C subtype avian metapneumovirus, inactivated vaccine containing C subtype avian metapneumovirus and application of C subtype avian metapneumovirus

Abstract

The invention provides an avian metapneumovirus QL125, the preservation number of which is CGMCC (China General Microbiological Culture Collection Center) No.46219. The invention also provides an application of the avian metapneumovirus QL125 in preparation of an avian metapneumovirus infected animal model and a medicine for preventing and / or treating avian metapneumovirus infection. The invention further provides an avian metapneumovirus vaccine and a preparation method of the avian metapneumovirus vaccine. The avian metapneumovirus vaccine contains the avian metapneumovirus QL125. Experiments prove that after the inactivated vaccine is immunized, a protective antibody is generated quickly, the laying rate of shelducks immunized twice by the inactivated vaccine is basically equal to that of a control group, and the laying rate of laying ducks is effectively prevented from being reduced.

Description

Technical Field

[0001] The present invention relates to a preparation method and application of a C subtype avian metapneumovirus inactivated vaccine, belonging to the field of veterinary biological products. Background Art

[0002] Avian metapneumovirus (aMPV) belongs to the Pulmonary subfamily of the Paramyxoyiridae family, Metapneumoviruses. The aMPV genome is a non-segmented single-stranded negative-sense RNA with a length of about 14 kb, encoding a total of 8 structural proteins, from the 3′ end to the 5′ end, they are Nucleoprotein (N), Phosphoprotein (P), Membrane protein (M), Fusion protein (F), Matrix protein (M2), SH protein (SH), Glycoprotein (G) and Polymerase protein (L). The diameter of aMPV virus particles is 80 to 200 nm, with various shapes such as elliptical and circular, with an envelope and fibrous protrusions on the surface, and it does not agglutinate red blood cells. aMPV infects many poultry species, including turkeys, chickens, pheasants, guinea fowls, and ducks, causing respiratory symptoms, head swelling, and decreased egg production. aMPV is divided into four subtypes (A, B, C, and D), of which subtypes A and B have been reported around the world, and subtypes C and D have been reported in the United States and France, respectively. Subtype C was first isolated from turkeys, and subsequently appeared in poultry species such as Muscovy ducks, pheasants, and broilers.

[0003] my country is a big country in duck farming. In recent years, through serological surveys of infected ducks, it was found that avian metapneumovirus antibodies were detected in the serum of chickens and ducks in many provinces of my country, and the infection positive rate in some provinces was as high as 86%. Subtype C avian metapneumovirus can cause diseases characterized by chylous effusion in the oviduct, mucosal hemorrhage, edema and thickening, and varying degrees of egg production decline (decline rate 10% to 30%) in duck farms with high egg production rates, such as Mallard, Cherry Valley breeder ducks and Muscovy ducks. At present, there is no vaccine in China to prevent and control the decline in egg production in breeder ducks and laying ducks.

[0004] The most effective way to prevent the disease is vaccination. According to published research reports, there is currently no inactivated vaccine at home and abroad to prevent the decrease in egg production in breeder ducks and laying ducks caused by subtype C avian metapneumovirus. In view of this, it is necessary to establish an artificial animal infection model of subtype C avian metapneumovirus and prepare an inactivated vaccine of subtype C avian metapneumovirus. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art and provide an inactivated vaccine of subtype C avian metapneumovirus with high protection rate.

[0006] Based on this, the present invention provides an avian metapneumovirus QL125, which was deposited on November 14, 2024 in the General Microbiological Center of China National Microbiological Culture Collection Administration, Beijing, China, and its deposit number is CGMCC No.46219.

[0007] The present invention also provides the use of the avian metapneumovirus QL125 in preparing an avian metapneumovirus infection animal model.

[0008] According to a preferred embodiment, the animal is a shelduck.

[0009] Preferably, the challenge dose for preparing the animal model is 1.0 ml / feather, and the virus content is 10 6.0 TCID 50 The method of attack is injection into the pectoral muscle.

[0010] On this basis, the present invention also provides the use of the above-mentioned avian metapneumovirus QL125 in the preparation of a drug for preventing and / or treating avian metapneumovirus infection.

[0011] In particular, the present invention provides an avian metapneumovirus vaccine, wherein the vaccine contains the above-mentioned avian metapneumovirus QL125.

[0012] In the present invention, the avian metapneumovirus QL125 is inactivated, and the virus titer before inactivation is not less than 10 6 TCID 50 / 0.1ml.

[0013] On the other hand, the present invention also provides a method for preparing the above-mentioned avian metapneumovirus vaccine, the method comprising the following steps:

[0014] (1) inoculating avian metapneumovirus QL125 into Vero cells for large-scale culture, harvesting the Vero cell virus solution, inactivating the virus solution to prepare an aqueous phase, adding 4% of sterilized Tween-80 based on the total volume percentage, and stirring thoroughly until Tween-80 is obtained to obtain an aqueous phase solution;

[0015] (2) Measure 188 ml of mineral oil, add 1 g of aluminum stearate, slowly heat to 80°C, stir at 200 r / min to dissolve, add 12 ml of Span-80, stir evenly, continue heating to 115°C, maintain for 30 minutes and stir evenly, and cool to obtain an oil phase solution;

[0016] (3) The oil phase is placed in a sterile beaker, and an emulsifier is turned on. The water phase is slowly added at a volume ratio of 2:1 between the oil phase solution and the water phase solution. The mixture is fully emulsified under stirring to obtain an avian metapneumovirus vaccine.

[0017] In addition, the present invention also provides the use of avian metapneumovirus QL125 in detecting the efficacy of avian metapneumovirus vaccines.

[0018] On the other hand, the present invention provides the use of Vero-αβ cells in improving the virus titer of avian metapneumovirus QL125 strain, characterized in that the Vero-αβ cells are Vero cells expressing chicken integrin αvβ1 gene.

[0019] Preferably, Vero-αβ cells grown into a well-grown monolayer are inoculated with the avian metapneumovirus QL125 strain at an inoculum volume of 1% of the culture medium, mixed and then placed at 37°C and 5% CO 2 The cells were cultured continuously in the incubator, and when more than 80% of the Vero-αβ cells showed pathological changes, the Vero-αβ cell culture was harvested as the virus solution.

[0020] After experimental verification, the avian metapneumovirus QL125 strain of the present invention was used to infect ducks in the early laying period, and the egg production rate of the ducks after infection decreased by 47.9%, which was used as an animal model. The QL125 strain was inactivated by formaldehyde and then emulsified with an oil adjuvant to prepare an inactivated vaccine for immunization of ducks twice, and the QL125 strain was used to attack the virus to verify the protective ability of the inactivated vaccine. The experimental results show that the inactivated vaccine of the present invention produces protective antibodies quickly after immunization, and the egg production rate of the ducks immunized with the inactivated vaccine twice is basically the same as that of the control group. Therefore, the QL125 strain separated and purified by the present invention can be used to prepare an inactivated vaccine, which can effectively prevent the decline in egg production in laying ducks.

[0021] Microbiological information

[0022] Avian metapneumovirus QL125 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 14, 2024, and its deposit number is CGMCC No.46219. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The specific identification results of aMPV in the diseased material samples of Example 1, in which M: DL5000 Marker; 1-6: aMPV RT-PCR detection products in the diseased materials.

[0024] Figure 2 The following are the pathological pictures of duck embryos inoculated with QL125 strain. A: normal duck embryo; B: pathological duck embryo.

[0025] Figure 3 This is the cytopathic effect image of aMPV infection.

[0026] Figure 4 RT-PCR detection of the F gene of aMPV. In the figure, M: DL5000 Marker; 1: aMPV positive cytotoxic sample.

[0027] Figure 5 Nucleotide sequence comparison of F gene between aMPV QL125 strain and reference strain

[0028] Figure 6 This is the evolutionary tree of the QL125 strain.

[0029] Figure 7 Results of whole genome segment amplification of aMPV QL125 strain. M: DNA Marker DL5000; 1-7: PCR fragments of QL125 genome amplification primers aMPV-F1 / R1-aMPV-F7 / R7.

[0030] Figure 8 This is a transmission electron microscopic photograph of aMPV QL125 strain.

[0031] Fig. 9 The following is a picture of the pathological changes caused by the QL125 strain infecting laying ducks. A: normal duck; B: diseased duck after infection. DETAILED DESCRIPTION

[0032] The following examples are used to illustrate the technical solutions of the present invention, but do not limit the scope of the present invention. The reagents or instruments used in the present invention without indicating the manufacturer are all regarded as conventional products that can be purchased on the market.

[0033] In the present invention, unless otherwise specified, "%" used to explain concentrations refers to weight percentage, and ":" refers to weight ratio.

[0034] Unless otherwise specified, all experimental methods used in the following examples are conventional methods or are performed according to the methods described in the kit instructions.

[0035] Unless otherwise specified, the materials, reagents, etc. involved in the present invention can be obtained through commercial channels.

[0036] Example 1 Isolation and Identification of Viruses

[0037] (1) PCR detection

[0038] Nasal turbinates of diseased ducks were collected from a white-feathered broiler duck farm in Shandong Province. Six diseased samples were added with sterile saline at a ratio of 1:5 and ground into a homogenate. The homogenate was frozen and thawed three times below -70°C and centrifuged at 10,000 r / min for 10 min. 500 μl of the supernatant was transferred to a sterile centrifuge tube, filtered through a 0.22 μm filter membrane, and stored below -70°C for later use.

[0039] Artificially synthesized avian metapneumovirus identification primers:

[0040] aMPV-F: 5'-GCAGCTGAAGTAGGAATGCAGTA-3'

[0041] aMPV-R: 5'-CCTGCACCATAAGCTTGCA-3'

[0042] Extract nucleic acids (DNA and RNA) according to the instructions of the viral nucleic acid extraction kit (MagaBio plus viral DNA / RNA purification kit III), and identify samples according to the instructions of the one-step RT-PCR kit HiScript IIOne Step RT-PCR Kit (Dye Plus). Reaction system: RNase-free ddH 2 O 16.5μl, 2×One Step Mix (DyePlus) 25μl, One Step Enzyme Mix 2.5μl, Primer F (10μM) 2μl, Primer R (10μM) 2μl, template RNA 2μl; 50℃30min, 94℃3min, 94℃30s, 56℃30s, 72℃1min, 30 cycles, 72℃7min. PCR products were detected by electrophoresis using 0.8% agarose gel.

[0043] The results are as follows Figure 1 As shown, aMPV was detected in the diseased materials from white-feathered broiler ducks, and the PCR product band was approximately 581 bp, and no other viruses were detected.

[0044] (2) Inoculation of duck embryos

[0045] The samples with aMPV positive results from RT-PCR were used to isolate and passage the virus using SPF duck embryos. The prepared supernatant was inoculated into the allantoic cavity of 5 10-day-old SPF duck embryos, with 0.5 ml of supernatant inoculated into each duck embryo. After inoculation, the duck embryos were incubated in a 37°C constant temperature incubator, and the duck embryos that died within 24 hours were discarded. The allantoic fluid of duck embryos that died after 24 hours were collected. If the duck embryo did not die, the sterile duck embryo allantoic fluid was cultured for 120 hours and blindly passaged for 4 generations. The allantoic fluid was collected for RT-PCR identification, and the aMPV-positive allantoic fluid virus was selected and stored below -80°C for later use.

[0046] The results showed that 5 duck embryos were inoculated with a single positive sample of avian metapneumovirus type C. No death was observed 5 days after inoculation. Duck embryos died after 4 consecutive passages. The surface of the duck embryos was edematous and hemorrhagic. The liver was hemorrhaged ( Figure 2 ).

[0047] (3) Inoculation of cells

[0048] 0.4 ml of positive allantoic fluid was inoculated into a monolayer of Vero cells, BHK cells, DF-1 cells, etc. in a 6-well plate and placed at 37°C and 5% CO. 2 Incubate in a cell culture incubator for 1 hour, and replace the culture medium with DMEM cell maintenance medium containing 1% penicillin-streptomycin and 10% fetal bovine serum. Observe the state of the cells every day for 7 days, freeze and thaw the infected cells 3 times, centrifuge at 4°C and 10,000 r / min for 20 minutes, and transfer 400 μl of the supernatant to a new monolayer of cells. Blind passage 5 generations, and select samples with cytopathic effect (CPE) for further identification.

[0049] The virus solution obtained in the previous step was diluted 10-fold in series with serum-free maintenance solution. -4 , 10 -5 , 10 -6 , 10 - 7 4 dilutions or appropriate dilutions were used to inoculate Vero cells, BHK cells and DF-1 cells grown into a good monolayer in a 96-well microtiter cell culture plate. Each dilution was inoculated into 8 wells, 100 μl per well, and a non-inoculated control well was set up at 37°C and 5% CO. 2 Culture in an incubator and observe for 120 to 144 hours. Observe the lesions every day and count the number of CPE holes produced by each dilution. Calculate TCID according to the Reed-Muench method 50 .

[0050] The results are as follows Figure 3As shown in the figure, all inoculated cells showed obvious CPE such as cell rounding, aggregation and fusion, which is consistent with the characteristic CPE formed by aMPV, indicating that the isolated aMPV can be stably propagated on Vero cells, BHK cells and DF-1 cells. 5.2 , 10 5.0 , 10 5.2 TCID 50 / 0.1ml.

[0051] (4) Sequence analysis

[0052] A pair of primers ampv-CF / R were designed based on the upstream and downstream conserved sequences of the F gene sequence of subtype C aMPV (GenBank sequence number OR365551). The cDNA of the virus-positive sample was used as a template to amplify the F gene. The expected amplified fragment size was 1700 bp:

[0053] ampv-CF:GTTAATTCCTGGTTTGATATTATTTAG

[0054] ampv-CR:GACATCTTGGACTTGTCCCA

[0055] The reaction system is 50μL: 2μl of upstream and downstream primers, 2μl of cDNA, 25μl of 2× Prime STAR Max, add water to 50μl. Reaction procedure: 98℃5min; 98℃15s; 53℃15s; 72℃50s; 30 cycles; 72℃ extension for 10min. The PCR product was detected by 0.8% agarose gel electrophoresis. The F gene band was 1700bp. The PCR product purified according to the instructions of Omega gel recovery kit was connected with pMD18-T vector, transformed into DH5a competent cells, spread on LB plates containing ampicillin, and cultured overnight. The correct single clone was identified by colony PCR method and the plasmid was extracted and sequenced. The results are as follows Figure 4 The aMPVF gene is 1614 bp in length and encodes 537 amino acids, as shown in SEQ ID No. 1-2.

[0056] DNAStar and MEGA11 software were used to compare the sequencing results with the F genes of different strains of subtype A, B, C, and D aMPV published in GenBank. Figure 5As shown, it has the highest nucleotide sequence homology with the C subtype aMPV American strain (sequence number AF085228), Korean strain (sequence number EF199771), and Chinese strain (sequence number KC915036), which is 95.2% to 98.9%, and the F gene of different strains of the same subtype is relatively conservative, with a lower mutation rate; the nucleotide sequence homology with the A subtype aMPV American strain (sequence number AY640317) and Brazilian strain (sequence number DQ175633) is relatively low, at 77.3% to 77.6%; the nucleotide sequence homology with the B subtype aMPV Chinese strain (sequence number HQ388396), Russian strain (sequence number JF810666), and Hungarian strain (sequence number Y14291) is the highest, at 68.3% to 73.1%; the nucleotide sequence homology with the D subtype aMPV French strain (sequence number HG934339) is the lowest, at 67.8%. Genetic evolution analysis showed that the isolate QL125 was a subtype C aMPV ( Figure 6 ).

[0057] (5) Virus whole genome sequencing

[0058] According to the genomic sequence of subtype C aMPV (GenBank sequence number OR365551), the nucleic acid (DNA and RNA) was extracted according to the instructions of the virus nucleic acid extraction kit (MagaBio plus virus DNA / RNA purification kit III), and the whole genome of the isolated strain was amplified according to the instructions of the one-step RT-PCR kit HiScript IIOne Step RT-PCR Kit (DyePlus). The 7 pairs of primers required for amplifying the whole genome (aMPV-F1 / R1, aMPV-F2 / R2, aMPV-F3 / R3, aMPV-F4 / R4, aMPV-F5 / R5, aMPV-F6 / R6, aMPV-F7 / R7) are shown in Table 1. The reaction system and PCR program refer to step (4).

[0059] Table 1 Primers involved in amplifying the whole genome

[0060]

[0061] The PCR product purified according to the instructions of Omega's gel recovery kit was connected to the pMD18-T vector, transformed into DH5a competent cells, spread on LB plates containing ampicillin, cultured overnight, and the correct single clone was identified by colony PCR method and the plasmid was extracted for sequencing.

[0062] The 7 pairs of primers for amplifying the complete gene sequence of aMPV were used to amplify the complete genome of the isolate. The RT-PCR results were as follows: Figure 7As shown, all PCR amplified fragments were consistent with the expected size. The whole genome sequence was obtained after sequencing and splicing, and its structure was confirmed to be consistent with the structural characteristics of the aMPV genome.

[0063] (6) Transmission electron microscopy identification of viruses

[0064] The aMPV cell solution was centrifuged at 4℃ 8000r / min for 1h, the supernatant was taken, and then centrifuged at 4℃ 32000r / min for 3h, the supernatant was discarded, and the precipitate was resuspended with a small amount of sterile PBS, and then centrifuged at 4℃ 12000r / min for 20min to take the supernatant, which was the purified virus solution. After negative staining with 3% phosphotungstic acid, the virus particles and morphology were observed under a transmission electron microscope. Figure 8 As shown, virus particles with a diameter of 80-200 nm, enveloped, oval and round shapes can be seen, which are consistent with the morphology and size of the published aMPV.

[0065] The isolated aMPV was confirmed to be avian metapneumovirus, belonging to subtype C, and named QL125.

[0066] Example 2 Establishment of the challenge model

[0067] 90 25-week-old laying ducks with an egg production rate of not less than 85% were divided into two groups. After 10 days of isolation and feeding, when the egg production rates of the two groups were stable and close, one group was randomly selected for challenge with QL125 strain by pectoral injection. The challenge dose was 1.0 ml / feather and the virus content was 10 6.0 TCID 50 The other group was used as a negative control group without challenge. The ducks were observed for 14 consecutive days after challenge. The clinical symptoms of the ducks were observed daily, and the death and egg laying were observed and recorded. All ducks were killed on the 14th day after challenge. The clinical anatomical pathological changes of the oviduct were observed, and whether each duck was sick was determined.

[0068] At the end of the experiment, 4 ducks were taken from each group and killed. The autopsy revealed symptoms of oviduct mucosal bleeding and mild ovarian bleeding in the ducks in the challenged group, which were the same as the characteristic autopsy lesions of clinical cases. The diseased materials from the challenged group were collected and processed and inoculated into SPF duck embryos. The target band consistent with the expected size was specifically amplified, confirming that the QL125 strain can be used to establish a challenge model.

[0069] Example 3 Construction of avian metapneumovirus-sensitive cells

[0070] Chicken integrin αvβ1 is a receptor for avian metapneumovirus. The full-length protein sequences of chicken integrins αv and β1 were obtained from the NCBI database (Genebank Nos. NP990770 and NP001034343). The gene sequences were designed according to mammalian codon preference as shown in SEQ ID No. 3-4. The sequences were synthesized by a gene synthesis company and then connected to the lentiviral expression plasmid pCDH-CMV-MCS-EF1-turboRFP-T2A-Puro. The virus was packaged using a lentiviral packaging kit (Yuanjing Biotechnology Co., Ltd.), and positive cells were selected by adding puromycin. Finally, Vero cells carrying chicken integrin αvβ1 were constructed and named Vero-αβ cells.

[0071] Example 4 Preparation and testing of inactivated vaccines

[0072] (1) Preparation of Vero cell monolayers

[0073] Quickly take out the frozen Vero cells and Vero-αβ cells from the liquid nitrogen tank, place them in a 37°C water bath to quickly thaw, transfer the cell suspension in the cryotube to a centrifuge tube containing 10% fetal bovine serum MEM medium in a biosafety cabinet, centrifuge at 1000 rpm for 5 min, carefully discard the supernatant, resuspend the cells in 10% fetal bovine serum MEM medium, transfer them to a cell culture flask, and place them at 37°C and 5% CO 2 Culture in an incubator.

[0074] Add trypsin digestion solution to the well-growing Vero cell monolayer and Vero-αβ cell monolayer to digest and disperse them evenly, add MEM cell suspension containing 10% fetal bovine serum, and divide them into 3000ml spinner bottles, each large spinner bottle has 500ml, and place them in a 37℃ spinner machine for rotation culture with the speed set at 9-11 rpm. Grow them into well-grown Vero monolayer cells for use.

[0075] (2) Vaccination

[0076] When Vero cells and Vero-αβ cells grew into a good monolayer, they were inoculated with avian metapneumovirus QL125 strain at an inoculum volume of 1% of the culture medium. After mixing, they were incubated at 37°C and 5% CO 2 Continue culturing in the incubator and observe the cells once a day. When more than 80% of the Vero cells and Vero-αβ cells show pathological changes, freeze the culture bottles below -15°C.

[0077] Vero cells and Vero-αβ cells were observed twice a day. When more than 80% of the Vero cells showed pathological changes, the Vero cells and Vero-αβ cell cultures were harvested, repeatedly frozen and thawed once, and stored below -15°C.

[0078] Vero cells and Vero-αβ cells were cultured in serum-free maintenance medium and diluted 10-fold. -4 , 10 -5 , 10 -6 , 10 -7 Four dilutions were used to inoculate Vero cells and Vero-αβ cells grown into a well-grown monolayer in a 96-well microtiter cell culture plate. Each dilution was inoculated into 8 wells, with 100 μl per well. A non-inoculated control well was also set up. The plate was placed at 37°C and 5% CO 2 Culture in an incubator and observe for 120 to 144 hours. Observe the lesions every day and count the number of CPE holes produced by each dilution. Calculate TCID according to the Reed-Muench method 50 .

[0079] Under the same conditions, when the QL125 strain was cultured in Vero cells, the virus titer was 10 6.0 TCID 50 / 0.1ml, while when the QL125 strain was cultured in Vero-αβ cells, the virus titer was 10 7.0 TCID 50 / 0.1ml. It was confirmed that Vero cells carrying chicken integrin αvβ1 can significantly increase the viral titer of avian metapneumovirus QL125 strain and can be used as Vero cells for the production of QL125 strain.

[0080] (3) Virus liquid inactivation

[0081] Vero-αβ cells were cultured and the virus titer was 10 7.0 TCID 50 Pour 0.1 ml of virus culture solution into the inactivation bottle, add 10% formaldehyde solution, mix thoroughly, and the final concentration of formaldehyde solution is 0.1%. Then place it on a 37°C shaker for inactivation for 12 to 16 hours, and store the inactivated virus solution at 2 to 8°C.

[0082] (4) Sterility test

[0083] The determination was carried out in accordance with the appendix of the 2015 edition of the Chinese Pharmacopoeia of Veterinary Medicine.

[0084] (5) Inactivation test

[0085] The inactivated avian metapneumovirus solution was diluted 10 times and inoculated into well-growing Vero monolayer cells. Each sample was inoculated into a 6-well cell culture plate, with 2.0 ml in each well. Uninoculated Vero cells were used as a blank control. The cells were observed for 5 days. If no cytopathic effect was observed in the cell culture plate, the culture was harvested and frozen and thawed three times, and then blindly propagated for one generation. The culture was continued for 5 days, and whether cytopathic effect was observed in the cell culture plate was recorded.

[0086] (6) Emulsification

[0087] Measure 188ml of mineral oil and add 1g of aluminum stearate. Slowly heat to 80℃ and stir at 200r / min to dissolve it. Then add 12ml of SIBEN-80 and stir evenly. Continue heating to 115℃ and maintain for 30 minutes. After stirring evenly, cool and set aside.

[0088] Measure 96ml of inactivated qualified avian metapneumovirus antigen, add 4ml of sterilized Tween-80, stir well to completely dissolve Tween-80. Put the oil phase into a sterile beaker, turn on the emulsifier, slowly add the water phase, increase the speed to 25000r / min and continue emulsification for 3 minutes. After emulsification, measure 10ml of the vaccine and add it to a centrifuge tube, centrifuge at 3000r / min for 30min, and the water phase precipitated at the bottom of the tube should not exceed 0.5ml. After emulsification, the QL125 strain inactivated vaccine is obtained.

[0089] (7) Safety inspection

[0090] Ten 2-week-old SPF ducks were injected with 1.0 ml of inactivated vaccine (virus content 10 6.0 TCID 50 ), 0.5 ml was injected subcutaneously on both sides of the back of the neck. All the mice were observed for 14 days and were alive and well, with no local or systemic adverse reactions caused by the vaccine.

[0091] (8) Effectiveness test

[0092] 90 25-week-old ducklings in the laying period with an egg-laying rate of not less than 80% were randomly divided into three groups, namely the immunization group, the positive challenge group and the blank control group, with 30 ducks in each group. The immunization group was injected with 0.5 ml / bird of QL125 inactivated vaccine subcutaneously in the neck. Four weeks after immunization, the immunization group was boosted with 0.6 ml / bird; the positive challenge group and the blank control group were not immunized. Four weeks after the booster immunization, all ducks in the immunization group and the positive challenge group were challenged with QL125 strain by breast muscle injection. The challenge dose was 1 ml / bird, and the virus content was 10 6 TCID 50 The blank control group was not challenged with the virus. After the challenge, the clinical symptoms of the ducks were observed daily, the egg production rate was recorded, and the disease situation was recorded. All ducks were killed on the 14th day after the challenge, and the clinical anatomical pathological changes such as the oviduct were observed, and whether each duck was sick was determined.

[0093] The results of animal experiments showed that no deaths occurred in the three groups of ducks during the 14-day observation period.

[0094] The egg-laying situation is as follows: the average egg-laying rate of the immunized group during the 14-day observation period was 71%, a decrease of 9% compared with the egg-laying rate of no less than 80% before the treatment; the average egg-laying rate of the positive challenge group was 32.1% within 14 days after the challenge, a decrease of 47.9% compared with before the challenge; the average egg-laying rate of the blank control group was 71.4% within 14 days after the treatment, a decrease of 8.6% compared with before the treatment. The data showed that the egg-laying rate of the positive challenge group and the blank control group was significantly different, while there was no significant difference between the immunized group and the blank control group.

[0095] The antibody level of the experimental ducks was tested with the IDEXX ELISA test kit. One month after immunization, the antibody level of the immunized ducks was 6379±3080, and the antibody level of the control ducks was 845±739. One month after the booster immunization, the antibody level of the immunized ducks was 11390±4637, and the control group was 982±747. The data showed that the antibody level of the immunized group was significantly different from that of the blank control group.

[0096]

[0097] Three groups of ducks were dissected. The ovaries of the immune group and the blank control group showed no obvious symptoms after dissection. The autopsy revealed bleeding in the oviduct mucosa and mild bleeding in the ovaries of the ducks in the positive challenge group, which were the same as the characteristic autopsy lesions of the clinical disease, such as Fig. 9 shown.

[0098] The above results show that after the inactivated vaccine prepared by the present invention using the C subtype avian metapneumovirus QL125 strain was used to immunize the duck twice, the ducks in the early laying period were infected with the QL125 strain, and the immunized ducks showed a good protection rate. The inactivated vaccine of the present invention produces protective antibodies quickly after immunization, and the egg laying rate of the ducks immunized twice with the inactivated vaccine is basically the same as that of the control group, which effectively prevents the decline of egg laying in laying ducks.

Claims

1. Avian metapneumovirus QL125 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 14, 2024, and its deposit number is CGMCC No.46219.

2. Use of the avian metapneumovirus QL125 according to claim 1 in preparing an avian metapneumovirus infection animal model.

3. The use according to claim 2, characterized in that The animal is a shelduck.

4. The challenge dose for preparing animal models was 1.0 ml / bird, and the virus content was 10 6.0 TCID 50 The method of attack is injection into the pectoral muscle.

5. Use of the avian metapneumovirus QL125 according to claim 1 in the preparation of a medicament for preventing and / or treating avian metapneumovirus infection.

6. An avian metapneumovirus vaccine, comprising the avian metapneumovirus QL125 as claimed in claim 1.

7. The avian metapneumovirus vaccine according to claim 6, characterized in that The avian metapneumovirus QL125 is inactivated, and the virus titer before inactivation is not less than 10 6 TCID 50 / 0.1ml.

8. The method for preparing the avian metapneumovirus vaccine according to claim 6, comprising the following steps: (1) inoculating avian metapneumovirus QL125 into Vero cells for large-scale culture, harvesting the Vero cell virus solution, inactivating the virus solution to prepare an aqueous phase, adding 4% of sterilized Tween-80 based on the total volume percentage, and stirring thoroughly until Tween-80 is obtained to obtain an aqueous phase solution; (2) Measure 188 ml of mineral oil, add 1 g of aluminum stearate, slowly heat to 80°C, stir at 200 r / min to dissolve, add 12 ml of Span-80, stir evenly, continue heating to 115°C, maintain for 30 minutes and stir evenly, and cool to obtain an oil phase solution; (3) The oil phase is placed in a sterile beaker, and an emulsifier is turned on. The water phase is slowly added at a volume ratio of 2:1 between the oil phase solution and the water phase solution. The mixture is fully emulsified under stirring to obtain an avian metapneumovirus vaccine.

9. Application of avian metapneumovirus QL125 in detecting the efficacy of avian metapneumovirus vaccine.

10. The use of Vero-αβ cells in increasing the viral titer of avian metapneumovirus QL125 strain, characterized in that The Vero-αβ cells are Vero cells expressing chicken integrin αvβ1 gene.

11. The use according to claim 10, characterized in that Vero-αβ cells grown into a well-grown monolayer were inoculated with the avian metapneumovirus QL125 strain at an inoculum volume of 1% of the culture medium. After mixing, the cells were placed in a 37°C, 5% CO2 incubator for continued culture. When more than 80% of the Vero-αβ cells showed pathological changes, the Vero-αβ cell culture was harvested as the virus liquid.

Images