Asian corn borer MSL2 gene and its application in the control of Asian corn borer

Abstract

The present invention discloses an Asian corn borer MSL2 gene and its application in the control of Asian corn borers. Among them, the nucleotide sequence of the Asian corn borer MSL2 gene is shown in SEQ ID NO: 1. The RNA interference sequence fragment of the Asian corn borer MSL2 gene has a nucleotide sequence shown in SEQ ID NO: 2. The present invention also provides the application of dsRNA synthesized from the RNA interference sequence fragment of the Asian corn borer MSL2 gene in the control of Asian corn borers. The present invention synthesizes dsRNA for the specific fragment of the Asian corn borer MSL2 gene, and uses the synthesized dsRNA to perform RNA interference on the target gene, achieving knockdown at the gene transcription level, significantly reducing the survival rate of Asian corn borer larvae, and having the potential for the research and development and application of targeted nucleic acid pesticides.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an Ostrinia furnacalis MSL2 gene and its application in the control of Ostrinia furnacalis. Background Art

[0002] Ostrinia furnacalis is an important pest of maize. At present, the control of Ostrinia furnacalis mainly relies on chemical control. However, chemical pesticides have a wide range of insecticidal effects and also have control effects on some natural enemy insects. The frequent use of the same or the same type of chemical pesticides is also likely to lead to pesticide resistance problems. Therefore, screening and discovering new control targets for Ostrinia furnacalis has important practical significance.

[0003] In Drosophila (XY type), the MSL complex is the core of its dosage compensation mechanism. It transcriptionally upregulates some specific sites on the X chromosome of male Drosophila and is a key factor determining the viability of male Drosophila. The MSL complex includes five protein subunits: MSL1, MSL2, MSL3, MLE, and MOF. Among them, MSL2 is used to bind to MSL1 and together with MSL1 binds to some high-affinity sites on the X chromosome, thereby mediating the assembly of the remaining MSL factors. The deletion of MSL2 causes specific lethality in males, and it has also been found that the MSL complex is involved in the regulation of insect growth and development in XY species. However, at present, the function of the Ostrinia furnacalis MSL2 gene is not clear. Studying the function of the Ostrinia furnacalis MSL2 gene and applying it to the control of Ostrinia furnacalis to provide an environmentally friendly control technology for Ostrinia furnacalis is an urgent research topic at present.

[0004] Therefore, there is an urgent need in the prior art for the application of an Ostrinia furnacalis MSL2 gene, an RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene, and dsRNA synthesized from the RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene in the control of Ostrinia furnacalis. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the application of an Ostrinia furnacalis MSL2 gene, an RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene, and dsRNA synthesized from the RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene in the control of Ostrinia furnacalis.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] An Ostrinia furnacalis MSL2 gene, the nucleotide sequence of which is as shown in SEQ ID NO:1.

[0008] The present invention also provides an RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene, and the nucleotide sequence is as shown in SEQ ID NO:2. The nucleotide sequences of the primers used for synthesizing the RNA interference sequence fragment are as follows:

[0009] dsMSL2-F: taatacgactcactatagggCAGCTACGCCTGGGAAATTA (SEQ ID NO3);

[0010] dsMSL2-R: taatacgactcactatagggTCGTCGTTGTCTTGGTCTTG (SEQ ID NO4).

[0011] The present invention further synthesizes dsRNA according to the RNA interference sequence fragment of the Ostrinia furnacalis MSL2 gene.

[0012] The present invention also provides the application of dsRNA in the control of Ostrinia furnacalis, performing RNA interference on Ostrinia furnacalis to inhibit its growth and development and cause its death.

[0013] The beneficial effects of the present invention are as follows: The present invention synthesizes dsRNA for a specific fragment of the Ostrinia furnacalis MSL2 gene, and uses the synthesized dsRNA to perform RNA interference on the target gene, achieving knockdown at the gene transcription level, significantly reducing the survival rate of Ostrinia furnacalis larvae, and having the potential for the research and development and application of targeted nucleic acid pesticides. Description of the Drawings

[0014] Figure 1 is the RNA interference efficiency of the MSL2 gene (the vertical axis represents the relative expression level of the MSL2 gene; in the horizontal axis, dsGFP represents the control group, and dsMSL2 represents the MSL2 gene RNA interference group);

[0015] Figure 2 is the larval mortality rate after RNA interference of the MSL2 gene (the vertical axis represents the mortality rate of Ostrinia furnacalis larvae; in the horizontal axis, dsGFP represents the control group, and dsMSL2 represents the MSL2 gene RNA interference group). Detailed Embodiments

[0016] The present invention will be described in detail below with reference to the accompanying drawings.

[0017] Examples

[0018] 1. Extraction of Ostrinia furnacalis genomic RNA

[0019] 1) Place the Asian corn borer samples into 1.5 mL centrifuge tubes, add 200 uL of TRIzol, grind the tissues evenly with a tissue grinder, then add another 800 uL of TRIzol, mix well, and let it stand at room temperature for 5 min;

[0020] 2) Add 200 uL of chloroform to the solution obtained in step 1), shake vigorously for 15 s, and let it stand at room temperature for 10 min;

[0021] 3) Centrifuge at 4 °C (12000 rpm × 15 min), aspirate the upper aqueous phase and transfer it to a new 1.5 mL centrifuge tube;

[0022] 4) Add 500 μL of isopropanol, gently invert the tube up and down to mix well, and let it stand at room temperature for 10 min;

[0023] 5) Centrifuge at 4 °C (12000 rpm × 10 min). At this time, the RNA precipitate is at the bottom of the tube. Remove the supernatant. If the amount is large, a white gelatinous precipitate will appear;

[0024] 6) Add 1 mL of 75% ethanol (prepared with RNase-free water), flick the precipitate up with your finger, and gently invert the tube up and down to wash the precipitate. Centrifuge at 4 °C (12000 rpm × 5 min), and discard the supernatant;

[0025] 7) Repeat step 6) once;

[0026] 8) Air-dry at room temperature for 5 - 10 min. Add 20 - 40 μL of RNase-free water to dissolve the precipitate. If necessary, gently pipette or incubate at 55 - 60 °C for 5 - 10 min to assist in dissolution. After the precipitate is completely dissolved, place the obtained RNA solution in an -80 °C refrigerator for storage for subsequent experiments.

[0027] 2. Reverse transcription of RNA

[0028] Add 1 μg of the above RNA solution to a 200 μl centrifuge tube, and obtain the first-strand cDNA according to the instructions of the 1st strand cDNA Synthesis Kit (6110A) from TAKARA company, and store it at -20 °C for later use.

[0029] 3. Amplification and purification of the target fragment of the Asian corn borer MSL2 gene

[0030] Using the above cDNA as a template, perform PCR amplification on the target fragment synthesized in double strands. The amplified RNA interference sequence fragment is shown in SEQ ID NO: 2. The nucleotide sequences of the primers used are as follows:

[0031] dsMSL2-F: taatacgactcactatagggCAGCTACGCCTGGGAAATTA (SEQ ID NO3);

[0032] dsMSL2-R: taatacgactcactatagggTCGTCGTTGTCTTGGTCTTG (SEQ ID NO4).

[0033] The PCR reaction system is shown in Table 1.

[0034]

[0035] The PCR reaction procedure is shown in Table 2.

[0036]

[0037] The PCR products were purified using a PCR purification kit and stored at -20°C as templates for the next step of dsRNA synthesis.

[0038] 4. Synthesis and purification of dsRNA of the MSL2 gene of Ostrinia furnacalis

[0039] 1) After mixing the reagents according to the system in Table 3, flick to mix well and centrifuge briefly. Place it in a 37°C metal bath for 4 hours.

[0040]

[0041] 2) Adjust the volume of the solution obtained in step 1) to 200 μL with DEPC H2O.

[0042] 3) Add half an equal volume (100 μL) of water-saturated phenol reagent and half an equal volume of chloroform (100 μL).

[0043] 4) Mix gently and centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 15 min.

[0044] 5) Take the upper layer, add an equal volume of chloroform (200 μL), mix gently, and centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 15 min.

[0045] 6) Take the upper layer, add 1 / 10 volume (20 μL) of 3M sodium acetate (pH 5.2) and 2.5 times the volume (500 μL) of 100% ethanol (stored at -20°C), mix gently and let it stand at -20°C for half an hour.

[0046] 7) Centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 30 min.

[0047] 8) At this time, a white precipitate appears at the bottom of the centrifuge tube. Discard the supernatant, add 80% ethanol (stored at -20 °C), gently mix, and wash the precipitate.

[0048] 9) Centrifuge at 4 °C (7500 rpm, 4 °C) for 5 min.

[0049] 10) Slowly aspirate the ethanol. Use a 10 μL pipette to slowly aspirate the supernatant close to the precipitate. To prevent the precipitate from being aspirated together, finally, open the lid of the centrifuge tube with a small amount of remaining ethanol and let it air dry for about 10 min until all the ethanol has evaporated.

[0050] 11) Add 20 μL of enzyme-free H2O, flick the bottom of the tube gently to fully dissolve the precipitate, and store it at -80 °C.

[0051] 5. RNA interference of Ostrinia furnacalis MSL2 (feeding interference)

[0052] Perform continuous 4 - time feeding interference on Ostrinia furnacalis larvae at the 2nd - 5th instars according to Table 4. The CK group is fed with dsGFP, and the treatment group uses dsMSL2. Set 5 replicates for both the CK group and the treatment group, with 20 larvae in each replicate. The specific operation is as follows: Place the insects individually on the insect - rearing board, add a quantitative amount of artificial diet, drop a quantitative amount of dsRNA solution on it, and rear them normally in the incubator.

[0053]

[0054] 6. Detection of RNA interference efficiency and mortality statistics of Ostrinia furnacalis MSL2 gene

[0055] On the 2nd day after feeding interference at the 5th instar, sample each group. Take 3 replicates (5 larvae / replicate) from each group for RNA extraction and subsequent fluorescence quantitative PCR detection of the expression level of the MSL2 gene. The primer sequences for real - time fluorescence quantitative PCR of the MSL2 gene and the internal reference gene rpL8 are as follows:

[0056] qMSL2 - F1: GAGGGTGCTGGCTTCTCTGA (SEQ ID NO5);

[0057] qMSL2 - R1: TGTGTCTGTGTAGATGCAGAGTTA (SEQ ID NO6);

[0058] qrpL8 - F: AAGCGAGGAACATCAGCC (SEQ ID NO7);

[0059] qrpL8 - R: GGTCTTGCCACCACGAAT (SEQ ID NO8).

[0060] The results of real-time fluorescence quantitative analysis showed that after feeding interference, the relative expression level of the MSL2 gene in Ostrinia furnacalis was significantly down-regulated by 48.3% compared with the control group (fed with dsGFP) (P<0.05), indicating that RNAi interference was successful (see Figure 1 ). See Figure 2 . Compared with the control group, the mortality rate of the treatment group increased significantly by 7.5%. This indicates that the knockdown of MSL2 can lead to the death of Ostrinia furnacalis.

[0061] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the protection scope of the present invention. Any simple modification or equivalent replacement of the technical solution of the present invention by those of ordinary skill in the art shall not depart from the essence and scope of the technical solution of the present invention.

Claims

1. Application of dsRNA synthesized from RNA interference sequence fragment of Ostrinia furnacalis MSL2 gene in control of Ostrinia furnacalis, which performs RNA interference on Ostrinia furnacalis to cause its death, wherein the nucleotide sequence of the RNA interference sequence fragment of Ostrinia furnacalis MSL2 gene is as shown in SEQ ID NO: 2.

Images