Gynostemma pentaphylla GpMYC2-1 gene and application thereof

Abstract

The invention discloses a gynostemma pentaphyllum GpMYC2-1 gene, which has a base sequence as shown in SEQ ID NO.1, the gene is obtained by cloning from gynostemma pentaphyllum leaves for the first time, and a foundation is laid for research on synthesis and accumulation of gynostemma pentaphyllum secondary metabolites by the GpMYC2-1 gene; the invention also discloses a construction method of a recombinant vector plasmid of the GpMYC2-1 gene of the Gynostemma pentaphylla. The construction method comprises the following steps: constructing a vector for over-expressing GpMYC2-1; the invention also discloses an expression method of the gynostemma pentaphyllum GpMYC2-1 gene, a hairy root system of the gynostemma pentaphyllum GpMYC2-1 gene is obtained and applied under a cadmium stress condition, and the GpMYC2-1 gene is indicated to be not only a regulatory gene for biosynthesis of gynostemma pentaphyllum saponin, but also a key transcription factor for biosynthesis of cadmium stress response gynostemma pentaphyllum saponin.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to Gynostemma pentaphyllum GpMYC2-1 Genes and their applications. Background Art

[0002] Metallic cadmium has high phytotoxicity and can be transferred from plant roots to above-ground parts, inhibiting plant growth and quality. This stress effect not only affects the quality of medicinal plants, but also directly affects the quality of Chinese herbal medicines and the safety of clinical use of Chinese herbal medicines. Therefore, conducting research on the cadmium response mechanism of medicinal plants will help explain the way in which cadmium affects the growth and development of medicinal plants and the quality of Chinese herbal medicines, and lay a solid theoretical foundation for the cultivation of cadmium-resistant medicinal plants.

[0003] Gynostemma pentaphyllum ( Gynostemma pentaphyllum ) is a perennial herbaceous vine of the genus Gynostemma in the Cucurbitaceae family, widely distributed in the Qinling Mountains and the area south of the Yangtze River in China. Gynostemma pentaphyllum is an important raw material for traditional Chinese medicine and health products. It is one of the plants containing ginsenosides outside the genus Panax, and enjoys the reputation of "Southern Ginseng". In the inventor's previous research, it was found that Gynostemma pentaphyllum can still grow normally after being treated with 50~100μM cadmium, indicating that Gynostemma pentaphyllum has a certain tolerance to cadmium stress (zhou et al., 2023).

[0004] MYC2 Myelocytomatosis proteins (MYCs) belong to the bHLH transcription factor class and are widely present in animals and plants. They are the core transcription factors that respond to jasmonic acid (JAs) hormone signals in plants and participate in the regulation of plant defense responses, growth and development, and secondary metabolites. MYC2 Transcription factors are involved in the regulation of biosynthesis of secondary metabolites such as flavonoids, alkaloids, and terpenes, mainly regulating the expression of key enzyme genes in metabolic biosynthesis. SmMYC2 It not only increases the content of tanshinone in hairy roots, but also participates in the biosynthesis of phenolic acids and anthocyanins (Cao Ruizhi, 2024; Liu Shucan, 2023). FhMYC2 Involved in linalool synthesis during flower development ( Yang et al., 2020 ). SmMYC2 Activated the key enzyme gene for tanshinone synthesis SmGGPPS1 Gene expression (Cao Ruizhi, 2024). Artemisia annua AaMYC2 Regulation of artemisinin biosynthetic enzymes AaCYP71AV1 and AaDBR2 Gene expression, increasing the content of artemisinin (Shen et al., 2016). CaMYC2 / 3 / 4 It can increase the biosynthesis accumulation of monoterpenes and improve the defense ability of pepper against tomato spotted wilt virus (Wu et al., 2019); in tobacco,NtMYC2 Regulate the content of scopoletin to improve tobacco's resistance to Alternaria alternata (Sun et al., 2014). MYC Transcription factors play an important role in adverse conditions such as drought, salt and heat stress, but there are no reports on whether this transcription factor improves cadmium tolerance by regulating the synthesis and accumulation of secondary metabolites in Gynostemma pentaphyllum under cadmium stress. Summary of the invention

[0005] An object of the present invention is to address at least the above-mentioned disadvantages and to provide at least the advantages which will be described hereinafter.

[0006] In order to achieve these and other advantages of the present invention, there is now provided GpMYC2-1 The gene has the base sequence shown in SEQ ID NO.1.

[0007] Gynostemma pentaphyllum GpMYC2-1 The method for constructing a recombinant vector plasmid of a gene comprises the following specific steps: S1. Take 0.1 g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen and grind them into powder.

[0008] S2. The total plant RNA in the powder was extracted using a total RNA extraction kit, and then the RNA was reverse transcribed into cDNA using a high-efficiency cDNA single-strand synthesis kit.

[0009] S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence of Gynostemma pentaphyllum is designed and the upstream and downstream primers are synthesized, and PCR amplification is performed using Gynostemma pentaphyllum cDNA as a template, and then 1.2% agarose gel is used for electrophoresis detection, and gel recovery is performed using a DNA purification and recovery kit to obtain the Gynostemma pentaphyllum. GpMYC2-1 DNA fragments.

[0010] S4. Extract the pCY-35D-GFP plasmid and perform double restriction digestion with SacI and SalI to obtain the pCY-35D-GFP linearized vector.

[0011] S5. Use cloning kit to GpMYC2-1 The full-length cDNA sequence was subjected to homologous recombination reaction with the pCY-35D-GFP linearized vector, and the reaction product was transformed into DH5α cells, and positive clones were screened in LB medium containing 50 mg / L kanamycin.

[0012] S6. After verification by bacterial solution PCR and sequencing, the plasmid was extracted to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.

[0013] In the above scheme, specifically, a grinder model JXFSTPRP-64L of Shanghai Jingxin Company was used to grind the leaves of Gynostemma pentaphyllum; Eastep® Super Total RNA Extraction Kit of Promega Biotechnology Company was used to extract total plant RNA; HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) of Novazonics was used to reverse transcribe RNA into cDNA; DNA purification and recovery kit of Tiangen Biochemical Technology Co., Ltd. was used for gel recovery; pCY-35D-GFP plasmid was extracted using Tiangen plasmid mini kit and recombinant vector plasmid was obtained; homologous recombination reaction was performed using Novazonics ClonExpress Ⅱ One Step Cloning Kit, and the reaction conditions were 37°C and 30 minutes.

[0014] Preferably, the sequences of the upstream and downstream primers are as follows: The base sequence of the upstream primer is shown in SEQ ID NO.2: ATGAATCTCTGGACTGATGAAAACG.

[0015] The base sequence of the downstream primer is shown in SEQ ID NO.3: CATGATGCCTTGGCGACC.

[0016] Preferably, the PCR amplification reaction system includes: 25 μL of high-fidelity enzyme, 2 μL of upstream primer, 2 μL of downstream primer, 2 μL of cDNA, and 19 μL of ddH2O; the reaction conditions are: denaturation at 98°C for 10 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 2 minutes, and 30 cycles.

[0017] Gynostemma pentaphyllum GpMYC2-1 The gene expression method is obtained by the following steps: S1, take 1 μg of pCY-35D-GFP- GpMYC2-1 The recombinant vector plasmid was gently mixed in 100 μL of Agrobacterium rhizogenes competent medium, placed on ice for 5 minutes, quick-frozen in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and placed on ice for 5 minutes. Then, 1000 μL of TY liquid culture medium was added and cultured on a shaker at 28°C for 4 hours to obtain bacterial cells. The bacterial cells were spread on a TY solid plate supplemented with 50 mg / L streptavidin and inverted for 48 hours at 28°C to obtain a single colony.

[0018] S2. Pick a single colony and inoculate it into 1000 μL TY liquid culture medium supplemented with 50 mg / L streptavidin, and culture it at 28°C under shaking conditions for 24 hours. Take out 100 μL of the bacterial solution and culture it in 50 mL of fresh TY culture medium at 28°C under shaking conditions for 2 hours. Add 100 μmoL / L acetosyringone and continue to culture until the absorbance of the culture solution at a wavelength of 600 nm is 0.5. Centrifuge the culture solution at 5000 rpm for 5 minutes, discard the supernatant and resuspend the culture solution in 1 / 2MS culture medium containing 100 μmoL / L acetosyringone.

[0019] S3. Take a leaf of Gynostemma pentaphyllum and scratch the surface lightly, then immerse it in the resuspended bacterial solution, infect it on a horizontal shaker at 110 rpm for 10 minutes, then transfer the leaf to MS solid medium containing 100 μmoL / L acetosyringone, culture it in the dark for 2-3 days, and then transfer it to MS medium containing 500 mg / L carbenicillin after washing, and culture it at 28 ℃ in the dark until the length of the hairy roots is 3-5 cm, cut off the hairy roots and transfer them to MS medium containing 500 mg / L carbenicillin for further culture, subculture once every week until no sterile spots appear on the hairy roots, and then transfer them to MS solid plates without antibiotics for expansion culture for at least 1 month to obtain the initial cultured hairy roots.

[0020] S4. The hairy roots were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28°C in the dark for 7 days. The hairy root strains with continued branching growth were selected and the hairy root DNA was extracted. The hairy root DNA was then used as a template for PCR amplification to obtain the overexpression GpMYC2-1 Transgenic hairy root system.

[0021] Preferably, the washing in S3 specifically comprises: transferring the cultured explants to sterile water containing 400 mg / L carbenicillin, washing them in a horizontal shaker at 110 rpm for 5 minutes, and then rinsing them with sterile water at least 3 times.

[0022] Preferably, the PCR amplification in S4 specifically includes: designing an upstream primer according to the 35S promoter contained in the vector: the base sequence of 35S-F is as shown in SEQ ID NO.4: TGAGACTTTTCAAC; GpMYC2-1 Sequence, design downstream primers: GpMYC2-1The base sequence of -det-R is shown in SEQ ID NO.5: CATGATGCCTTGGCGACC; the rolB gene in Agrobacterium rhizogenes is selected as the hairy root to determine whether the hairy root is induced by Agrobacterium rhizogenes, the rolB gene sequence is designed and the base sequence of the upstream and downstream primers F is shown in SEQ ID NO.6: GCTCTTGCAGTGCTAGATTT and the base sequence of R is shown in SEQ ID NO.7: GAAGGTGCAAGCTACCTCTC, and PCR amplification is performed using the hairy root DNA as a template.

[0023] Preferably, the reaction system for PCR amplification in S4 includes: Taq Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA 2 μL, ddH2O 19 μL; the reaction conditions are: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 10 seconds, 58°C annealing for 15 seconds, 72°C extension for 30 seconds, and 30 cycles.

[0024] Gynostemma pentaphyllum GpMYC2-1 Application of genes to improve plant resistance to cadmium stress.

[0025] The present invention has at least the following beneficial effects: The present invention cloned the transcription factor gene from the leaves of Gynostemma pentaphyllum for the first time GpMYC2-1 , construct to obtain overexpression GpMYC2-1 vector to obtain overexpression GpMYC2-1 Transgenic hairy root system for research GpMYC2-1 Genes lay the foundation for the synthesis and accumulation of secondary metabolites in Gynostemma pentaphyllum.

[0026] The present invention obtains Gynostemma pentaphyllum GpMYC2-1 Gene hairy root system, and applied under cadmium stress conditions, indicating GpMYC2-1 It is not only a regulatory gene for gypenosides biosynthesis, but also a key transcription factor for gypenosides biosynthesis in response to cadmium stress.

[0027] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 For the present invention GpMYC2-1 Gene cloning PCR images; Figure 2 The present invention pCY-35D-GFP- GpMYC2-1 Schematic diagram of plasmid vector construction; Figure 3 This is a solid culture diagram of the hairy roots of Gynostemma pentaphyllum of the present invention; Figure 4 Overexpression of the present invention GpMYC2-1 Hairy root liquid culture diagram; Figure 5 Overexpression of the present invention GpMYC2-1 PCR analysis of the hairy root rolB gene verification; Figure 6 Overexpression of the present invention GpMYC2-1 Hairy root positive verification PCR chart; Figure 7 This is a graph showing the total saponin content of hairy roots of the present invention; Figure 8 This is a gene expression analysis diagram of key enzymes in terpenoid synthesis of the present invention; in, Figure 1 The results of 1.2% agarose gel electrophoresis show that the size of the target fragment obtained by PCR amplification is between 1900 and 2000 bp, which is consistent with GpMYC2-1 The size of Figure 5 The results of 1.2% agarose gel electrophoresis show that the size of the product obtained by PCR amplification of the rolB gene is between 450 and 500 bp, which is consistent with the size of the target gene, indicating that the hairy roots are induced by Agrobacterium rhizogenes. Figure 6 To utilize 35S-F and GpMYC2-1 -det-R was used to judge the overexpression of positive hairy roots, and the product size obtained by PCR amplification was between 2100 and 2300 bp, which was consistent with the expected fragment size, indicating that the hairy roots were positive hairy root strains. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with embodiments so that those skilled in the art can implement the invention with reference to the description.

[0030] Example 1 Gynostemma pentaphyllum GpMYC2-1 Gene, the base sequence is shown as SEQ ID NO.1.

[0031] ATGAATCTCTGGACTGATGAAAACGCATCTGTAATGGATGCGTTTATGAGCTCCGATCTC TCTTCATATTGGGCACCAACTACTTCACAATCTCAATCTCAACCACCACAATCCTCTGCT TCAGCTTCTGCTTCTACTCCCAATGACCCATGTAAATCTCAAATCCTCAACCAAGAATCT CTCCAACATCGTCTTCAAGCTTTAATCGACGGGTTCTCGAGAAAGCTGGACTTACGCCATT TTCTGGCAATCTTCTTATGATTATTCTGGTGCTTCAGTTTTAGGTTGGGGAGATGGGTAT TATAAAGGAGAAGAAGATAAAGGGAAAAAAACCAAAGGTAAAGCTAAAGTTGTTTCCACC GCTGGTGAACAAGCTCACCGGAAAAAGGTTTCTCAGGGAATTGAATTCTTTGATTTCTGGA AACCCATCTGGACCTGATGATGCTATCGATGAAGAAGTTACTGATACGGAATGGTTTTTC CTTGTTTCTATGACTCAATCTTTTGGGAATGGTGTTGGATTTCCGAGTCAGGCTTTTTC AATTCGACTCCGATTTGGGTTTCCGGTGCTGATAAATTAGCTGCTGCTTCTTGTGAGAGA GCTCGTCAAGGAAGCGTTTTCGGGTTGCGGACGATGGTCTGTATTCCTTCCGCGAATGGT GTTGTTGAAATGGGTTCTACGGAGATGATTTATCGGACTTCTGATTTGATGAATAAAGTT AGGGTTTTGTTTGATTTTAATAATCATAATCTTGAAATGGGTTCTTGGAATTTGGGTGGT GATGAGGTGAGAATGATCCGTCTGAAATCTGGATTAACGAGCCTTCAAGTACGATTGAG ATGAAGGATTCGTTGAACACTAATGTTCCTTTGAAAGGAATTCATTCCCAAAACCCGAGT TCGGTAGTTTGACTGAAACCCTAAGTGCAATTCATGTTCCTCCTAAGCAGAGTCAGGGT TTTTTGAACTTTTCTGATCATGGGAATTCTTCACATTCCAATTCATTCAAGCCGGAATCT GGTGGGATGTTGAATTTCGGCGATAGTAATCGGAGTTCTTATGGTAACGGTAATAATGGA AATGGTAGTTTGTTTTCTGGTCATTCACAATATGTTGCAGAGGAGAGAGAGAGAGAGAGA TCGCCGCCTTCGCGTAGTAGTAACGAGGAGAGATTCTTTCGTTTACTTCCGGTGTGGTT TTGCCGTCGTCTGGGAAGGTGAAATCGGGCAGTGCTGCTGCTGATTCGGACCATTCGGAT CTTGAAGCGTCGATAATTCGTGAGGTTGATAGTTGTAAAGTTGTAGAGCCGGAGAAAAGG CCGAGAAAGAGAGGAAGAAAACCAGCTAATGGAAGAAGAGGCCTTTGAATCATGTTGAA GCAGAGAGGCAGAAGGGAAAAGTTGAACCAAAAATTCTATGCTCTTCGCGCTGTGGTT CCAAACGTATCCAAATGGATAAAGCTTCCCTCCTCGGCGACGCTGTCTCGTACATTAAC GACCTTAAATCGAAGCTCCAAATCACAGAATCGGATAAAACAGAGTTGCAGAGGCAATTA GACTCGATGAGAAGCATATGGGAAGTAAAGATTCAAGTTTTTCAAGATGTGCAATTGAG GAAGAAGATCTTAAGATCTCCAAGCAAATTGATGGAGATGGATGTCGACGTGAAGAATTATC GGTTGGGACGCTATGATTAGGATCCAATGCAGCAAGAAAAACCATCCGGCAGCAAGGTTG ATGATGGCTCTAAAGGATCTCGATTTAGATATGCTTCACGCCAGTGTATCGGTAGTGAAC GATTTGATGATTCAACAGGCGACCGTGAAGATGGGAGCCGATTCTACACGCAGGAGCAG CTCAGAATAGCCCTTATATCGAAATTCAGTGATGGGGGTCGCCAAGGCATCATG Example 2 Gynostemma pentaphyllum GpMYC2-1 The method for constructing a recombinant vector plasmid of a gene comprises the following specific steps: S1. Take 0.1 g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen, and grind them into powder using a grinder model JXFSTPRP-64L from Shanghai Jingxin Company.

[0032] S2. Use Eastep® Super Total RNA Extraction Kit from Promega Biotech to extract total plant RNA from the powder, and then use HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) from Novazonics to reverse transcribe the RNA into cDNA.

[0033] S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence is designed and the upstream and downstream primers are synthesized, and PCR amplification is performed using the cDNA of Gynostemma pentaphyllum as a template, and then 1.2% agarose gel is used for electrophoresis detection, and the DNA purification and recovery kit of Tiangen Biochemical Technology Co., Ltd. is used for gel recovery to obtain the Gynostemma pentaphyllum. GpMYC2-1 DNA fragments.

[0034] S4. Use the Tiangen Plasmid Extraction Kit to extract the pCY-35D-GFP plasmid, and perform double restriction digestion with SacI and SalI to obtain the pCY-35D-GFP linearized vector.

[0035] S5. Use ClonExpress Ⅱ One Step Cloning Kit to GpMYC2-1 The full-length cDNA sequence was subjected to homologous recombination reaction with the pCY-35D-GFP linearized vector at 37°C for 30 minutes. The reaction product was then transformed into DH5α competent cells, and positive clones were screened on LB medium containing 50 mg / L kanamycin.

[0036] S6. After verification by bacterial liquid PCR and sequencing, the plasmid was extracted using the Tiangen plasmid extraction kit to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.

[0037] Further, the sequences of the upstream and downstream primers are as follows: The base sequence of the upstream primer is shown in SEQ ID NO.2: ATGAATCTCTGGACTGATGAAAACG.

[0038] The base sequence of the downstream primer is shown in SEQ ID NO.3: CATGATGCCTTGGCGACC.

[0039] Furthermore, the PCR amplification reaction system includes: 25 μL of high-fidelity enzyme, 2 μL of upstream primer, 2 μL of downstream primer, 2 μL of cDNA, and 19 μL of ddH2O; the reaction conditions are: denaturation at 98°C for 10 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 2 minutes, and 30 cycles.

[0040] Example 3 Gynostemma pentaphyllum GpMYC2-1 The gene expression method is obtained by the following steps: S1, take 1 μg of pCY-35D-GFP- GpMYC2-1 The recombinant vector plasmid was gently mixed in 100 μL of Agrobacterium rhizogenes competent medium, placed on ice for 5 minutes, quick-frozen in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and placed on ice for 5 minutes. Then, 1000 μL of TY liquid culture medium was added and cultured on a shaker at 28°C for 4 hours to obtain bacterial cells. The bacterial cells were spread on a TY solid plate supplemented with 50 mg / L streptavidin and inverted for 48 hours at 28°C to obtain a single colony.

[0041] S2. Pick a single colony and inoculate it into 1000 μL TY liquid culture medium supplemented with 50 mg / L streptavidin, and culture it at 28°C under shaking conditions for 24 hours. Take out 100 μL of the bacterial solution and culture it in 50 mL of fresh TY culture medium at 28°C under shaking conditions for 2 hours. Add 100 μmoL / L acetosyringone and continue to culture until the absorbance of the culture solution at a wavelength of 600 nm is 0.5. Centrifuge the culture solution at 5000 rpm for 5 minutes, discard the supernatant and resuspend the culture solution in 1 / 2MS culture medium containing 100 μmoL / L acetosyringone.

[0042] S3. Take a leaf of Gynostemma pentaphyllum and scratch the surface gently, then soak it in the resuspended bacterial solution, infect it on a horizontal shaker at 110 rpm for 10 minutes, then transfer the leaf to MS solid medium containing 100 μmoL / L acetosyringone, culture it in the dark for 2-3 days, transfer it to MS medium containing 500 mg / L carbenicillin after washing, culture it at 28 ℃ and dark conditions until the length of the hairy root is 3-5 cm, cut the hairy root and transfer it to MS medium containing 500 mg / L carbenicillin to continue culture, subculture it once every week until the hairy root has no bacterial plaque, then transfer it to an antibiotic-free MS solid plate for expansion culture for at least 1 month, and obtain the hairy root of initial culture. Among them, washing specifically includes: transferring the cultured explant to sterile water containing 400 mg / L carbenicillin, washing it in a horizontal shaker at 110 rpm for 5 minutes, and then rinsing it with sterile water at least 3 times.

[0043] S4. The hairy roots were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28°C in the dark for 7 days. The hairy root strains with continued branching growth were selected and the hairy root DNA was extracted. The hairy root DNA was then used as a template for PCR amplification to obtain the overexpression GpMYC2-1 The PCR amplification specifically includes: designing upstream primers according to the 35S promoter contained in the vector: the base sequence of 35S-F is shown in SEQ ID NO.4: TGAGACTTTTCAAC; GpMYC2-1 Sequence, design downstream primers: GpMYC2-1 The base sequence of -det-R is shown in SEQ ID NO.5: CATGATGCCTTGGCGACC; the rolB gene in Agrobacterium rhizogenes is selected as the base sequence for judging whether the hairy roots are hairy roots induced by Agrobacterium rhizogenes, the rolB gene sequence is designed and the base sequences of the upstream and downstream primers F are shown in SEQ ID NO.6: GCTCTTGCAGTGCTAGATTT and the base sequence of R are shown in SEQ ID NO.7: GAAGGTGCAAGCTACCTCTC, and PCR amplification is performed using the hairy root DNA as a template; the PCR amplification reaction system includes: Taq Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA 2 μL, ddH2O 19 μL; the reaction conditions are: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 10 seconds, 58°C annealing for 15 seconds, 72°C extension for 30 seconds, and 30 cycles.

[0044] Example 4 Gynostemma pentaphyllum GpMYC2-1 Application of genes to improve plant resistance to cadmium stress.

[0045] Gynostemma pentaphyllum GpMYC2-1 Gene response test to heavy metal cadmium Test 1: Determination of total saponin content in Gynostemma pentaphyllum S1. Overexpression is obtained by using the method of Example 3 GpMYC2-1 The transgenic hairy roots were transferred into 1 / 2 MS liquid medium for culture. 50 μmoL CdCl2 solution was added to the medium during the rapid growth period of the hairy roots. The hairy roots were taken out after 7 days of culture as the experimental group; the hairy roots obtained by infecting Agrobacterium rhizogenes containing the empty vector of pCY-35D-GFP were used as the control group.

[0046] S2. The surface moisture of the hairy roots of the test group and the control group was absorbed, and the hairy roots were placed in an oven at 60°C to dry to constant weight, and ground into powder particles with a particle size of 100 mesh to obtain powder of the test group and powder of the control group.

[0047] S3. Take 0.5g of the test group powder and the control group powder respectively, use 5mL75% ethanol to ultrasonically extract 3 times, 2 hours each time, filter with a filter membrane, and obtain 15mL of the test group extract and 15mL of the control group extract respectively; evaporate the ethanol in a 50℃ water bath, add 2mL of distilled water to dissolve the crystals, add 2.5mL of water-saturated n-butanol solution to extract once, dissolve with methanol after recovery, and finally dilute to 2mL with methanol to obtain the test solution of the test group and the control group. Weigh 3.8mg of the standard ginsenoside Rb1 and use methanol to prepare a 0.38 mg / mL standard solution.

[0048] S4. Accurately pipette 0 μL, 50 μL, 100 μL, 200 μL, 300 μL, 400 μL, 500 μL, and 600 μL of the standard solution into a 10 mL stoppered colorimetric tube and evaporate in a 60 ℃ water bath. Add 0.2 mL of 5% vanillin glacial acetic acid solution and 0.8 mL of perchloric acid, mix well, heat in a 60 ℃ water bath for 15 minutes, and cool in ice water. Add 5 mL of glacial acetic acid, shake well, and measure the absorbance at 550 nm. Draw a standard curve based on the mass concentration of the standard and the absorbance value. Accurately pipette 0.1 mL of the test solution, measure the sample absorbance according to the above standard determination method, and substitute it into the regression equation to calculate the total saponin content. The total saponin content in the test sample is represented by X, x=(M1×V1) / (M2×V2×1000). In the formula, M1: the mass of total saponins in the sample solution to be tested calculated from the standard curve, in milligrams (mg); V1: the volume of the sample solution, in milliliters (mL); M2: the mass of the sample, in grams (g); V2: the volume of the sample solution used for determination, in milliliters (mL).

[0049] Experiment 2: Analysis of gene expression of key enzymes in the biosynthesis pathway of gypenosides 1. Extract control hairy roots, positive hairy roots, and positive hairy roots treated with cadmium. Use Eastep® Super Total RNA Extraction Kit from Promega Biotech to extract total plant RNA. Use HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) from Novazonics to reverse transcribe RNA into cDNA. Use specific primers to identify key genes in the saponin biosynthesis pathway. GpDXS , GpDHDDS , GpHMGR2 , GpMVK The specific primers are shown in Table 1.

[0050] 2. Housekeeping Gene GpUBC As the internal reference gene (the base sequence of the upstream primer is shown in SEQ ID NO.8: ATGCTGATGGTAGTATATGC; the base sequence of the downstream primer is shown in SEQ ID NO.9: TGGATAGAGGTGAGTATGG), 2- △△CT The relative expression of the gene to be tested was calculated.

[0051] Table 1: Specific primer sequence list The results are as follows Figure 7 and Figure 8 The results showed that in the 0 μM CdCl2 untreated group, the total saponin content of the overexpression lines OE1, OE2 and OE3 was higher than that of the control hairy roots (WT), increasing by 0.13 times, 0.13 times and 0.18 times, and the key enzyme genes of the gypenosides biosynthesis pathway GpDXS , GpDHDDS , GpHMGR2 , GpMVK , GpSQE and Gpβ-AS In the 50 μM CdCl2 cadmium treatment group, the total saponin content of Gynostemma pentaphyllum in the overexpression lines OE1, OE2 and OE3 was significantly higher than that in the control hairy roots (WT), increasing by 0.22 times, 0.26 times and 0.26 times, respectively. GpDXS , GpDHDDS , GpHMGR2 , GpMVK , GpSQE and Gpβ-AS The expression levels of genes were significantly increased compared with WT.

[0052] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and the embodiments. They can be applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily realized.

Claims

1. Gynostemma pentaphyllum GpMYC2-1 A gene characterized by It has the base sequence shown in SEQ ID NO.

1.

2. Gynostemma pentaphyllum GpMYC2-1 A method for constructing a recombinant vector plasmid of a gene, characterized in that: The specific steps include: S1, take 0.1 g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen and grind them into powder; S2, extracting total plant RNA from the powder using a total RNA extraction kit, and then reverse-transcribing the RNA into cDNA using a high-efficiency cDNA single-strand synthesis kit; S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence of Gynostemma pentaphyllum is designed and the upstream and downstream primers are synthesized, and PCR amplification is performed using Gynostemma pentaphyllum cDNA as a template, and then 1.2% agarose gel is used for electrophoresis detection, and gel recovery is performed using a DNA purification and recovery kit to obtain the Gynostemma pentaphyllum. GpMYC2-1 DNA fragments; S4, extract the pCY-35D-GFP plasmid, perform double restriction digestion with SacI and SalI to obtain the pCY-35D-GFP linearized vector; S5. Use cloning kit to GpMYC2-1 The full-length cDNA sequence was homologously recombined with the pCY-35D-GFP linearized vector, and the reaction product was transformed into DH5α competent cells, and positive clones were screened in LB medium containing 50 mg / L kanamycin. S6. After verification by bacterial solution PCR and sequencing, the plasmid was extracted to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.

3. Gynostemma pentaphyllum as claimed in claim 2 GpMYC2-1 A method for constructing a recombinant vector plasmid of a gene, characterized in that: The sequences of the upstream and downstream primers are as follows: Upstream primer: ATGAATCTCTGGACTGATGAAAACG; Downstream primer: CATGATGCCTTGGCGACC.

4. Gynostemma pentaphyllum as claimed in claim 2 GpMYC2-1 A method for constructing a recombinant vector plasmid of a gene, characterized in that: The reaction system of the PCR amplification comprises: High-fidelity enzyme 25 μL, upstream primer 2 μL, downstream primer 2 μL, cDNA 2 μL, ddH2O 19 μL; The reaction conditions were as follows: denaturation at 98 °C for 10 seconds, annealing at 58 °C for 15 seconds, and extension at 72 °C for 2 minutes, for 30 cycles.

5. Gynostemma pentaphyllum as claimed in claim 1 GpMYC2-1 A method for expressing a gene, characterized in that Obtained by the following steps: S1, take 1 μg of pCY-35D-GFP- GpMYC2-1 The recombinant vector plasmid was gently mixed in 100 μL of Agrobacterium rhizogenes competent medium, placed on ice for 5 minutes, quickly frozen in liquid nitrogen for 5 minutes, placed on ice for 5 minutes, and then added with 1000 μL of TY liquid medium. The culture was shaken at 28°C for 4 hours to obtain bacterial cells. The bacterial cells were spread on TY solid plates with 50 mg / L streptavidin and inverted at 28°C for 48 hours to obtain single colonies. S2. Pick a single colony and inoculate it in 1000 μL of TY liquid medium supplemented with 50 mg / L streptavidin, and culture it at 28°C for 24 hours. Take out 100 μL of bacterial solution and culture it in 50 mL of fresh TY medium at 28°C for 2 hours. Add 100 μmoL / L acetosyringone and continue to culture until the absorbance of the culture solution at 600 nm is 0.

5. Centrifuge the culture solution at 5000 rpm for 5 minutes, discard the supernatant and resuspend it in 1 / 2MS medium containing 100 μmoL / L acetosyringone to obtain a resuspended bacterial solution. S3. Take a leaf of Gynostemma pentaphyllum and scratch the surface gently, then soak it in the resuspended bacterial solution, infect it on a horizontal shaker at 110 rpm for 10 minutes, then transfer the leaf to MS solid medium containing 100 μmoL / L acetosyringone, culture it in the dark for 2-3 days, transfer it to MS medium containing 500 mg / L carbenicillin after washing, culture it at 28 ℃ in the dark until the length of the hairy root is 3-5 cm, cut the hairy root and transfer it to MS medium containing 500 mg / L carbenicillin to continue culture, subculture it every other week until the hairy root has no bacterial plaque, then transfer it to MS solid plate without antibiotics for expansion culture for at least 1 month to obtain the hairy root of initial culture; S4. The hairy roots of the initial culture were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28°C in the dark for 7 days. The hairy root strains with continued branching growth were selected and the hairy root DNA was extracted. The hairy root DNA was then used as a template for PCR amplification. GpMYC2-1 Transgenic hairy root system.

6. Gynostemma pentaphyllum as claimed in claim 5 GpMYC2-1 A method for expressing a gene, characterized in that The cleaning described in S3 specifically includes: The cultured explants were transferred to sterile water containing 400 mg / L carbenicillin, washed in a horizontal shaker at 110 rpm for 5 min, and then rinsed with sterile water at least 3 times.

7. Gynostemma pentaphyllum as claimed in claim 5 GpMYC2-1 A method for expressing a gene, characterized in that PCR amplification in S4 specifically includes: According to the 35S promoter contained in the vector, the upstream primer was designed: 35S-F: TGAGACTTTTCAAC; according to GpMYC2-1 sequence, and designed downstream primers: GpMYC2-1-det-R: CATGATGCCTTGGCGACC; The rolB gene in Agrobacterium rhizogenes was selected as the judgement that the hairy roots were induced by Agrobacterium rhizogenes. The upstream and downstream primers F: GCTCTTGCAGTGCTAGATTT and R: GAAGGTGCAAGCTACCTCTC were designed and synthesized from the rolB gene sequence, and PCR amplification was performed using hairy root DNA as a template.

8. Gynostemma pentaphyllum as claimed in claim 5 GpMYC2-1 A method for expressing a gene, characterized in that The reaction system for PCR amplification in S4 includes: Taq Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA 2 μL, ddH2O 19 μL; The reaction conditions were as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 10 s, annealing at 58 °C for 15 s, and extension at 72 °C for 30 s, for 30 cycles.

9. A Gynostemma pentaphyllum as claimed in claim 1 GpMYC2-1 Application of genes as agents for improving plant resistance to cadmium stress.

Images