SgRNA of targeted carassius auratus gibelio isg15 gene and application of sgRNA in improvement of herpes virus resistance of fish

Abstract

The invention provides sgRNA of a targeted carassius auratus gibelio isg15 gene and application of the sgRNA to improvement of herpes virus resistance of fishes. According to the invention, the CRISPR / Cas9 technology is utilized, the isg15-A gene and the isg15-B gene of the carassius auratus gibelio are subjected to targeted knockout to obtain an F0 generation chimera, and the F0 generation is subjected to gynogenesis and screening to obtain the isg15 homozygous mutant carassius auratus gibelio isg15- / - / -carassius auratus gibelio. After the crucian carp herpes virus is infected, the survival rate of the isg15 <- / - / -> of the crucian carp is obviously increased; the isg15 protein expression in the tissue is obviously reduced; meanwhile, the transcriptional level of the virus gene 39ring in the kidney is obviously reduced. Therefore, the gene edited fish prepared by the creation method provided by the invention improves the crucian carp herpesvirus resistance, provides a basis for disease-resistant breeding of the crucian carp, and also provides important reference value for disease-resistant breeding of other cultured fishes.

Description

Technical Field

[0001] The present invention belongs to the technical field of fish disease-resistant genes and specifically relates to a method targeting silver carp isg15 sgRNA of the gene and its application in improving the resistance of fish to herpes virus. Background Art

[0002] Interferon stimulated gene 15 (ISG15) is a protein induced by stimuli such as viruses, and plays an important role in immune regulation and tumorigenesis (Perng, et al. 2018). ISG15 is the earliest ubiquitin-like protein (UBL) identified. It is composed of two ubiquitin-like domains (UBQ). As a ubiquitin-like protein, ISG15 can regulate the immune response of host cells by binding to proteins through an enzyme cascade reaction (similar to the ubiquitination process, called ISGylation). Unbound ISG15 can also play an immunomodulatory role and inhibit the occurrence of type I interferon autoinflammation (Du, et al. 2018, Zhang, et al. 2015). ISG15 exists in all vertebrates, and studies have shown that the functions of ISG15 vary among species (Speer, et al. 2018). Currently, in living fish, isg15 There are few studies on the construction and function of gene mutants.

[0003] Aquaculture ensures global food supply and food security. Aquatic products provide humans with essential nutrients such as protein, vitamins and trace elements, and also enrich people's dietary choices. Carassius gibelio ) is an important economic fish in my country, with an annual production of nearly 3 million tons in China (Zhou and Gui, 2017). It is one of the most important freshwater aquaculture fish in my country. The silver crucian carp is a triploid crucian carp with more than 150 chromosomes (also known as allohexaploid AAABBB), which has the ability of parthenogenetic gynogenesis and reproduces through gynogenesis (Zhou and Gui, 2002). Taking advantage of the gynogenesis characteristics of the silver crucian carp, new aquatic species such as the tall-bodied heterogeneous silver crucian carp and the heterogeneous silver crucian carp "Zhongke No. 3" have been bred one after another.

[0004] Fish diseases caused by pathogenic microorganisms are an important cause of huge economic losses in the aquaculture industry, seriously affecting the production and quality of aquatic products. With the large-scale promotion of breeding of superior varieties of silver crucian carp, high-density breeding has led to the outbreak of many diseases in silver crucian carp, especially the prevalence of herpes virus diseases. Among them, the crucian herpes virus (CaHV) mainly infects the kidneys, gills and other tissues of silver crucian carp, causing acute gill bleeding in silver crucian carp. The mortality rate of silver crucian carp after infection with CaHV is very high (Zeng, et al. 2016). Therefore, it is necessary to create silver crucian carp resistant to herpes virus to cope with the outbreak of herpes virus and reduce the economic losses caused to the aquaculture industry. Summary of the invention

[0005] The object of the present invention is to provide a method for targeting silver carp isg15 Gene sgRNA and its application in improving the ability of fish to resist herpes virus. The present invention targets silver carp isg15 sgRNA knockout of genes isg15 Genes were constructed and screened using CRISPR / Cas9 technology. isg15 A homozygous silver crucian carp strain with gene deletion has a higher resistance to crucian carp herpes virus.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The invention provides a method for targeting silver carp isg15 The sgRNA of the gene includes isg15-A-sgRNA and isg15-B-sgRNA, the sequence of the isg15-A-sgRNA is shown in SEQ ID No.1, and the sequence of the isg15-B-sgRNA is shown in SEQ ID No.2.

[0007] The present invention provides amplification primers for the sgRNA, the upstream primer sequence of the isg15-A-sgRNA is shown as SEQ ID No.7; the upstream primer sequence of the isg15-B-sgRNA is shown as SEQ ID No.8; the downstream primer sequences of the isg15-A-sgRNA and isg15-B-sgRNA are shown as SEQ ID No.9.

[0008] The present invention provides a vector comprising sgRNA.

[0009] The present invention provides a CRISPR / Cas9 gene editing system, which comprises a Cas9 protein and the sgRNA.

[0010] The present invention provides the use of the sgRNA or the CRISPR / Cas9 gene editing system in improving the ability of fish to resist herpes virus.

[0011] Furthermore, the application method is: injecting a mixture of Cas9 protein and sgRNA into mature fish eggs to knock out the targeted isg15-A Genes and isg15-B Gene, obtain F0 generation chimera, perform gynogenesis and screening on F0 generation, obtain isg15 Gene-deficient strains are fish with improved resistance to herpes viruses.

[0012] Furthermore, the application specifically includes the following steps: (1) Evenly mixing the sgRNA, Cas9 protein and nuclease-free water, and injecting the mixture into mature eggs of silver carp; (2) taking sperm and fertilizing the injected mature eggs, and obtaining the F0 generation after hatching; (3) Screening the eggs produced by the F0 generation with successful knockout and fertilizing them with sperm, and hatching them through gynogenesis to produce the F1 generation; (4) Screening homozygous F1 generation, the eggs produced by them are obtained after female nucleus development isg15 Gene-deficient silver crucian carp is resistant to herpes virus.

[0013] Furthermore, the concentration of the sgRNA is 100 ng / μL~500 ng / μL; the volume ratio of the isg15-A-sgRNA, isg15-B-sgRNA, Cas9 protein, and nuclease-free water is 4:4:1:5.

[0014] Furthermore, the screening step for successful knockout in the F0 generation is as follows: the fertilized embryos are lysed as PCR templates and isg15-A Genes and isg15-B The detection primers of the target site of the gene are used for PCR amplification, and the PCR product is subjected to electrophoresis to verify the size of the target band. isg15-A The amplified fragment is 450 bp and isg15-B The amplified fragment is 911 bp. The PCR product is sequenced. If overlapping peaks appear in the sequencing peak graph, it means isg15 The gene knockout was successful.

[0015] Furthermore, the isg15-A The detection primer sequences of the target sites of the genes are shown in SEQ ID No.3 and SEQ ID No.4 respectively; isg15-B The detection primer sequences of the target sites of the genes are shown in SEQ ID No. 5 and SEQ ID No. 6 respectively.

[0016] Furthermore, the water temperature of the incubation is 22°C to 23°C.

[0017] Furthermore, the herpes virus is crucian carp herpes virus.

[0018] Furthermore, the freshwater fish includes silver carp.

[0019] Compared with the prior art, the present invention has the following advantages: The present invention uses CRISPR / Cas9 technology to knock out isg15-A Genes and isg15-B Gene, obtained isg15 Homozygous mutant silver carp, after being infected with herpesvirus, isg15 - / - / - The survival rate of silver crucian carp increased significantly, and the expression of isg15 protein in tissues decreased significantly. 39ring The transcription level of was significantly reduced. The gene-edited fish prepared by the creation method of the present invention has improved the resistance to crucian carp herpes virus, providing a basis for the disease-resistant breeding of silver crucian carp, and also providing important reference value for the disease-resistant breeding of other farmed fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 for isg15-A Genes and isg15-B Schematic diagram of gene mutation target sites.

[0021] Figure 2 For wild-type Carassius auratus and isg15 - / - / - Survival rate of silver carp infected with CaHV.

[0022] Figure 3 For wild-type Carassius auratus and isg15 - / - / - Expression of ISG15 protein in tissues of Carassius auratus gibelio infected with CaHV.

[0023] Figure 4 For wild-type Carassius auratus and isg15 - / - / - Virus genes in the kidneys of gibel carp infected with CaHV 39ring Transcription level.

[0024] Figure 5 To prove isg15 Sequencing peak map of successful gene knockout. DETAILED DESCRIPTION

[0025] The technical solutions of the present invention are conventional methods in the art unless otherwise specified; the reagents or materials used are from commercial sources unless otherwise specified. The application method of the present invention is applicable not only to silver carp, but also to other freshwater fish.

[0026] Embodiment 1: isg15 Obtaining a homozygous silver carp strain with gene deletion 1.1 Selection of sgRNA targets First search through NCBI isg15-A ( Carassius gibelio ) gene complete sequence (gene ID:128012972) and isg15-B ( Carassius gibelio ) gene complete sequence (gene ID: 127958337), according to isg15-A and isg15-B In different sequences of the second exon, we designed isg15-A and isg15-B Two specific knockout target sites. Target site prediction and screening comparison were performed through http: / / zifit.partners.org. The selected isg15-A The target sequence is: GTGAGCGGTGAAGCCACAGT (SEQ ID No. 1), isg15-B The target sequence is: GCCAGGAAACTCAGCGAATA (SEQ ID No. 2). In this experiment, sgRNA was designed on the second exon, and a pair of amplification primers were designed upstream and downstream of the target gene: Detection isg15-A The amplified fragment is 450bp, and the primer sequence is: F: GAACACTTCGGCAAACCACG (SEQ ID No. 3); R: CTTCATACGTTCCAATCTGGCC (SEQ ID No. 4).

[0027] Detection isg15-B The amplified fragment is 911 bp, and the primer sequence is: F: GCTCACCTCCATCCAGAGAC (SEQ ID No.5); R: GGCCAGCAGCACATATGTAG (SEQ ID No. 6).

[0028] 1.2 In vitro synthesis of sgRNA sgRNA with isg15-A The upstream primer of the target site isg15-A-sgRNA-F: GTAATACGACTCACTATAGTGAGCGGTGAAGCCACAGTGTTTTAGAGCTAGAAATAGC (SEQ ID No.7) and isg15-BThe upstream primer isg15-B-sgRNA-F of the target site: GTAATACGACTCACTATAGCCAGGAAACTCAGCGAATAGTTTTAGAGCTAGAAATAGC (SEQ ID No.8) was used for PCR amplification with the conservative downstream primer sgRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID No.9).

[0029] The amplification system is as follows:

[0030] (1) All PCR products were subjected to agarose gel electrophoresis and purified using a DNA gel recovery kit; (2) In vitro transcription was performed using the Thermo Transcript Aid T7 High Yield Transcription Kit. The transcription system was as follows:

[0031] (3) Mix well and centrifuge, then incubate in a 37°C incubator for 3 h; (4) Add 1 µL DNase and incubate at 37 °C for 30 min to remove the DNA template. (5) Add 1 µL EDTA and incubate at 60 °C for 10 min to terminate the reaction. (6) Add 30 µL LiCl and 30 µL RNase free water, mix well, and precipitate at -20 °C overnight; (7) Centrifuge at 15,000 g for 15 min at 4 °C; (8) Discard the supernatant, add 1 mL of RNase-free 70% ethanol for washing, and centrifuge at 15,000 g at 4 °C for 5 min. (9) Repeat the previous step; (10) After discarding the supernatant, dry for 5 min, add 30 µL of RNase-free water to dissolve for 5 min, take 1 µL and measure the RNA concentration and quality using NanoDrop2000 nucleic acid quantification instrument, dilute to 100 ng / µL, divide into aliquots and place at -80 °C for later use.

[0032] 1.3 Microinjection 2 μL isg15-A-sgRNA (SEQ ID No.1) 200 ng / μL, 2 μL isg15-B-sgRNA (SEQ ID No.2) 200 ng / μL, 0.5 μL 10X Cas9 protein and 2.5 μL nuclease-free water were mixed and 1-2 nL of the mixture was injected into A using a nitrogen-pressurized PLI100A quantitative microinjector (Warner). + The mature eggs of silver crucian carp were injected, about 200 eggs were injected each time, and some uninjected eggs were kept as controls; Xingguo red carp ( Cyprinus carpio ) sperm and mature fish eggs were artificially inseminated, and the fertilized fish eggs were transferred to an incubation tank with a water temperature of 22-23°C to hatch and obtain the F0 generation ( isg15 knockout chimeras).

[0033] 1.4 F0 target mutation efficiency detection and heritable screening (1) Take 15 embryos from the injection group and the control group, mix them separately, add 50 µL of NaOH (50 mM) lysis buffer using the alkaline lysis method, lyse at 95 °C for 30 min, and store at 4 °C as PCR template for later use; (2) Using the above product as a template, conventional PCR was performed to amplify a 450 bp fragment near the isg15-A target site. F: GAACACTTCGGCAAACCACG (SEQ ID No. 3); R: CTTCATACGTTCCAATCTGGCC (SEQ ID No. 4); The amplified fragment of isg15-B was 911 bp. F: GCTCACCTCCATCCAGAGAC (SEQ ID No.5); R: GGCCAGCAGCACATATGTAG (SEQ ID No. 6).

[0034] The PCR amplification system is: , (3) Take 6 μL of PCR product and perform 1.5% agarose gel electrophoresis to verify the size of the target band. Send the PCR product to a sequencing company (Wuhan Aikangjian Biotechnology Co., Ltd.) for sequencing. The results show that there are overlapping peaks in the sequencing at the designed knockout target site (such as Figure 5 ), indicating that the knockout was successful.

[0035] 1.5 Screening of homozygous F2 adult fish carrying target site mutations (1) The eggs produced by the knockout F0 chimeras were artificially fertilized with Xingguo red carp and then incubated by gynogenesis to produce the F1 generation; (2) Extracting fin ray DNA from F1 fry using alkaline lysis method; (3) Perform PCR amplification using isg15-A and isg15-B target site detection primers. After verifying the band size by agarose gel electrophoresis, send the PCR product to a sequencing company for sequencing. Sequence the PCR product and screen the homozygous F1 generation based on the sequencing results.

[0036] (4) The eggs produced by the homozygous F1 obtained through screening were transformed into the isg15 homozygous deletion mutant line F2 after gynogenesis. isg15 The gene-deficient silver carp contains the sequence shown in SEQ ID No. 10: GTGAGCGGTTGGCGAACTCAAG and the sequence shown in SEQ ID No. 11: GCCAGGAAACTCATACGGTACGGTTTGCG, specifically Figure 1 shown.

[0037] Example 2: CaHV infection experiment (1) The wild-type silver carp and the isg15 knockout silver carp in Example 1 (isg15 - / - / - Silver carp) were raised in an aquarium of 70.5cm×48cm×38cm, and the water temperature was maintained at 22℃ (±1℃). The experimental fish were raised for one week to observe whether there were any abnormalities; (2) Wild-type and isg15 knockout silver carp were healthy silver carp weighing about 6 g and were intraperitoneally injected with 6 μL of CaHV virus suspension (body weight: CaHV virus ratio was 1 g: 1 μL), with 30 fish in each group; (3) The aquaculture water is maintained at 22°C (±1°C) and is continuously filtered, and dead individuals are removed in time to keep the water clean; (4) Record the mortality of silver carp every day after infection until 10 dpi (days post infection); (5) The fish survival rate was analyzed using Mantel-Cox method.

[0038] The results are as follows Figure 2 The results showed that the survival rate of WT group silver carp infected with CaHV was 0% on the 8th day, while isg15 - / - / - Only one silver carp died, and the survival rate increased by 97%, indicating that isg15 - / - / - The ability of silver crucian carp to resist infection with crucian carp herpes virus is significantly improved.

[0039] Example 3: ISG15 protein expression in tissues of wild-type and isg15 knockout silver carp infected with CaHV The expression of isg15 protein in different tissues of wild-type and isg15 knockout silver carp infected with CaHV was detected.

[0040] (1) The wild-type and isg15 knockout silver crucian carp in Example 2 were anesthetized on ice 72 hours after infection with CaHV, and gill and kidney samples were dissected and weighed; (2) Add 200 mL of NP40 lysis buffer containing protease inhibitors and add grinding zirconium beads; (3) Pre-cool the homogenizer (Servicebio) and place the tissue in the homogenizer to completely disrupt it; (4) After the sample was instantaneously broken, 50 µL of 5× SDS Sample Buffer was added, vortexed and mixed, and placed in a metal bath at 100°C for 10 min; (5) Western Blot was used to detect the expression level of isg15 protein in isg15 knockout and wild-type silver carp. The results are as follows: Figure 3 As shown, the expression of isg15 protein in the tissues (gills, body and kidneys) of isg15 knockout silver crucian carp was significantly reduced.

[0041] Example 4: Detection of viral gene transcription levels in kidneys of wild-type and isg15 knockout silver carp infected with CaHV Detection of viral genes in the kidneys of wild-type and isg15 knockout silver carp infected with CaHV 39ring Transcription level. The wild-type and isg15 knockout silver crucian carp in Example 2 were anesthetized on ice 72 hours after infection with CaHV, and kidney samples were removed to extract total RNA. qPCR detection was performed after reverse transcription (primer sequence CaHV-39ring-F: CGGACTGTGCCGTTTGC, CaHV-39ring-R: CGTGCCCTTCACCTTTT). The results are shown in Figure 4 This indicates that isg15 knocks out viral genes in the kidney of silver carp 39ring The transcription level was significantly decreased.

[0042] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A method targeting silver carp isg15 The sgRNA of a gene is characterized by: The sgRNA includes isg15-A-sgRNA and isg15-B-sgRNA, the sequence of the isg15-A-sgRNA is shown in SEQ ID No.1, and the sequence of the isg15-B-sgRNA is shown in SEQ ID No.

2.

2. The amplification primer of the sgRNA according to claim 1, characterized in that The upstream primer sequence of the isg15-A-sgRNA is shown in SEQ ID No.7; the upstream primer sequence of the isg15-B-sgRNA is shown in SEQ ID No.8; the downstream primer sequences of the isg15-A-sgRNA and isg15-B-sgRNA are shown in SEQ ID No.

9.

3. A carrier, characterized in that The vector comprises the sgRNA of claim 1.

4. A CRISPR / Cas9 gene editing system, characterized in that: It comprises Cas9 protein and the sgRNA according to claim 1.

5. Use of the sgRNA described in claim 1 or the CRISPR / Cas9 gene editing system described in claim 4 in improving the ability of fish to resist herpes virus.

6. The use of the CRISPR / Cas9 gene editing system according to claim 5 in improving the ability of fish to resist herpes virus, characterized in that: The application method is: injecting a mixture of Cas9 protein and the sgRNA described in claim 1 into mature fish eggs to knock out the targeted isg15-A Genes and isg15-B Gene, obtain F0 generation chimera, perform gynogenesis and screening on F0 generation, obtain isg15 Gene-deficient strains are fish with improved resistance to herpes viruses.

7. The use according to claim 6, characterized in that: The application specifically includes the following steps: (1) Evenly mixing the sgRNA, Cas9 protein and nuclease-free water, and injecting the mixture into mature eggs of silver carp; (2) taking sperm and fertilizing the injected mature eggs to obtain the F0 generation after hatching; (3) Screening the eggs produced by the F0 generation with successful knockout and fertilizing them with sperm, and hatching them through gynogenesis to produce the F1 generation; (4) Screening homozygous F1 generation, the eggs produced by them are obtained after female nucleus development isg15 Gene-deficient silver crucian carp is resistant to herpes virus.

8. The use according to claim 7, characterized in that: The concentration of the sgRNA is 100 ng / μL~500 ng / μL; the volume ratio of the isg15-A-sgRNA, isg15-B-sgRNA, Cas9 protein, and nuclease-free water is 4:4:1:

5.

9. The use according to claim 7, characterized in that: The screening step for successful knockout in the F0 generation is as follows: fertilized embryos are lysed as PCR templates, and isg15-A Genes and isg15-B The detection primers of the target site of the gene are used for PCR amplification, and the PCR product is subjected to electrophoresis to verify the size of the target band. isg15-A The amplified fragment is 450 bp and isg15-B The amplified fragment is 911 bp. The PCR product is sequenced. If overlapping peaks appear in the sequencing peak graph, it means isg15 The gene knockout was successful.

10. The use according to claim 9, characterized in that: Said isg15-A The detection primer sequences of the genes are shown in SEQ ID No.3 and SEQ ID No.4 respectively; isg15-B The detection primer sequences of the genes are shown in SEQ ID No.5 and SEQ ID No.6 respectively.

Images