Glycosyl transferase UGT91C1 mutant and method for catalytically synthesizing rebaudioside D by using glycosyl transferase UGT91C1 mutant

Abstract

The invention discloses a glycosyl transferase UGT91C1 mutant and a method for catalytically synthesizing rebaudioside D by using the glycosyl transferase UGT91C1 mutant, and belongs to biological catalytic synthesis. The glycosyl transferase UGT91C1 mutant is any one of the following (A)-(C): A) a protein obtained by mutation of any one or more of the following mutations on the basis of an amino acid sequence as shown in SEQ ID NO.1: the 89th amino acid is mutated from N to Y; the 155th amino acid is mutated from M to L; the 274th amino acid is mutated from S to T; the 361st amino acid is mutated into S from N; the protein (B) and the amino acid sequence limited by (A) have 95% or more than 98% of identity and have the same function; and (C) a fusion protein obtained by connecting a tag to the terminal of the protein defined in (A) or (B). The glycosyl transferase UGT91C1 mutant provided by the invention is obtained by mutating and screening wild glycosyl transferase UGT91C1, has higher enzyme activity and catalytic rate, and can be used for efficiently synthesizing rebaudioside D by taking rebaudioside A as a substrate.

Description

Technical Field

[0001] The invention relates to the technical field of biocatalytic synthesis, and in particular to a glycosyltransferase UGT91C1 mutant and a method for catalyzing the synthesis of rebaudioside D by the mutant. Background Art

[0002] Rebaudioside D is a natural, non-nutritive sweetener. It is one of the many steviolglycosides in stevia, with extremely low calories and high sweetness. Compared with other steviol glycosides in stevia extracts such as rebaudioside A, rebaudioside D is relatively sweeter and has less aftertaste, and is closer to the taste of sucrose.

[0003] In the food and beverage industry: As a zero-calorie sweetener, rebaudioside D is widely used in various low-calorie and sugar-free foods such as beverages, baked products, candies, dairy products, jams, condiments, etc. to reduce the sugar content of the product without affecting its sweetness quality. And because rebaudioside D does not cause blood sugar levels to rise, it is particularly suitable for diabetics and consumers who need to control blood sugar, and can be used as an ideal alternative to sugar. At the same time, as consumers pay more attention to healthy lifestyles, more and more sugar-reduced and fat-reduced products use rebaudioside D as a source of sweetness to meet the market demand for low-calorie foods.

[0004] However, rebaudioside D is generally extracted from stevia leaves using separation and purification technology. The yield of rebaudioside D obtained by this method is relatively low and cannot meet the high demand of the market. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a glycosyltransferase UGT91C1 mutant and a method for catalyzing the synthesis of rebaudioside D by the mutant, so as to overcome the technical problem of low rebaudioside D yield in the prior art.

[0006] In a first aspect, the present invention provides a glycosyltransferase UGT91C1 mutant, wherein the UGT91C1 mutant is any one of the following (A)-(C):

[0007] (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0008] The 89th amino acid mutated from N to Y;

[0009] The amino acid at position 155 mutated from M to L;

[0010] The amino acid at position 274 mutated from S to T;

[0011] The amino acid at position 361 mutated from N to S;

[0012] (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function;

[0013] (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

[0014] Compared with the prior art, the glycosyltransferase UGT91C1 mutant provided by the present invention is obtained by mutation screening of the wild-type glycosyltransferase UGT91C1, and has higher enzyme activity and catalytic rate. The optimal mutant 2-12E can convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 hours, and the rebaudioside A conversion rate reaches 94.2%, which greatly improves the yield of rebaudioside D.

[0015] Furthermore, the amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO.3.

[0016] In a second aspect, the present invention provides a biomaterial, comprising any one of the following:

[0017] (A) an expressed gene encoding the above-mentioned glycosyltransferase UGT91C1 mutant;

[0018] (B) a recombinant plasmid containing the expression gene described in (A);

[0019] (C) A recombinant cell comprising the above-mentioned recombinant plasmid or a gene expressing the glycosyltransferase UGT91C1 mutant.

[0020] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0021] Position 89 of SEQ ID NO.2 is replaced by TAT from AAC;

[0022] Position 155 of SEQ ID NO.2 is replaced by ATG to TTG;

[0023] Position 274 of SEQ ID NO.2 is replaced by TCC to ACG;

[0024] Position 361 of SEQ ID NO.2 is replaced by AAC to AGC;

[0025] Preferably, the nucleotide sequence of the expressed gene is shown as SEQ ID NO.4.

[0026] In a third aspect, the present invention provides an enzyme composition, comprising the above-mentioned glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS;

[0027] The sucrose synthase AtSUS is as follows (B1) or (B2): the amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0028] (B2) A protein having an amino acid sequence identity of 95% or 98% or more to that of (B1) and having the same function.

[0029] In a fourth aspect, the present invention provides a set of recombinant strains for use in the above enzyme composition, comprising a recombinant strain A and a recombinant strain B:

[0030] The recombinant strain A contains the above-mentioned recombinant plasmid;

[0031] The recombinant strain B contains a recombinant plasmid B, which is obtained by constructing a gene encoding sucrose synthase AtSUS into the plasmid; the gene encoding AtSUS is shown in SEQ ID NO.6.

[0032] Furthermore, the host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

[0033] In a fifth aspect, the present invention provides a method for synthesizing rebaudioside D by catalyzing the glycosyltransferase UGT91C1 mutant, comprising the following steps:

[0034] Rebaudioside A, UDPG, sucrose and the above enzyme composition or the induced expression enzyme product of the above complete set of recombinant strains are added to the catalytic reaction system. After the reaction is completed, the enzyme is inactivated, centrifuged, and the supernatant is collected. The supernatant contains rebaudioside D.

[0035] Compared with the prior art, the glycosyltransferase UGT91C1 mutant can use rebaudioside A and UDPG as substrates, catalyze the synthesis of rebaudioside D and UDP through glycosylation reaction, and the sucrose synthase AtSUS can catalyze UDP and sucrose to generate UDPG and fructose. Therefore, the present invention uses rebaudioside A, UDPG, and sucrose as substrates, and uses the glycosyltransferase UGT91C1 mutant and the sucrose synthase AtSUS two enzymes to couple the catalytic reaction. On the one hand, the activity of the glycosyltransferase can be indirectly measured by quantitative analysis of the reaction product fructose, thereby screening out the glycosyltransferase UGT91C1 mutant with higher catalytic activity. On the other hand, the introduction of the sucrose synthase AtSUS realizes the cyclic regeneration of UDPG, further improving the yield of rebaudioside D.

[0036] Furthermore, the inducible expression enzyme products of the above-mentioned set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0037] The method for obtaining the induced expression enzyme product A is as follows:

[0038] The seed solution of the recombinant strain A in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture solution is 600 When the pH value reaches 0.6 to 0.8, isopropyl-β-D-thiogalactoside is added for induction culture for 8 to 40 hours, and the cells are collected by centrifugation. Lysozyme solution is added to the cells to break the cells or ultrasonically break the cells, and the cells are centrifuged. The supernatant is collected to obtain the induced expression enzyme product A; the final concentration of kanamycin sulfate is 10 to 100 μg / mL; the final concentration of isopropyl-β-D-thiogalactoside is 0.01 to 1 mM;

[0039] The method for obtaining the induced expression enzyme product B is as follows:

[0040] The seed solution of the recombinant strain B in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and cultured at 25-40°C and 200-300 r / min until the OD 600 When the pH reaches 0.6 to 0.8, L-arabinose is added to continue induction culture for 8 to 40 hours, centrifuged and the bacteria are collected, lysozyme solution is added to the bacteria to break the cells or ultrasonically break the cells, centrifuged, and the supernatant is collected to obtain the induced expression enzyme product B; the final concentration of kanamycin sulfate is 10 to 100 μg / mL; the final concentration of L-arabinose is 0.1 to 15 mM.

[0041] Furthermore, in the catalytic reaction system, the concentration of rebaudioside A is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the amount of induced expression enzyme product A added is 0.1-50 mL, and the amount of induced expression enzyme product B added is 0.1-50 mL.

[0042] Furthermore, the pH value in the catalytic reaction system is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The yield of rebaudioside D (RD) under the catalysis of different glycosyltransferase UGT91C1 mutants.

[0044] Figure 2 This is the changing trend of the yield of rebaudioside D (RD) with conversion time. DETAILED DESCRIPTION

[0045] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0046] It should be understood that the materials used in the following examples are all commercially available materials unless otherwise specified.

[0047] Example 1

[0048] Construction of recombinant Escherichia coli AtSUS expressing sucrose synthase AtSUS

[0049] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers and Arabidopsis thaliana sucrose synthase AtSUS cDNA as template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The atsus gene fragment is shown in SEQ ID NO.6, and the amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0050] Inf-pYB1k-atsus-F:

[0051] GCTAACAGGAGGAATTAACCATGGAAAATAAAACGGAGACC(SEQ ID NO.7)

[0052] Inf-pYB1k-atsus-R:

[0053] CCAGATCTACCCTCGAGTTACAACGATGAAATGTAAGAAAC(SEQ ID NO.8)

[0054] The atsus gene fragment was connected to the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.

[0055] Using pYB1k-F and pYB1k-R as primers and the pYB1k empty vector as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1): 109. The pYB1k vector has been published.)

[0056] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0057] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0058] The above-mentioned atsus gene fragment and the pYB1k expression vector fragment were ligated using the Gibson assembly method.

[0059] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, followed by adding 1 mL of LB medium, and placed on a 37°C shaker for 1 hour to recover, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight.

[0060] Several monoclonal strains were selected for culture, and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmid was named pYB1k-atsus.

[0061] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0062] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0063] E. coli BW25113 competent cells were prepared by the CaCl2 method, and the recombinant expression vector pYB1k-atsus was transferred into the E. coli BW25113 competent cells, and then the cells were spread on LB plates containing kanamycin and cultured at 37°C overnight. The positive clone containing pYB1k-atsus was selected and named AtSUS.

[0064] Example 2

[0065] Construction of recombinant Escherichia coli UGT91C1 expressing wild-type glycosyltransferase UGT91C1

[0066] Using ugt91c1-F and ugt91c1-R as primers and the cDNA of glycosyltransferase UGT91C1 from wild-type rice (Oryza sativa) as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct ugt91c1 gene fragment.

[0067] ugt91c1-F:

[0068] CTTTAAGAAGGAGATATACCATGGATTCGGGTTACTCTTCC(SEQ ID NO.13)

[0069] ugt91c1-R:

[0070] CTTGTCGACGGAGCTCGAATTCTTAGTCTTTATAGCTACGGAG(SEQ ID NO.14)

[0071] Using pET28a-F and pET28a-R as primers and pET28a empty vector as template, PCR amplification was performed with high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct pET28a expression vector fragment. (PeiWang, Hai-YanZhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiplex modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342, 2021, 126050. The pET28a vector has been disclosed).

[0072] pET28a-F:GAATTCGAGCTCCGTCGACAAG (SEQ ID NO.15)

[0073] pET28a-R: GGTATATCTC CTTCTTAAAG (SEQ ID NO.16)

[0074] The above ugt91c1 gene fragment and the pET28a expression vector fragment were connected using the Gibson assembly method.

[0075] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, followed by adding 1 mL of LB medium, and placed on a 37°C shaker for 1 hour to recover, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight.

[0076] Multiple monoclonal strains were selected for culture, and PCR verification was performed using primers T7-F and ugt91c1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmid was named pET28a-ugt91c1.

[0077] T7-F: TAATACGACTCACTATAGGG (SEQ ID NO.17)

[0078] ugt91c1-F300-R:GGCGGTGCAGTTCAACCATG(SEQ ID NO.18)

[0079] After the competent cells of E. coli BL21 (DE3) were prepared by the CaCl2 method, the recombinant expression vector pET28a-ugt91c1 was transferred into the competent cells of E. coli BL21 (DE3), and then spread on LB plates containing kanamycin and cultured at 37°C overnight. The positive clone containing pET28a-ugt91c1 was selected and named as recombinant E. coli UGT91C1.

[0080] Example 3

[0081] Construction of a mutant library of glycosyltransferase UGT91C1

[0082] UGT91C1 was randomly mutated by error-prone PCR, and ugt91c1-ATG-F and ugt91c1-TAA-R were used as primers, pET28a-ugt91c1 plasmid was used as template, and ep-PCR amplification was performed using the low-fidelity property of rTaq DNA polymerase (TAKARA). The amplification system and amplification procedure are shown in Tables 1 and 2.

[0083] ugt91c1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.19)

[0084] ugt91c1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.20)

[0085] Table 1 Error-prone PCR amplification system

[0086]

[0087] Table 2 Error-prone PCR amplification procedures

[0088]

[0089] After PCR product purification, the mutant gene fragments of UGT91C1 were obtained, and these fragments were connected to the vector pET28a using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT91C1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0090] Table 3 Gibson ligation reaction system

[0091]

[0092]

[0093] After reacting in a 50°C water bath for 1 hour, the plasmid containing the UGT91C1 mutant gene was transferred to E. coli DH5α competent cells for culture, and then placed in a shaker for 1 hour for recovery. After recovery, it was spread on a plate and placed in a 37°C incubator for 12 hours. After the colonies grew, 5 monoclonal strains were randomly selected, and their plasmids were extracted for sequencing. Subsequently, the colonies on the plate were scraped with a glass rod, and the plasmids were extracted to obtain a plasmid mutant library, which was stored at -20°C for subsequent high-throughput screening of the mutant library.

[0094] Example 4

[0095] High-throughput screening of superior mutants

[0096] After the random mutation library was constructed, a monoclonal colony on the plate was picked with a high-temperature and high-pressure sterilized toothpick and inoculated into a 96-well deep-well plate containing 800 μL LB medium (containing kanamycin sulfate). The seed solution was obtained by shaking and culturing at 37°C and 900 rpm in a 96-well plate shaker for 24 hours.

[0097] Use an inoculation needle to dip the seed solution and transfer it to another new 96-well plate LB medium containing kanamycin sulfate (final concentration of 50 μg / mL). Cultivate at 37°C and 900 rpm until the OD of the culture solution reaches 600 When the pH reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.4 mM, and continue induction culture for 22 hours at 30°C and 900 rpm in a 96-well plate shaker. After the induction culture is completed, the bacteria are collected by centrifugation at 3000×g for 20 minutes. Add the lysozyme solution to each well, mix thoroughly, let the lysozyme fully act on the cells, break the cells and release the intracellular enzymes. After the cell breakage is completed, centrifuge at 4°C and 3000×g for 20 minutes in a refrigerated centrifuge to obtain the glycosyltransferase UGT91C1 mutant enzyme solution.

[0098] Preparation of AtSUS enzyme solution: Use an inoculation needle to dip the seed solution of recombinant E. coli AtSUS and transfer it to a triangular flask containing 10 mL of LB medium, which also contains kanamycin sulfate (final concentration of 50 μg / mL). Cultivate in a shaking incubator at 37°C and 220 r / min. When OD 600 When the pH value reached 0.6-0.8, L-arabinose was added to a final concentration of 1 mM, and the culture was continued at 30°C and 220 r / min for 22 h. After centrifugation, the cells were collected and ultrasonically disrupted, and then centrifuged at 5000×g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0099] Reaction system: 7mM rebaudioside A, 42mM sucrose, 1.6mM UDPG, 0.16mL AtSUS enzyme solution, 0.16mL glycosyltransferase UGT91C1 mutant enzyme solution and wild-type UGT91C1 enzyme solution, add 100mM sodium phosphate buffer and mix. After reacting in a 37℃ water bath for 6h, heat for 5min to terminate the reaction, and the pH of the reaction system is 8.

[0100] DNS detection: Centrifuge the reaction product in a refrigerated centrifuge at 4°C, 3000×g for 20 minutes, and collect the reaction supernatant. Add 70μL of the reaction supernatant and 210μL of DNS to a clean 96-well plate, mix well, and heat for 5 minutes to perform DNS color reaction. Cool to room temperature, centrifuge at 3000×g for 18 minutes, take 200μL of the supernatant to a 96-well ELISA plate, and detect its OD using an ELISA reader. 540 Numerical value.OD 540 The UGT91C1 mutant used in the reaction solution with the higher value is the mutant with higher activity, and the test is then repeated in the vial.

[0101] Vial validation: OD obtained by 96-well plate screening 540 After the mutant with high value, the mutant single colony, wild-type UGT91C1 single colony and recombinant E. coli AtSUS single colony were picked and inoculated into test tubes respectively, and placed in a shaker at 37°C and 220rpm for 12h to obtain seed solution. The seed solution was inoculated into 20mL LB medium (containing kanamycin sulfate with a final concentration of 50μg / mL) at a volume ratio of 1%, and continued to be shaken at 37°C and 220rpm until OD 600When the pH value was 0.6-0.8, IPTG with a final concentration of 0.4 mM was added to the culture medium of the mutant and wild-type UGT91C1 for induction, and L-arabinose with a final concentration of 1 mM was added to the culture medium of AtSUS for induction. All three were cultured at 30°C and 220 rpm for 15 h. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), and the bacteria were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer, respectively, and the enzyme solution of the UGT91C1 mutant, the wild-type UGT91C1 enzyme solution and the sucrose synthase AtSUS enzyme solution were obtained by crushing and centrifugation.

[0102] The reaction system in the vial was as follows: 8 mM rebaudioside A, 48 mM sucrose, 1.6 mM UDPG, 0.5 mL UGT91C1 mutant enzyme solution or wild-type UGT91C1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer was added to the total system to 10 mL. The pH of the reaction system was 8. The reaction was placed in a water bath at 37 °C for 6 h, and then the reaction was terminated by boiling water bath for 5 min. The supernatant was centrifuged at 10,000 × g for 2 min, and the DNS reaction was performed. The OD 540 The reaction solution catalyzed by the mutant with a higher value than the wild-type UGT91C1 was tested by HPLC to verify the production of rebaudioside D.

[0103] Filter results:

[0104] After multiple screenings of the UGT91C1 mutant library, the inventors finally obtained seven excellent mutants from nearly 500,000 mutants, all of which had higher enzyme activities than the wild type, and the efficiency of catalyzing rebaudioside A to synthesize rebaudioside D was greatly improved. The results of rebaudioside D production are shown in Figure 2. Figure 1 As shown. Among them, the yield of rebaudioside D of the optimal mutant 2-12E is nearly 30 times higher than that of the wild type. After sequencing, the amino acid sequence of the mutant 2-12E is obtained by mutating the 89th amino acid from N to Y, the 155th amino acid from M to L, the 274th amino acid from S to T, and the 361st amino acid from N to S based on the amino acid sequence shown in SEQ ID NO.1.

[0105] Example 5

[0106] Scale-up study on the synthesis of rebaudioside D by the best mutant 2-12E

[0107] The seed liquid of mutant 2-12E and sucrose synthase AtSUS was inoculated into 400 ml LB medium (containing kanamycin sulfate with a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C and 220 rpm. 600When the pH value was 0.6-0.8, IPTG with a final concentration of 0.4 mM and L-arabinose with a final concentration of 1 mM were added to the two culture media in sequence for induction, and the induction culture was carried out at 30°C and 220 rpm for 15 hours. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), resuspended with 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and the bacteria were crushed and centrifuged to obtain UGT91C1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0108] The reaction system is as follows: 27.4 mM rebaudioside A, 164.4 mM sucrose, 1 mM UDPG, 10 mL AtSUS enzyme solution, 10 mL 2-12E enzyme solution, and 100 mM sodium phosphate buffer to 100 mL. Reaction conditions: pH of the reaction system is 8, and the reaction is carried out at 37°C for 15 h.

[0109] The reaction solution was sampled every 4 hours, and the yield of rebaudioside D was detected by HPLC to show the trend of the change of conversion time. Figure 2 As shown, the optimal mutant 2-12E could convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 h, and the RA conversion rate reached 94.2%.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT91C1 mutant, characterized in that: The UGT91C1 mutant is any one of the following (A)-(C): (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The 89th amino acid mutated from N to Y; The amino acid at position 155 mutated from M to L; The amino acid at position 274 mutated from S to T; The amino acid at position 361 mutated from N to S; (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function; (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

2. The glycosyltransferase UGT91C1 mutant according to claim 1, characterized in that The amino acid sequence of the UGT91C1 mutant is shown in SEQ ID NO.

3.

3. A biomaterial, characterized in that: The biological material includes any one of the following: (A) an expressed gene encoding the glycosyltransferase UGT91C1 mutant according to claim 1 or 2; (B) a recombinant plasmid containing the expression gene described in (A); (C) A recombinant cell comprising the recombinant plasmid or the glycosyltransferase UGT91C1 mutant expression gene.

4. An enzyme composition, characterized in that The enzyme composition comprises the glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS according to claim 1 or 2; The sucrose synthase AtSUS is as follows (B1) or (B2): the amino acid sequence of (B1) is shown in SEQ ID NO.5; (B2) A protein having an amino acid sequence identity of 95% or 98% or more to that of (B1) and having the same function.

5. A set of recombinant strains for expressing the enzyme composition according to claim 4, characterized in that: The complete set of recombinant strains includes recombinant strain A and recombinant strain B: The recombinant strain A contains the recombinant plasmid according to claim 3; The recombinant strain B contains a recombinant plasmid B, and the recombinant plasmid B is obtained by constructing the coding gene of sucrose synthase AtSUS into the plasmid.

6. The set of recombinant strains according to claim 5, characterized in that: The host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

7. A method for synthesizing rebaudioside D using a glycosyltransferase UGT91C1 mutant, characterized in that: The following steps are involved: Rebaudioside A, UDPG, sucrose and the enzyme composition described in claim 4 or the induced expression enzyme product of the complete set of recombinant strains in claim 5 are added to the catalytic reaction system. After the reaction is completed, the enzyme is inactivated, centrifuged, and the supernatant is collected. The supernatant contains rebaudioside D.

8. The method according to claim 7, characterized in that The inducible expression enzyme products of the set of recombinant strains in claim 5 include inducible expression enzyme product A and inducible expression enzyme product B; The method for obtaining the induced expression enzyme product A is as follows: The seed solution of the recombinant strain A in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture solution is 600 When the pH value reaches 0.6 to 0.8, isopropyl-β-D-thiogalactoside is added for induction culture for 8 to 40 hours, and the cells are collected by centrifugation. Lysozyme solution is added to the cells to break the cells or ultrasonically break the cells, and the cells are centrifuged. The supernatant is collected to obtain the induced expression enzyme product A; the final concentration of kanamycin sulfate is 10 to 100 μg / mL; the final concentration of isopropyl-β-D-thiogalactoside is 0.01 to 1 mM; The method for obtaining the induced expression enzyme product B is as follows: The seed solution of the recombinant strain B in claim 5 is inoculated into a culture medium containing kanamycin sulfate, and cultured at 25-40°C and 200-300 r / min until the OD 600 When the pH reaches 0.6 to 0.8, L-arabinose is added to continue induction culture for 8 to 40 hours, centrifuged and the bacteria are collected, lysozyme solution is added to the bacteria to break the cells or ultrasonically break the cells, centrifuged, and the supernatant is collected to obtain the induced expression enzyme product B; the final concentration of kanamycin sulfate is 10 to 100 μg / mL; the final concentration of L-arabinose is 0.1 to 15 mM.

9. The method according to claim 7 or 8, characterized in that: In the catalytic reaction system, the concentration of rebaudioside A is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the addition amount of the induced expression enzyme product A is 0.1-50 mL, and the addition amount of the induced expression enzyme product B is 0.1-50 mL.

10. The method according to claim 7 or 8, characterized in that: The pH value of the catalytic reaction system is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours.

Images