationic lipid: phospholipid: cholesterol: polyethylene glycol is mixed in a ratio of 50:10:38.5:1.5 through a microfluidic mixing device to obtain the prepared LNP. The novel CAR mRNA fragment is introduced into LNP, and the ratio of LNP:mRNA is 10:1 to obtain CAR-LNP.

[0063] Induce induced pluripotent stem cells or third-generation mesenchymal stem cells into 24-well plates. Add CAR-LNP to transfect stem cells, and then place the cells in an incubator. After incubation overnight, replace with fresh culture medium to expand CAR stem cells. Or directly use cationic liposomes, electroporation, etc. to introduce new CARmRNA into stem cells to achieve transient transfection of CAR stem cells. The effect of transient transfection reaches its peak on the 2nd-3rd day and begins to decline after 5 days.

[0064] CAR stem cell therapy

[0065] CAR stem cells are transported into the body by intravenous injection: the injection volume is 1*10 5 -1*10 7 / kg; injection frequency is 1-4 times, injection cycle is 1-6 months / time. It can also be injected into the diseased area by in situ injection, the injection volume is 1*10 5 -1*10 7 The number of injections is 1-4 times, and the injection cycle is 1-6 months / time.

[0066] Result analysis:

[0067] Ordinary stem cell transfusion therapy cannot be located in the target tissue for a long time and has a low degree of activation, resulting in an extremely low differentiation rate in vivo. The cells that have successfully differentiated in vitro have disadvantages such as poor infiltration, low integration, and low similarity, making it difficult for them to infiltrate the site of cell loss and function normally. Our results show that the CAR stem cells of the present invention are targeted and can specifically identify and locate to the target tissue, and 50-80% of the CAR stem cells have successfully differentiated into target cells.

[0068] Embodiment 1:

[0069] Mesenchymal stem cells were extracted from human umbilical cord using tissue block method. The Warren's jelly was cut into small pieces and evenly inoculated in a T175 cell culture bottle; 20ml STEMPRO MSC SFM mesenchymal stem cell GMP-grade culture medium was used for culture. After one week, mesenchymal stem cells could crawl out of the tissue block, and then normal passage and expansion were performed to obtain mesenchymal stem cells. The culture environment was 37°C, 95% air, and 5% CO2.

[0070] The antigen binding domain of the novel CAR nucleic acid is composed of the scFv of FAP; the connecting peptide is a polymer of glycine and serine; the hinge domain is composed of CD8. The signal peptide, transmembrane domain and signal activation domain are composed of the corresponding domains of FGFR1.

[0071] Specifically, the gene sequences of the signal peptide, transmembrane domain and signal activation domain of FGFR1 were obtained from the protein database UniProt; the sequence of the signal peptide of FGFR1 was defined as SEQ ID NO: 1, the sequence of the transmembrane domain was defined as SEQ ID NO: 2, and the sequence of the signal activation domain was defined as SEQ ID NO: 3; specifically as follows:

[0072] SEQ ID NO: 1: atgtggagctggaagtgcctgctgttttgggccgtgctggtgaccgccaccctgtgcaccgct

[0073]

[0074] The novel CAR nucleic acid fragment was obtained by artificial synthesis. After the nucleic acid of the activation gene and the suicide gene was obtained by PCR technology, it was connected to the CAR nucleic acid sequence by enzyme cutting and ligation technology, and the CAR, activation gene, and suicide gene were translated and expressed separately using T2A and P2A sequences to obtain the nucleic acid encoding the novel CAR. The activation gene is HIF-1α and the suicide gene is iCasp-9.

[0075] After obtaining the nucleic acid encoding the new CAR, it is introduced into the transfer plasmid of the lentivirus by enzyme cutting and ligation, and then the virus is packaged. The transfer plasmid, packaging plasmid and membrane protein plasmid are transfected into 293T cells together, and finally the packaged lentivirus containing the nucleic acid of the new CAR is obtained. Mesenchymal stem cells are inoculated into 24-well plates. Viruses containing the nucleic acid of the new CAR and Polybrene (7μg / ml) are added to transfect stem cells, and then the cells are placed in an incubator. After incubation overnight, FAP-CAR mesenchymal stem cells (FAP-CAR-MSC-FGFR1) with FGFR1 as the signal activation domain are obtained.

[0076] One week after myocardial infarction, significant myocardial fibrosis was observed in the mice, with the infarct area accounting for 37.5%. 6 The FAP-CAR-MSC-FGFR1 was injected into the mice through the tail vein, with only one injection. Two weeks after the injection, we found that the FAP-CAR mesenchymal stem cells successfully differentiated into cardiomyocyte-like cells in vivo, and the proportion of myocardial infarction in mice was reduced by 82.5% ( Figure 2 ). In addition, after induction with AP1903, suicide genes can induce apoptosis of FAP-CAR stem cells, enhancing the safety of FAP-CAR stem cells.

[0077] Example 2: The difference between Example 2 and Example 1 mainly lies in the differences in signal peptide, transmembrane domain and signal activation structure.

[0078] Acquisition of signal peptide, transmembrane domain and signal activation structure: The gene sequences of signal peptide, transmembrane domain and signal activation domain of VEGFR2 were obtained according to the protein database UniProt; the sequence of signal peptide of VEGFR2 was defined as SEQ ID NO: 4, the sequence of transmembrane domain was defined as SEQ ID NO: 5, and the sequence of signal activation domain was defined as SEQ ID NO: 6; the details are as follows:

[0079]

[0080] One week after myocardial infarction surgery, significant myocardial fibrosis was observed in the mice, with the infarct area accounting for 37.5%. 6 FAP-CAR mesenchymal stem cells (FAP-CAR-MSC-VEGFR2) with VEGFR2 as the signal activation domain were injected into mice through the tail vein, with only one injection. Two weeks after the injection, we found that FAP-CAR mesenchymal stem cells successfully differentiated into cardiomyocyte-like cells in vivo, and the proportion of myocardial infarction area in mice was reduced by 71.3% ( Figure 2 ). In addition, after induction with AP1903, suicide genes can induce apoptosis of FAP-CAR stem cells, enhancing the safety of FAP-CAR stem cells.

[0081] Example 3: The difference between Example 3 and Example 1 mainly lies in the differences in signal peptide, transmembrane domain and signal activation structure.

[0082] The gene sequences of the signal peptide, transmembrane domain and signal activation domain of LRP5 were obtained from the protein database UniProt; the sequence of the signal peptide of LRP5 was defined as SEQ ID NO: 7, the sequence of the transmembrane domain was defined as SEQ ID NO: 8, and the sequence of the signal activation domain was defined as SEQ ID NO: 9; the details are as follows:

[0083] SEQ ID NO: 7: atggaggcagcgccgcccgggccgccgtggccgctgctgctgctgctgctgctgctgctggcgctgtgcggctgcccg gcccccgccgcggcc

[0084] SEQ ID NO: 8: agtgccatcgggcccgtcattggcatcatcctctctctcttcgtcatgggtggtgtctattttgtgtgc

[0085] SEQ ID NO: 9: cagcgcgtggtgtgccagcgctatgcgggggccaacgggcccttcccgcacgagtatgtcagcgggaccccgcacgtgcccctcaatttcatagccccgggcggttcccagcatggccccttcacaggcatcgcatgcggaaagtccatgat gagctccgtgagcctgatggggggccggggcggggtgcccctctacgaccggaaccacgtcacaggggcctcgtccagcagctcgtccagcacgaaggccacgctgtacccgccgatcctgaacccgccgccctccccggccacggacccctccctg tacaacatggacatgttctactcttcaaacattccggccactgcgagaccgtacaggccctacatcattcgaggaatggcgcccccgacgacgccctgcagcaccgacgtgtgtgacagcgactacagcgccagccgctggaaggccagcaagtact acctggatttgaactcggactcagacccctatccacccccacccacgccccacagccagtacctgtcggcggaggacagctgcccgccctcgcccgccaccgagaggagctacttccatctcttcccgccccctccgtccccctgcacggactcatcc

[0086] One week after myocardial infarction surgery, significant myocardial fibrosis was observed in the mice, with the infarct area accounting for 37.5%. 6 FAP-CAR mesenchymal stem cells (FAP-CAR-MSC-LRP5) with LRP5 as the signal activation domain were injected into mice through the tail vein, with only one injection. Two weeks after the injection, we found that FAP-CAR mesenchymal stem cells successfully differentiated into cardiomyocyte-like cells in vivo, and the proportion of myocardial infarction area in mice was reduced by 47.2% ( Figure 2 ). In addition, after induction with AP1903, suicide genes can induce apoptosis of FAP-CAR stem cells, enhancing the safety of FAP-CAR stem cells.

[0087] Comparative Example 1:

[0088] One week after myocardial infarction surgery, significant myocardial fibrosis was observed in the mice, with the infarct area accounting for 37.5%. 6 The mice were injected with MSCs through the tail vein. Two weeks after the injection, the area of ​​myocardial infarction in the mice was reduced by 23.2%. Figure 2 ).

[0089] In summary, the present invention successfully prepared CAR stem cells that can differentiate in vivo, which can be localized in the target tissue for a long time, and rely on the activation of the intracellular domain and the unique growth microenvironment of the target cells to achieve the in vivo differentiation of stem cells, thereby treating a variety of cell damage and deficiency diseases.

[0090] In addition, the nucleic acid related information of the present invention is as follows:

[0091] Connecting peptide (denoted as SEQ ID NO: 10):

[0092] 5'-GGCGGCGGAGGAAGCGGAGGCGGAGGATCTGGTGGTGGTGGATCT-3'

[0093] T2A (denoted as SEQ ID NO: 11):

[0094] 5'-AGGGCAGAGGCAGCCTGCTGACATGTGGCGACGTGGAAGAGAAC CCTGGCCCC-3'

[0095] P2A (denoted as SEQ ID NO: 12):

[0096] 5'-GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTATG-3'

[0097] NCAM:Uniprot:P13591

[0098] Caveolin-3:Uniprot:P56539

[0099] LHFPL5:Uniprot:Q8TAF8

[0100] IgG1:Uniprot:P0DOX5

[0101] IgG4:Uniprot:P01861

[0102] CD28:Uniprot:P10747

[0103] FGFR1:Uniprot:P11362

[0104] VEGFR2:Uniprot:P35968

[0105] EGFR:Uniprot:P00533

[0106] NGFR:Uniprot:P08138

[0107] IGFR:Uniprot:Q9H665

[0108] PDGFR:Uniprot:P09619

[0109] HGFR:Uniprot:P08581

[0110] LRP5:Uniprot:O75197

[0111] ER:Uniprot:P03372

[0112] Notch:Uniprot:P46531

[0113] HIF-1α:NM_001243084.2

[0114] TFAM:NM_001270782.2

[0115] miR-223-5p:NR_029637.1

[0116] CXCR4:NM_001008540.2

[0117] TSG-6:NM_007115.4

[0118] CD248:IMGT INN Number:9519

[0119] HSV-TK:GenBank:ACC91769.1

[0120] KLF4:NM_001314052.2

[0121] SOX2:NM_003106.4

[0122] OCT4:NM_001173531.3

[0123] c-Myc:NM_001354870.1

[0124] NANOG:NM_001297698.2

[0125] Lin28:NM_024674.6

[0126] FAP:Advanced manufacturer:Wang LC,Lo A,Scholler J,Sun J,Majumdar RS,Kapoor V,Antzis M,Cotner CE,Johnson LA,DurhamAC,Solomides CC,June CH,Pure E andAlbelda SM.Targeting fibroblast activation protein in tumor stroma withchimeric antigen receptor T cells can inhibit tumor growth and augment hostimmunitywithout severe toxicity.Cancer Immunol Res.2014:2:154-66.

[0127] CD8 Differentiators:Alabanza L, Pegues M, Geldres C, Shi V, Wiltzius JJW, Sievers SA, Yang S and Kochenderfer JN andTransmembrane Domains.Mol Ther.2017:25:2452–2465.

[0128] CD28 Differential Antigens:Alabanza L,Pegues M,Geldres C,Shi V,WiltziusJJW,Sievers SA,Yang S and Kochenderfer JN.Function of Novel Anti-CD19ChimericAntigen Receptors with HumanVariable Regions IsAffected by Hinge andTransmembrane Domains.Mol Ther.2017:25:2452–2465.

[0129] iCasp-9: Reference journal literature: Wunderlich S, HaaseA, Merkert S, Jahn K, Deest M, Frieling H, Glage S, Korte W, Martens A, Kirschning A, Zeug A, Ponimaskin E, GohringG, Ackermann M, Lachmann N, Moritz T, Zweigerdt R and Martin U. Targeted biallelic integration of an inducible Caspase 9suicide gene in iPSCs for safetherapies. Mol TherMethods Clin Dev. 2022; 26:84-94.

[0130] Rituximab binding epitope: Reference journal article: Philip B, Kokalaki E, Mekkaoui L, Thomas S, Straathof K, Flutter B, Marin V, Marafioti T, Chakraverty R, Linch D, Quezada SA, Peggs KS and Pule MA highly compact epitope-based marker / suicide gene foreasier and safer T-cell therapy. Blood. 2014; 124: 1277-87.

[0131] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions under the concept of the present invention belong to the protection scope of the present invention. It should be pointed out that for ordinary technicians in this technical field, some improvements and modifications without departing from the principle of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. CAR stem cells that can differentiate in vivo, characterized by: Includes antigen binding domain, hinge domain, signal peptide, transmembrane domain and signal activation domain; The antigen binding domain includes scFv of NCAM, Caveolin-3, LHFPL5, FAP or CD248; The hinge domain includes CD8, IgG1, IgG4 or CD28; The signal peptide, transmembrane domain and signal activation domain include FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR or HGFR.

2. The in vivo differentiable CAR stem cell of claim 1, characterized in that: The CAR stem cells also include one or more of HIF-1α, TFAM, miR-223-5p, CXCR4 or TSG-6.

3. The in vivo differentiable CAR stem cell according to claim 1 or 2, characterized in that: The CAR stem cell also includes one of HSV-TK, iCasp-9, and rituximab binding epitopes.

4. The in vivo differentiable CAR stem cell of claim 3, characterized in that: The signal peptide, transmembrane domain and signal activation domain also include LRP5, ER or Notch.

5. A method for preparing CAR stem cells that can differentiate in vivo, characterized by: 1) Obtaining stem cells; the stem cells include mesenchymal stem cells or induced pluripotent stem cells; 2) introducing a nucleic acid encoding CAR into stem cells to obtain CAR stem cells; wherein the CAR stem cells include an antigen binding domain, a hinge domain, a signal peptide, a transmembrane domain and a signal activation domain; The antigen binding domain includes scFv of NCAM, Caveolin-3, LHFPL5, FAP or CD248; The hinge domain comprises CD8, IgG1, IgG4 or CD28. The signal peptide, transmembrane domain and signal activation domain include FGFR1, VEGFR2, EGFR, NGFR, IGFR, PDGFR or HGFR.

6. The method for preparing the in vivo differentiable CAR stem cell according to claim 5, characterized in that: The signal peptide, transmembrane domain and signal activation domain also include LRP5, ER or Notch.

7. The method for preparing the in vivo differentiable CAR stem cells according to claim 6, characterized in that: In step 2), one or more nucleic acids encoding HIF-1α, TFAM, miR-223-5p, CXCR4, and TSG-6 are introduced into CAR stem cells using lentivirus, retrovirus transfection, electroporation, LNP transduction, or chemical transfection; And / or, in step 2), one of the nucleic acids encoding herpes simplex virus thymidine kinase (HSV-TK), inducible caspase 9 (iCasp-9), or rituximab binding epitopes is introduced into CAR stem cells using lentivirus, retrovirus transfection, or electroporation, LNP transduction, or chemical transfection.

8. The method for preparing the in vivo differentiable CAR stem cells according to claim 7, characterized in that: The mesenchymal stem cells are derived from human umbilical cord, umbilical cord blood, placenta, bone marrow and fat; the induced pluripotent stem cells are derived from various somatic cells of the human body.

9. The method for preparing the in vivo differentiable CAR stem cell according to claim 8, characterized in that: The nucleic acid encoding CAR is introduced into stem cells using lentivirus or retrovirus transfection; alternatively, the nucleic acid encoding CAR is introduced into stem cells using transient transfection such as electroporation, LNP transduction, or chemical transfection.

10. Use of the in vivo differentiable CAR stem cell according to any one of claims 1 to 9 in the treatment of heart disease, muscle damage, neurodegenerative disease, diabetes, lung damage, liver disease or kidney disease.

Images