Esterase mutant, engineering bacterium and application in splitting R, S-2, 6-dimethyl phenyl amino methyl propionate

Abstract

The invention discloses an esterase mutant, an engineering bacterium and application of the esterase mutant in resolution of R, S-2, 6-dimethyl phenyl amino methyl propionate, a coding gene of the esterase mutant provided by the invention can be cloned and expressed in escherichia coli, and the mutant esterase has high R-selectivity on the R, S-2, 6-dimethyl phenyl amino methyl propionate. A mutant esterase WZest-W23T recombinant bacterium wet cell is used for catalyzing and hydrolyzing a substrate, the concentration of the substrate is 5g / L, the reaction is carried out for 10 minutes, the conversion rate of the substrate reaches 44.64%, the eep value of the product R-2, 6-dimethyl phenyl aminopropionic acid is 94.70%, and the enantiomer selectivity E value reaches 85.0.

Description

(I) Technical field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an esterase mutant derived from Burkholderia sp. and an application thereof in splitting R, S-2, 6-dimethylphenylaminopropionic acid methyl ester. (II) Background technology

[0002] Metalaxyl is an amide agricultural fungicide that is biologically active against downy mildew, phytophthora and rot fungi. Metalaxyl has two isomers, S and R. The metalaxyl sold on the market is mainly the racemic form, but the main bactericidal form is R-metalaxyl, and the R-isomer is 20 to 30 times more effective than the S-isomer. The preparation of high-purity R-isomers can reduce the total amount of pesticides released into the environment and reduce the expansion of inactive isomers in the biosphere, thereby reducing potential side effects on non-target organisms. In addition, the amount of optically pure products is half that of racemic products, which is beneficial to the production, transportation and storage of products.

[0003] At present, a large number of chiral compounds are prepared by chemical resolution. The use of bioenzymatic methods to resolve chiral compounds has obvious advantages over chemical resolution: (1) Enzyme-catalyzed reactions usually have a high degree of stereospecificity. Therefore, the optical purity of the obtained products is very high. (2) There are few side reactions, high yields, and simple product separation and purification. (3) Enzyme-catalyzed reactions are mostly carried out under very mild conditions, and the production safety is high.

[0004] Esterase is a type of hydrolase that can catalyze the formation and disconnection of ester bonds. It has many types and a wide source, and does not require coenzymes. In addition, many esterases have high stereoselectivity for substrates, so esterases are widely used in the production of food, materials, chemicals, and drugs.

[0005] R,S-2,6-dimethylphenylaminopropionic acid methyl ester (abbreviated as R,S-MAP) is an intermediate in the production of agricultural fungicide R,S-metalaxyl. The splitting of R,S-MAP can produce chiral pesticide R-metalaxyl. At present, the enzyme catalysts reported at home and abroad for selective splitting of (R,S)-MAP mainly include: lipase, such as Lipase PS (from Burkhloderia cepacia, Amano), Lipase OF (Candida rugose), Lipase QLM (Alcaligenes sp.); alkaline protease Alcalase (Bacillus licheniformis) and acyltransferase Acylase Amano (Aspergillus melleus) (ParkO, 2005); esterase EHest (Achromobacter denitrificans 1104) (Lu Yanan, 2016), PAE07 (Pseudochrobactrum asaccharolyticum WZZ003) (Yin-Jun Zhang, 2023). Some of these enzymes have R-type stereoselectivity for substrates (such as Lipase PS, EHest and PAE07), and some enzymes have S-type stereoselectivity for substrates (such as Lipozyme RMIM). Domestically disclosed esterase patents that can split R, S-MAP include: CN201510497747.7 (esterase from the genus Achromobacter), CN202010679906.6 (esterase from the genus Pseudochrobactrum). The chiral selectivity of these patented esterases for substrates is R-type. The process route for splitting R, S-MAP to produce R-metalaxyl using R-selective hydrolases is as follows: Figure 1 As shown in (Park O, 2006), the enzyme hydrolyzes R-MAP into R-MAP acid (S-MAP is not hydrolyzed), and then re-esterifies R-MAP acid to form R-MAP, which is then further synthesized into R-metalaxyl. (III) Summary of the invention

[0006] The present invention aims to provide an esterase mutant, an engineered bacterium and an application thereof in the splitting of R,S-2,6-dimethylphenylaminopropionic acid methyl ester. The wild-type esterase WZest has almost no enantiomeric selectivity for a substrate (E value is 1.15). The mutant obtained by transformation of the present invention has high R-selectivity, wherein the TE value of the mutant WZest-W23 reaches 85.0, and the catalytic rate is increased by 35%.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides an esterase mutant, which is obtained by mutating the 23rd position of the esterase amino acid sequence shown in SEQ ID NO. 2. The esterase (WZest) is derived from Burkholderia sp., and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 1.

[0009] Furthermore, the esterase mutant is obtained by mutating the tryptophan W at position 23 of the amino acid sequence shown in SEQ ID NO.2 to threonine T.

[0010] Due to the particularity of the amino acid sequence, any fragment or variant of the polypeptide containing the amino acid sequence shown in SEQ ID NO.2 or after mutation, such as its conservative variant, biologically active fragment or derivative, as long as the homology of the polypeptide fragment or polypeptide variant with the aforementioned amino acid sequence is more than 80%, belongs to the scope of protection of the present invention. Specifically, the change may include the deletion, insertion or substitution of amino acids in the amino acid sequence.

[0011] The present invention also relates to a recombinant expression vector and a recombinant genetic engineering bacterium constructed by the coding gene of the esterase mutant. The recombinant expression vector uses pET28a(+) as a basic vector; the recombinant genetic engineering bacterium uses E.coliBL21(DE3) as a host bacterium. The present invention uses inverse PCR to construct a mutant recombinant bacterium.

[0012] The present invention also provides an application of the esterase mutant in the preparation of R-2,6-dimethylphenylaminopropionic acid (R,S-MAP acid) by splitting R,S-2,6-dimethylphenylaminopropionic acid methyl ester (R,S-MAP). The application method comprises the following steps: using wet bacteria obtained by induction culture of recombinant genetic engineering bacteria expressing the esterase mutant as a catalyst, using R,S-MAP as a substrate, using Tween 80 as a cosolvent, and using a pH 7-9 buffer as a reaction medium to form a conversion system, reacting completely under the conditions of 20-40° C. and 100-300 rpm (preferably 30° C. and 200 rpm) to obtain R-2,6-dimethylphenylaminopropionic acid.

[0013] Furthermore, in the transformation system, the final concentration of wet bacteria added is 10-50 g / L, preferably 20 g / L; the final concentration of substrate added is 2-10 g / L, preferably 5 g / L; and the final concentration of Tween 80 added is 1-5 g / L, preferably 5 g / L.

[0014] Furthermore, the reaction medium is preferably 100 mM sodium phosphate buffer at pH 8.0.

[0015] Furthermore, the catalyst is prepared as follows: the recombinant genetically engineered bacteria are inoculated into an LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm for 12-16 hours to obtain a seed solution; then the seed solution is inoculated into an LB liquid culture medium containing 50 μg / mL kanamycin at a volume concentration of 1% inoculation amount, and cultured in a constant temperature shaker at 37°C and 200 rpm for 3 hours, IPTG is added to a final concentration of 0.1 mM, and induced at 24°C and 180 rpm for 12 hours; after the fermentation is completed, centrifuge at 4°C and 8000 rpm for 10 minutes to obtain wet bacteria.

[0016] The composition of the seed culture medium is as follows: 5.0 g glucose, 0.8 g K2HPO4, 3.0 g KH2PO4, 1.0 g NaCl, 0.4 g MgSO4, 10.0 mL trace element solution, add 800 mL deionized water, adjust the pH to 7.0, and then make up to 1 L with deionized water, sterilize at 115 °C for 15 min;

[0017] The composition of the trace element liquid: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4.7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O0.01g / L, EDTA·2Na 1.0g / L, the solvent is deionized water; preparation method: accurately weigh 1.0g EDTA·2Na, dissolve it in 800mL deionized water, then add the remaining other components in turn, and finally add deionized water to make up to 1L;

[0018] The fermentation medium composition: tryptone 15.0g, yeast powder 5.0g, NaCl 0.5g, K2HPO4 1.0g, MgSO41.0g, KH2PO4 0.8g, add 800mL deionized water, adjust the pH to 7.0, then make up to 1L with deionized water, and sterilize at 121℃ for 20min.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] The coding gene of the esterase mutant provided by the present invention can be cloned and expressed in Escherichia coli, and the mutant esterase has high R-selectivity for R, S-2, 6-dimethylphenylaminopropionic acid methyl ester. The mutant esterase WZest-W23T wet bacteria was used to catalyze the hydrolysis of the substrate, with a substrate concentration of 5 g / L and a reaction time of 10 min. The conversion rate of the substrate reached 44.64%, and the ee of the product R-2, 6-dimethylphenylaminopropionic acid was 1. p The value is 94.70%, and the enantiomeric selectivity E value reaches 85.0. (IV) Description of the drawings

[0021] Figure 1 , the process route of producing R-metalaxyl by splitting R,S-MAP using R-selective hydrolase.

[0022] Figure 2 , PCR verification of recombinant plasmid; M: Maker; Lane 1: pET-28a(+)-GE04845 recombinant plasmid; Lane 2: pET-28a(+) empty plasmid control; Lane 3: esterase gene fragment.

[0023] Figure 3 , SDS-PAGE of the expression product of the recombinant bacteria E. coli BL21(DE3)-pET-28a(+)-GE04845; M: Maker; Lane 1: with IPTG induction; Lane 2: without IPTG induction; Lane 3: empty plasmid control.

[0024] Figure 4 , normal phase HPLC chart of the hydrolysis and separation of (R,S)-MAP by WZest-W23T recombinant bacteria for 10 minutes. The retention times of R-MAP and S-MAP were 13.2 and 13.8 minutes, respectively.

[0025] Figure 5 , esterase WZest and two esterases with the same application disclosed in domestic patents were compared for multiple sequences (yellow indicates consistent amino acids).

[0026] Figure 6 , esterase WZest and two esterase amino acid sequences with the same application that have been disclosed in domestic patents. A: Pairwise alignment with the amino acid sequence of esterase from Achromobacter, B: Pairwise alignment with the amino acid sequence of esterase from Pseudochrobactrum. (V) Specific implementation methods

[0027] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto: the experimental methods described in the following embodiments are conventional methods unless otherwise specified; the reagents and biological materials described are all commercially available unless otherwise specified.

[0028] Burkholderia sp. zjutQ19, deposited in the China Center for Type Culture Collection, the deposit date is December 6, 2023, the deposit number is CCTCC NO: M 20232426, the deposit address is: Wuhan University, Wuhan, China, Postal Code 430072, and has been disclosed in patent application 202410233252.2.

[0029] Example 1: Amplification of wild-type esterase WZest gene GE04845 and construction of recombinant genetic engineering bacteria

[0030] 1. Extraction of genomic DNA from Burkholderia sp. CCTCC NO: M 20232426

[0031] Burkholderia sp. CCTCC NO: M 20232426 was inoculated into a seed culture medium, and cultured in a constant temperature shaker at 30°C and 200 rpm for 24 hours to obtain a seed solution. The seed solution was then transferred to a fermentation medium at an inoculation volume of 5%, and cultured in a constant temperature shaker at 30°C and 200 rpm for 24 hours. The fermentation solution was centrifuged to collect wet cells. The genomic DNA of the strain was extracted according to the instructions of the SK8255 column-type bacterial genomic DNA extraction kit.

[0032] The composition of the seed culture medium is: glucose 5.0 g, K2HPO4 0.8 g, KH2PO4 3.0 g, NaCl 1.0 g, MgSO4 0.4 g, trace element solution 10.0 mL, add 800 mL of deionized water, adjust the pH to 7.0, then make up to 1 L with deionized water, and sterilize at 115°C for 15 min.

[0033] Composition of trace element liquid: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4.7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O0.01g / L, EDTA·2Na 1.0g / L, the solvent is deionized water; preparation method: accurately weigh 1.0g EDTA·2Na, dissolve it in 800mL deionized water, then add the remaining components in sequence, and finally add deionized water to make up to 1L.

[0034] The fermentation medium composition: tryptone 15.0g, yeast powder 5.0g, NaCl 0.5g, K2HPO4 1.0g, MgSO41.0g, KH2PO4 0.8g, add 800mL deionized water, adjust the pH to 7.0, then make up to 1L with deionized water, and sterilize at 121℃ for 20min.

[0035] 2. Amplification of gene GE04845 and construction of recombinant genetically engineered bacteria

[0036] Use the genomic DNA extracted in step 1 as a template to amplify the target gene, design specific primers, and insert restriction sites EcoRⅠ and HindⅢ into the primers. The designed primers are as follows:

[0037] Upstream primer: CGCGGATCCGAATTCGAGATGGAGACGAACGTAACCGC;

[0038] Downstream primer: CGAGTGCGGCCGCAAGCTTGTCAGCTTTTCGCGATATCCG.

[0039] After the PCR reaction was completed, the amplified product was detected by agarose gel electrophoresis, and there was an obvious band at 900 bp and no non-specific bands, which was consistent with the expected size.

[0040] Using AxyPrep TM The target fragment was recovered by gel excision using DNA Gel Extraction G Kit. The target fragment and pET28a(+) were double-digested with restriction endonucleases QuickCut EcoRⅠ and QuickCut HindⅢ (Takara), respectively. The target fragment and pET-28a(+) after digestion were ligated, and the ligation product was transformed into the host bacteria E. coli BL21(DE3) to obtain recombinant E. coli BL21(DE3)-pET-28a(+)-GE04845.

[0041] The recombinant E. coli was spread on LB plates containing 50 μg / mL kanamycin and cultured in a 37°C constant temperature incubator overnight. Single colonies on several plates were randomly picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C overnight. The recombinant plasmid was extracted using a plasmid DNA mini kit, double-digested, and the pET28a(+) empty vector was used as a control to perform plasmid PCR verification (see Figure 2 ), and there is a 900bp band in lane 3, which is consistent with expectations. The recombinant plasmid was sent for sequencing, and the sequencing results showed that the recombinant E. coli was successfully constructed.

[0042] LB liquid culture medium composition: 5.0 g yeast powder, 10.0 g tryptone, 10.0 g sodium chloride, add 800 mL deionized water, adjust the pH to 7.0, then make up to 1 L with deionized water, and sterilize at 121°C for 20 min.

[0043] LB solid medium: Add 20 g / L agar powder to LB liquid medium.

[0044] Example 2: Expression of wild-type recombinant esterase WZest and catalytic performance of recombinant bacteria

[0045] A single colony of the recombinant E. coli BL21(DE3)-pET-28a(+)-GE04845 grown on a plate in Example 1 was picked up and inoculated into 50 ml of LB medium containing 50 μg / mL kanamycin. The culture was carried out at 37°C and 180 rpm for 12 h until the OD value of the bacterial solution reached 0. 600 The inoculum concentration was 0.5-0.8. The inoculum concentration was 1% by volume and inoculated into 50 ml of liquid LB medium containing 50 μg / mL kanamycin. The culture was cultured in a constant temperature shaker at 37°C and 180 rpm for 3 hours, and IPTG was added to a final concentration of 0.1 mM. The culture was induced at 24°C and 180 rpm for 12 hours. The induced culture was homogenized at 4°C and centrifuged at 4°C and 10,000 rpm for 30 minutes. The supernatant and wet cells were used as follows:

[0046] The supernatant was subjected to SDS-PAGE electrophoresis analysis. Figure 3 As shown. Figure 3 It can be seen that after IPTG induction, the recombinant E. coli overexpressed the target protein with a size of about 38 KDa (lane 1), which was consistent with expectations.

[0047] The substrate R, S-MAP was catalyzed and hydrolyzed using the recombinant wet bacterial cells as catalysts. The wet bacterial cells were resuspended in 100mM sodium phosphate buffer at pH 8.0 to a wet bacterial cell concentration of 20g / L, and then R, S-MAP at a final concentration of 5g / L and Tween 80 at a final concentration of 5g / L were added to form a 10mL reaction system. The catalytic reaction was carried out at 30°C and 200rpm for 15min. The substrate and product contents were detected by normal phase HPLC. The substrate conversion rate was 49.56%, and the ee p The enantiomeric selectivity E value was 8.21% and 1.15 (almost no enantiomeric selectivity).

[0048] Normal phase chiral HPLC detection. Mobile phase is n-hexane: isopropanol = 98:2 (add 0.1% trifluoroacetic acid), flow rate: 0.5 ml / min, detection UV wavelength: 220 nm, column temperature: 30°C, injection volume: 10 μl, chromatographic column: 250 mm × 4 mm, Daicel chiral OD column. Chromatograph Waters.

[0049] The enantiomeric excess (ee p ), substrate conversion rate (C) and enantiomeric selectivity (E) are calculated as follows:

[0050]

[0051] Note: In the above formula, [P] R and [P] S Represent the contents of R-MAP acid and S-MAP acid in the products, respectively.s0 and C s Represented as the substrate R, S-MAP concentrations at the initial reaction and time t, respectively.

[0052] Example 3: Screening of esterase WZest mutants and construction of engineered bacteria

[0053] 1. Screening of mutation sites

[0054] The following six amino acid residues were selected as mutation sites for the wild-type esterase WZest: (1) amino acid residues A22 and M112 that constitute the esterase oxygen anion pore. (2) amino acid residues G21 and W23 before and after the oxygen anion pore. (3) H110 and L192, the former is located on a loop close to the substrate active site and is the residue before the catalytic triad active residue S111; the latter is located on another loop close to the hydrophobic part 2,6-dimethylphenyl of the substrate. The established mutation library is shown in Table 1.

[0055] Table 1 Esterase WZest mutation modification sites and mutation library

[0056]

[0057] The mutant was constructed by the method of step 2, and the substrate conversion rate and ee of the mutant were detected by the method of Example 1. p The experimental results showed that among the 33 mutants in Table 1, a total of 7 changed enantiomeric selectivity, of which 4 became R-selective (W23T, A22I, A22V and L192S) and 3 became S-selective (L192A, G21A, H110I). Among the 4 R-selective mutants, WZest-W23T had the highest R-selectivity (enantiomeric selectivity E value of 85). Among the 3 S-selective mutants, WZest-H110I had the highest S-selectivity (E value of 6.21).

[0058] 2. Construction of the esterase mutant WZest-W23T engineering bacteria

[0059] The plasmid was extracted from the bacterial solution of the esterase WZest engineering bacteria E. coli BL21 (DE3)-pET-28a (+)-GE04845, and the pET-28a (+)-GE04845 plasmid was used as a template and a high-fidelity enzyme was used for reverse phase PCR. The designed primers are shown in Table 2, the PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0060] Table 2W23T site-directed mutant full plasmid PCR primers

[0061]

[0062] Note: -F, -R are upstream and downstream primers respectively. The underlined part is the mutation site

[0063] PCR system (50 μL):

[0064] Table 3 PCR reaction system

[0065]

[0066] PCR reaction procedure:

[0067] Table 4 PCR reaction program

[0068]

[0069] In order to avoid the false positive effect of the template plasmid on the transformation, the template DNA needs to be digested before the circularization product. The digestion system is: 40-50μL PCR product, 1μL Dpn I, mix well and react in a constant temperature metal bath at 37℃ for 2h.

[0070] Recombination reaction: Take 2 μL of the product after Dnp I digestion, add 2 μL 5×CE II buffer, 1 μL Express II, and finally fill the volume to 20 μL with ddH2O. Perform the reaction in a metal bath at 37°C for 30 min and then quickly cool on ice.

[0071] Take 10 μL of the above recombination reaction product, mix it with 100 μL of E.coli BL21 (DE3) competent cells, and place it on ice for 30 minutes. Then transfer it to a 42°C water bath, heat shock it for 45 seconds, and quickly place it on ice. Then add 900 μL of LB liquid culture medium and culture it at 37°C and 200 rpm for 45-60 minutes. Centrifuge at 5000 rpm for 3 minutes, remove the supernatant and resuspend the cells. Spread the cell resuspension on the LB solid plate containing Kan resistance, and invert and culture it at 37°C for 16-20 hours. The single colony that grows well on the plate is the mutant engineered bacteria E.coli BL21 (DE3) - pET-28a (+) - GE04845-W23T.

[0072] Example 4: Mutant enzyme WZest-W23T recombinant bacteria catalyzes the hydrolysis of R,S-2,6-dimethylphenylaminopropionic acid methyl ester

[0073] The catalytic performance of the wet cell of the mutant enzyme WZest-W23T recombinant bacteria constructed in Example 3 was measured according to the method and conditions of Example 2.

[0074] The results are shown in Table 5 and Figure 4, indicating that the WZest-W23T mutant recombinant bacteria has high R-selectivity for the substrate, the E value is increased to 85.0, and the catalytic reaction rate is increased by 35% compared with the WZest recombinant bacteria.

[0075] Table 5 Comparison of the catalytic performance of the original enzyme WZest and the mutant enzyme WZest-W23T recombinant bacteria on the substrate (R,S)-MAP

[0076]

[0077] *E=1 means no chiral selectivity

[0078] Example 5: Sequence Alignment

[0079] Currently, the relevant esterases available in China for hydrolyzing (R,S)-2,6-dimethylphenylaminopropionic acid methyl ester are: esterase from the genus Achromobacter (CN201510497747.7) and esterase from the genus Pseudochrobactrum (CN202010679906.6).

[0080] The amino acid sequences of esterase WZest were compared with those of the two esterases reported above. Figure 5 (Multiple Sequence Alignment), Figure 6 (pairwise comparison) and shown in Table 6. The results showed that the identities and similarities of esterase WZest were very low compared with the other two enzymes, indicating that the enzyme is a new esterase.

[0081] Table 6. Pairwise comparison of the amino acid sequences of the recombinant esterase WZest and two known esterases with the same application

[0082]

[0083]

[0084] *The amino acid sequence length of esterase WZest is 294aa.

[0085] Note: A represents esterase from Achromobacter; B represents esterase from Pseudochrobactrum

Claims

1. An esterase mutant, characterized in that The mutant is obtained by mutating the 23rd position of the esterase amino acid sequence shown in SEQ ID NO.

2.

2. The esterase mutant according to claim 1, characterized in that The esterase mutant is obtained by mutating the tryptophan W at position 23 of the amino acid sequence shown in SEQ ID NO.2 to threonine T.

3. A recombinant genetically engineered bacterium containing a gene encoding the esterase mutant according to claim 1.

4. Use of the esterase mutant according to claim 1 in the preparation of R-2,6-dimethylphenylaminopropionic acid by splitting R,S-2,6-dimethylphenylaminopropionic acid methyl ester.

5. The use according to claim 4, characterized in that The application method comprises the following steps: using wet bacteria obtained by induction culture of recombinant genetic engineering bacteria expressing esterase mutants as a catalyst, using R,S-2,6-dimethylphenylaminopropionic acid methyl ester as a substrate, using Tween 80 as a cosolvent, and using a pH 7-9 buffer as a reaction medium to form a conversion system, and reacting completely under the conditions of 20-40° C. and 100-300 rpm to obtain R-2,6-dimethylphenylaminopropionic acid.

6. The use according to claim 5, characterized in that In the transformation system, the wet bacteria are added to a final concentration of 10-50 g / L; the substrate is added to a final concentration of 2-10 g / L; and Tween 80 is added to a final concentration of 1-5 g / L.

7. The use according to claim 5, characterized in that The reaction medium is 100 mM sodium phosphate buffer at pH 8.

0.

8. The use according to claim 5, characterized in that The catalyst is prepared as follows: the recombinant genetically engineered bacteria are inoculated into a LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm for 12-16 hours to obtain a seed solution; then the seed solution is inoculated into a LB liquid culture medium containing 50 μg / mL kanamycin at a volume concentration of 1% inoculation amount, and cultured at 37°C and 200 rpm in a constant temperature shaker for 3 hours, IPTG is added to a final concentration of 0.1 mM, and induced at 24°C and 180 rpm for 12 hours; after the fermentation is completed, the mixture is centrifuged at 4°C and 8000 rpm for 10 minutes to obtain a wet cell; The composition of the seed culture medium is as follows: 5.0 g glucose, 0.8 g K2HPO4, 3.0 g KH2PO4, 1.0 g NaCl, 0.4 g MgSO4, 10.0 mL trace element solution, add 800 mL deionized water, adjust the pH to 7.0, and then make up to 1 L with deionized water, sterilize at 115 °C for 15 min; Trace element liquid composition: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4.7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O 0.01g / L, EDTA·2Na 1.0g / L, the solvent is deionized water; preparation method: accurately weigh 1.0g EDTA·2Na, dissolve it in 800mL deionized water, then add the remaining other components in turn, and finally add deionized water to make up to 1L; The fermentation medium composition: tryptone 15.0g, yeast powder 5.0g, NaCl 0.5g, K2HPO4 1.0g, MgSO41.0g, KH2PO4 0.8g, add 800mL deionized water, adjust the pH to 7.0, then make up to 1L with deionized water, and sterilize at 121℃ for 20min.

Images