Application and method of cotton promoter PGhTCP67 in regulation and control of expression of target gene in vascular tissue cells

Abstract

The invention belongs to the field of gene engineering, relates to application of a cotton promoter, and particularly provides application and a method of a cotton promoter PGhTCP67 in regulating expression of a target gene in vascular tissue cells, and a nucleotide sequence of the cotton promoter PGhTCP67 is shown as SEQ ID No.1. The PGhTCP67 promoter provided by the invention is proved to be a promoter for regulating the specific expression of a gene in the vascular tissue of cotton, the PGhTCP67 promoter is connected with a reporter gene tdTomato (red fluorescent protein), cotton is transformed by using a carrier with the fusion gene, and the promoter can specifically promote the gene expression in the vascular tissue of cotton. The promoter has an important application value in the field of plant genetic engineering, and can promote the development of the cotton breeding industry and improve the comprehensive utilization value of cotton.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to the application of cotton promoter. Background Art

[0002] The promoter is located in the regulatory sequence that controls gene expression, upstream of the gene transcription start site (toward the 5′ direction of the DNA sense strand), and is about 100~1000 bp long. The characteristics of the promoter were originally identified by mutations that can increase or decrease the gene transcription rate. The promoter is located in the DNA sequence upstream of the 5' end of the structural gene, which can activate RNA polymerase, allowing it to accurately bind to the template DNA and have the specificity of transcription initiation (Progress in Research on Plant Tissue-Specific Promoters, Jiao Yong et al., 2019). Tissue-specific promoters, that is, under the regulation of such promoters, the expression of genes is limited to certain specific parts. When using tissue-specific promoters to regulate gene expression, exogenous gene products can play a more effective role and reduce negative effects on plants (Structural characteristics of tissue-specific promoters and their regulatory effects, Chen Mengci et al., 2015).

[0003] Vascular tissue is a plant tissue composed of xylem and phloem that conducts water and nutrients and has certain support functions. In vascular plants, water is absorbed from the soil, but sugars are assimilated in the leaves, so the flow of these resources in the plant body is essential for plant survival (APXY-Mediated Transcriptional NetworkIntegrates Signaling Mechanisms to ControlVascular Development inArabidopsis, Smit ME et al., 2020). Cotton is an annual herb or perennial shrub of the genus Gossypium in the Malvaceae family. It is native to the subtropics and is currently cultivated worldwide. At present, research on vascular tissue development mainly focuses on plants such as Arabidopsis and poplar. As an important crop, there is little research on the development of cotton vascular tissue. The formation of vascular tissue is a complex tissue-specific development and differentiation process, originating from the vascular cambium, producing three types of cells: fiber, tubular and ray, accompanied by secondary wall thickening and programmed cell death (Esau's Plant Anatomy: Meristems, Cells, and Tissues of the Plant Body - Their Structure, Function, and Development, Evert, 2006). Therefore, the study of vascular tissue-specific promoters is of great significance to the growth, development and production of cotton. Summary of the invention

[0004] In order to explore vascular tissue-specific promoters and study the functions of vascular tissue-specific promoters, the present application provides cotton promoter P GhTCP67 The application and methods in regulating the expression of target genes in vascular tissue cells provide a reference for related research such as the regulatory mechanism of cotton vascular tissue development.

[0005] The technical solution of the present invention is achieved in this way: A cotton promoter P GhTCP67 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] Or its nucleotide sequence has greater than 70% homology with the sequence shown in SEQ ID NO.1; for example, 75% homology, 80% homology, 85% homology, 90% homology, 95% homology or 100% homology.

[0007] Or its nucleotide sequence is a subfragment having similar function to the sequence shown in SEQ ID NO.1; the subfragment includes A-box, AAGAA-motif, ARE, AT-rich element, BOX 4, CAAT-box, CAT-box, CCAAT-box, CCGTCC motif, CCGTCC-box, ERE, GATA-motif, GT1-motif, LAMP-element, MRE, MYB, MYBrecognition site, MYB-like sequence, MYC, O2-site, STRETATA-DoXTCA-element, TCT-motif, Unnamed_4, w box and WRE3 element.

[0008] Cotton promoter P GhTCP67 Application in regulating the expression of a target gene in vascular tissue cells. The target gene is a gene in the cotton genome. The vascular tissue cells are from cotton.

[0009] A recombinant vector containing cotton promoter P GhTCP67 , the cotton promoter P GhTCP67 There is greater than 70% homology with the nucleotide sequence shown in SEQ ID No. 1; for example, 75% homology, 80% homology, 85% homology, 90% homology, 95% homology or 100% homology.

[0010] Preferably, the cotton promoter P GhTCP67 The nucleotide sequence is shown in SEQ ID No.1.

[0011] Furthermore, the recombinant vector also contains a target gene, which is covalently linked to a cotton promoter P GhTCP67 connected.

[0012] The target gene is a gene in the cotton genome. Further, the target gene is a fluorescent protein or a marker gene.

[0013] A method for regulating gene expression in vascular tissue cells comprises the following steps: the above-mentioned recombinant vector is transformed into a plant to be improved which has vascular tissue cells by Agrobacterium transformation.

[0014] Preferably, the plant to be improved is a cotton plant. GhTCP67 The regulatory effect of tdTomato reporter gene was used as an example to verify the effect. In practical applications, the genes of cotton group can be cloned and expressed by P GhTCP67 The promoter is connected to drive the gene to be expressed in vascular tissue cells.

[0015] The present invention has the following beneficial effects: 1. P of the present invention GhTCP67 The promoter has been proven to be a promoter that regulates the specific expression of genes in cotton vascular tissue cells. This promoter has important application value in the field of plant genetic engineering, and will promote the development of the cotton breeding industry and improve the comprehensive utilization value of cotton.

[0016] 2. The present invention provides a tissue-specific expression promoter, which provides a new method for molecular breeding. This method can be achieved by the following steps: GhTCP67 The recombinant vector after the promoter is connected to the target gene can be transferred into cotton to drive the expression of the gene in the vascular tissue cells, thereby improving the expression of the gene in the vascular tissue cells. The recombinant vector of the promoter can also be used to specifically silence the expression of the target gene in the vascular tissue cells. The present invention can provide or use the transgenic plants and corresponding seeds obtained by the above-mentioned recombinant vector, and then the promoter of the present invention can be transferred into other plants by hybridization technology, avoiding cumbersome genetic transformation processes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 In the embodiment of the present invention, P GhTCP67Agarose gel electrophoresis detection of promoter PCR amplification.

[0019] Figure 2 P GhTCP67 The basic structure of the promoter, +1 is the predicted transcription start site.

[0020] Figure 3 P GhTCP67 Schematic diagram of the recombinant plasmid containing the promoter-linked tdTomato reporter gene.

[0021] Figure 4 The expression pattern of tdTomato in genetically transformed cotton plants was described by P GhTCP67 The promoter initiates gene expression specifically in vascular tissue cells. DETAILED DESCRIPTION

[0022] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0024] The Taq DNA Polymerase, Phanta Max Super-Fidelity DNA Polymerase, and ClonExpressII One Step Cloning Kit seamless cloning enzyme used in the present invention were purchased from Nanjing Novogene Biotechnology Co., Ltd. Cycle-Pure Kit DNA purification kit was purchased from Beijing Promega Biotechnology Co., Ltd.; pEASY-Blunt Simple Cloning Kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Cotton2.0 vector was optimized and maintained by our laboratory; Plant genomic DNA extraction kit and rapid plasmid extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Plant transformation and tissue culture related culture media were purchased from Beijing Coolaibo Technology Co., Ltd.; The instrument used for fluorescence detection is a macroscopic variable magnification stereo microscope; The primers and sequencing work were completed at Shanghai Shenggong Biotechnology Co., Ltd.

[0025] Experimental protocol: A cotton promoter P GhTCP67 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0026] Or its nucleotide sequence has greater than 70% homology with the sequence shown in SEQ ID NO.1; for example, 75% homology, 80% homology, 85% homology, 90% homology, 95% homology or 100% homology.

[0027] Or its nucleotide sequence is a subfragment having similar function to the sequence shown in SEQ ID NO.1; the subfragment includes A-box, AAGAA-motif, ARE, AT-rich element, BOX 4, CAAT-box, CAT-box, CCAAT-box, CCGTCC motif, CCGTCC-box, ERE, GATA-motif, GT1-motif, LAMP-element, MRE, MYB, MYBrecognition site, MYB-like sequence, MYC, O2-site, STRETATA-DoXTCA-element, TCT-motif, Unnamed_4, w box and WRE3 element.

[0028] Cotton promoter P GhTCP67 Application in regulating the expression of a target gene in vascular tissue cells. The target gene is a gene in the cotton genome. The vascular tissue cells are from cotton.

[0029] A recombinant vector containing cotton promoter P GhTCP67 , the cotton promoter P GhTCP67 There is greater than 70% homology with the nucleotide sequence shown in SEQ ID No. 1; for example, 75% homology, 80% homology, 85% homology, 90% homology, 95% homology or 100% homology.

[0030] Preferably, the cotton promoter P GhTCP67 The nucleotide sequence is shown in SEQ ID No.1.

[0031] The specific implementation is as follows: Example 1: P GhTCP67 ::Construction of tdTomato recombinant expression vector Cotton DNA extraction: DNA from true leaf tissue of upland cotton was extracted according to the instructions of the plant genomic DNA extraction kit. The extracted DNA concentration was then determined using a NanoDrop 2000c UV-visible spectrophotometer (TbermoFisber, USA), and the DNA purity was finally detected using 1.0% agarose gel electrophoresis.

[0032] The promoter fragment with the linker was obtained by PCR amplification. The PCR reaction system is as follows: The template was extracted cotton true leaf DNA, and the PCR product was detected by agarose gel electrophoresis ( Figure 1 ), the amplified product was purified and recovered using the Cycle-PureKit kit, and then constructed into the Cotton2.0 vector by a one-step cloning method, transformed into E. coli DH5α, and PCR detection was performed using Taq DNA Polymerase. The positive clones were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The clones with correct sequencing were extracted with a rapid plasmid extraction kit and recorded as P GhTCP67 , sequence information is shown in SEQ ID No.1; structure is shown in Figure 2 As shown, the promoter contains A-box, AAGAA-motif, ARE, AT-rich element, BOX 4, CAAT-box, CAT-box, CCAAT-box, CCGTCC motif, CCGTCC-box, ERE, GATA-motif, GT1-motif, LAMP-element, MRE, MYB, MYB recognition site, MYB-like sequence, MYC, O2-site, STRETATA-DoXTCA-element, TCT-motif, Unnamed_4, w box and WRE3 elements.

[0033] The amplification primers are as follows: P GhTCP67 -F2: 5'- CCAAGCTCAAGCTAAGCTTGAGCTC TTTGGTGTGTTTAGTGTT-3′; P GhTCP67 -R2: 5'- CTCGCCCTTGCTCACCATACTAGT TTCCTGAAACTGTGTGAG-3′; The underlined nucleotide sequences are homologous recombination sequences.

[0034] PCR amplification program: (95℃, 3 min; 95℃, 15 s; 58℃, 15 s; 72℃, 50 s; 38 cycles; 12℃, 5 min). The amplified PCR product was purified and recovered, and then P was cloned using a one-step cloning method. GhTCP67 Connect to the Cotton2.0 vector. The specific operation is as follows: 10 μL reaction system: 5×CE Buffer 2 μL, overexpression vector Cotton2.0 1 μL (30-50 ng), gene product 1 μL (60-80 ng), Exnase Ⅱ 1 μL, gently mix, and react at 37°C for 30 min. Then transfer to Escherichia coli DH5α by heat shock transformation method, activate for 50 minutes, apply to LB solid medium containing spectinomycin (Spe) with a glass rod, culture at 37°C for about 12 hours, pick single clones into LB liquid medium containing Spe, activate for about 6 hours, and perform bacterial liquid PCR detection. The positive clones with correct detection are sent for sequencing, and the plasmids are extracted from the single clones with correct sequencing. The obtained plasmids are named P GhTCP67 ::tdTomato plasmid, such as Figure 3 shown.

[0035] The plasmid was transferred into Agrobacterium LBA4404 by electroporation. After culturing at 28°C for 60 h on LB solid medium containing spectinomycin (Spe) and rifampicin (Rif), single clones were picked and tested by PCR, and positive single clones were mixed and stored in an equal volume of 40% glycerol and stored at -80°C.

[0036] Example 2: P GhTCP67 Functional verification of promoter 1. Genetically modified material creation The P carried by Agrobacterium tumefaciens LBA4404 was transformed into cotton by Agrobacterium tumefaciens mediated genetic transformation. GhTCP67 ::tdTomato was introduced into cotton (Jin et al., 2006). The specific method is as follows: First, the cotton to be transformed was dehulled and then sterilized with 0.1% mercuric chloride solution. The sterilized seeds were cultured in sterile seedling germination medium (1 / 2 MS) at room temperature in the dark for 8 days. GhTCP67 ::tdTomato plasmid-containing LBA4404 Agrobacterium was diluted to OD 600The value is 0.6, and the hypocotyls of sterile seedlings grown for about 8 days are cut into 0.6 cm segments and placed in the prepared Agrobacterium until the hypocotyl tissue is completely submerged and gently shaken for 7 min, and the bacterial solution is removed. Finally, the excess bacterial solution on the surface of the tissue is blotted with sterile filter paper and spread on the MSB medium. After 72 hours of co-cultivation in the dark, the hypocotyl tissue is placed on an induction medium containing kanamycin to induce embryonic callus. Subculture once every 30 days until embryo differentiation occurs in the callus to form transgenic cotton seedlings. The present invention finally obtains 6 independent transgenic strains, and all of them have offspring.

[0037] 2. P GhTCP67 Promoter drives tdTomato expression specifically in vascular tissue cells Fluorescence detection was performed on the stem tissue sections of the obtained T0 generation positive cotton lines. Cut the stem tissue into slices <1 mm by hand with a double-sided blade, place the slices in a 2 mL centrifuge tube, and rinse with pure water 3-5 times. Vacuum in the concentrator 3 times (D-AL), 3 min each time (to remove the gas between and on the surface of the tissue cells). Place the slices on a slide, cover with a coverslip, and observe and photograph them under a stereo microscope (Leica MZFLⅢ). Figure 4 As shown, the red fluorescence is concentrated in the vascular tissue cells, indicating that P GhTCP67 The promoter can initiate gene expression specifically in vascular tissue cells and is a plant tissue-specific promoter.

[0038] From the above, we can see that using the above method, P GhTCP67 The promoter drives other genes, so we can expand the range of target genes to fluorescent proteins or marker genes (such as mCherry, GFP, GUS) instead of just tdTomato.

[0039] Similarly, through the above method, the use of P GhTCP67 The promoter was linked to the functional gene in the cotton group and the P GhTCP67 The promoter activates other genes in the cotton genome and drives the target gene to express in vascular tissue cells to varying degrees according to specific circumstances, so as to realize the regulatory function of the target gene on the vascular tissue.

[0040] Implementation effect analysis The present invention provides two P GhTCP67 Plant expression vector driven by P GhTCP67 ::tdTomato. The two recombinant strains of the above recombinant vector, P GhTCP67 ::tdTomato transformed with LBA4404 Agrobacterium. GhTCP67The promoter has been proven to be a promoter that regulates the specific expression of genes in cotton vascular tissue cells. This promoter has important application value in the field of plant genetic engineering, and will promote the development of the cotton breeding industry and improve the comprehensive utilization value of cotton.

[0041] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Cotton promoter P GhTCP67 Application in regulating the expression of target genes in vascular tissue cells.

2. The use according to claim 1, characterized in that: The cotton promoter P GhTCP67 There is more than 70% homology with the nucleotide sequence shown in SEQ ID No.

1.

3. The use according to claim 1, characterized in that: The cotton promoter P GhTCP67 The nucleotide sequence is shown as SEQ ID No.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The target gene is a gene in the cotton genome.

5. The use according to any one of claims 1 to 3, characterized in that: The vascular tissue cells are from cotton.

6. A recombinant vector, characterized in that: The recombinant vector contains cotton promoter P GhTCP67 , the cotton promoter P GhTCP67 There is more than 70% homology with the nucleotide sequence shown in SEQ ID No.

1.

7. The recombinant vector according to claim 6, characterized in that: The cotton promoter P GhTCP67 The nucleotide sequence is shown in SEQ ID No.

1.

8. The recombinant vector according to claim 7, characterized in that: The recombinant vector also contains a target gene, which is linked to the cotton promoter P GhTCP67 connected.

9. A method for regulating gene expression in vascular tissue cells, characterized in that: The steps are: the recombinant vector described in claim 8 is transformed into the plant to be improved with vascular tissue cells through Agrobacterium transformation method.

10. The method for regulating gene expression in vascular tissue cells according to claim 9, characterized in that: The plant to be improved is a cotton plant.

Images