FaAL6 gene related to strawberry fruit hardness and application thereof

Abstract

The invention belongs to the technical field of plant molecular genetic engineering, and particularly relates to a FaAL6 gene related to strawberry fruit hardness and application of the FaAL6 gene. The nucleotide sequence of the FaAL6 gene is as shown in SEQ ID NO. 1. The invention discloses a nucleotide sequence of a FaAL6 gene for regulating and controlling the hardness of strawberry fruits and an amino acid sequence coded by the FaAL6 gene, and experiments show that the FaAL6 gene or a construct or a host cell containing the FaAL6 gene can be applied to regulating and controlling the hardness of the strawberry fruits. The invention provides a new gene resource for molecular breeding for delaying strawberry fruit softening and improving strawberry fruit storage and transportation performance.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular gene engineering, and in particular to a FaAL6 gene related to strawberry fruit hardness and an application thereof. Technical Background

[0002] Strawberry is a berry fruit tree of the Rosaceae family. After ripening, its fruit has an extremely high softening rate and post-harvest deterioration rate, which seriously limits the transportation, shelf life and economic value of strawberry production. The softening of strawberry fruit is mainly attributed to the degradation of cell wall components, which leads to the destruction of the fruit cell wall structure and the reduction of hardness. The pectin in the middle lamina and primary cell wall of higher plants constitutes an important component of cell wall integrity and rigidity. It can be depolymerized and dissolved by pectate lyase (PL, EC4.2.2.2) during the fruit ripening process, destroying the adhesion between pectin and cellulose and hemicellulose, and unable to maintain the support of the cell wall. Previous studies have shown that transcription factors can directly regulate the transcription of PL genes, thereby mediating the fruit softening process. For example, the NAC transcription factor FvRIF positively regulates fruit softening by binding to the FvPL2 promoter (Li et al., 2023). FvWRKY48 can bind to the W-box element of the FvPLA promoter to promote the expression of FvPLA, resulting in fruit softening (Zhang et al., 2022). In banana, MaWRKY49 accelerates fruit ripening by binding to the PL gene (Liu et al., 2023). However, no transcription factors that inhibit the transcription of the PL gene have been reported so far.

[0003] Alfin-like is a type of transcription factor containing a zinc finger structure, belonging to a subfamily of the zinc finger protein PHD protein family. It is mainly involved in some physiological and developmental processes of plants, and the response of plants to biological and abiotic adversities. Yan et al. (2022) confirmed that the Alfin-like transcription factor VqAL4 recognizes and binds to the CACCTC cis-acting element on the VqNSTS4 promoter, positively regulates the transcription of stilbene synthase synthesis genes, and makes the transgenic grapevines more tolerant to powdery mildew. Wei et al. (2017) only proved that banana MaPHD1 directly binds to the promoter of the cell wall degradation gene MaXTH6 and inhibits the transcription of MaXTH6, but the effect on fruit softening has not been reported or proven. Summary of the invention

[0004] In order to solve the problems in the prior art, one of the objectives of the present invention is to provide a FaAL6 gene related to strawberry fruit firmness, the nucleotide sequence of the FaAL6 gene is shown in SEQ ID NO.1; the amino acid sequence encoded by the FaAL6 gene is shown in SEQ ID NO.2.

[0005] A second object of the present invention is to provide an application of the FaAL6 gene as described above in regulating the firmness of strawberry fruit.

[0006] Preferably, the firmness of strawberry fruit is increased by increasing the expression or activity of the FaAL6 gene; or the firmness of strawberry fruit is reduced by inhibiting the expression or activity of the FaAL6 gene.

[0007] Preferably, the expression of the FaAL6 gene is increased by a FaAL6 overexpression vector, the FaAL6 overexpression vector is pCAMBIA1302-FaAL6, and the PCR product of the FaAL6 gene is obtained using strawberry fruit cDNA as a template, and is connected to a pCAMBIA1302-GFP vector.

[0008] Preferably, the expression of the FaAL6 gene is inhibited by an RNAi interference vector, the RNAi interference vector is FaAL6-TRV2, and the PCR product of the FaAL6 gene is obtained using strawberry fruit cDNA as a template, and is connected to the TRV2 vector in the VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.3.

[0009] The third object of the present invention is to provide a construct for increasing the expression level of the FaAL6 gene in strawberry, wherein the construct contains the FaAL6 gene as described above.

[0010] A fourth object of the present invention is to provide a construct for reducing or eliminating the expression of the FaAL6 gene in strawberry, wherein the construct comprises a siRNA complementary to the target mRNA of the FaAL6 gene.

[0011] A fourth object of the present invention is to provide a host cell containing the construct as described above.

[0012] Preferably, the host cell is Agrobacterium tumefaciens GV3101.

[0013] Finally, the present invention provides an application of the construct or host cell as described above in regulating the hardness of strawberry fruit.

[0014] The beneficial effects of the present invention are:

[0015] 1) The present invention clones the strawberry transcription factor FaAL6 gene, and by transiently expressing it in strawberry fruit, it is possible to increase the cell wall material of the fruit and improve the firmness of the strawberry fruit.

[0016] 2) The present invention uses biochemistry, molecular biology and transgenic technology to explore the molecular regulatory mechanism of the FaAL6 gene in regulating the hardness of strawberry fruit, providing new gene resources for molecular breeding to delay fruit softening and improve the storage and transportation performance of strawberry fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the PCR gel electrophoresis diagram of the FaAL6 gene cloning in Example 1 of the present application, M: DL2000 marker; 1: PCR amplified fragment of FaAL6.

[0018] Figure 2 This is the plasmid map of the plant overexpression plasmid pCAMBIA1302-GFP used in Example 2 of the present application.

[0019] Figure 3 This is the plasmid map of TRV2 of the VIGS system used in Example 2 of the present application.

[0020] Figure 4 This is a comparison diagram of fruit phenotypes after transient expression of the FaAL6 gene in Example 3 of the present application.

[0021] Figure 5 This is a comparison chart of the expression levels of FaAL6 and FaPL1 in strawberry fruit after transient expression in Example 3 of the present application.

[0022] Figure 6 This is a comparison chart of fruit hardness after transient expression in Example 3 of the present application.

[0023] Figure 7 This is a comparison chart of the pectin lyase activity in Example 3 of the present application.

[0024] Figure 8 This is a comparison chart of pectin content in Example 3 of the present application. DETAILED DESCRIPTION

[0025] For ease of understanding, the technical solution of the present invention is described in more detail below in conjunction with embodiments:

[0026] Example 1

[0027] Cloning of the Strawberry Transcription Factor FaAL6 Gene

[0028] The FaPL1 promoter was used to construct the bait vector pFaPL1-pAbAi of the yeast one-hybrid system. The FaAL6 gene was identified by screening the cDNA library of strawberry fruits at different developmental stages and comparing it with the strawberry genome database.

[0029] Design the full-length primer pair based on the full-length sequence of FaAL6 gene:

[0030] FaAL6-F:GA AGATCT GATGGAGGGTTTACCGCAGCA

[0031] FaAL6-R:GG ACTAGT AACTCTAGCCCTCTTGCTAC

[0032] The underlined lines represent the Bgl II restriction site and the Spe I restriction site, respectively.

[0033] Using the cDNA of the "Sweet Charlie" strawberry fruit at the color change stage as a template, TaKaRa LA Taq heat-resistant DNA polymerase was used to obtain the full-length PCR product of the FaAL6 gene under the PCR reaction program of 94℃4min; 95℃30sec, 56℃30sec, 72℃40sec35 times; 72℃10min. The product was connected to the pMD19-T vector, and the ligation product was introduced into E. coli by heat shock method, and coated with 50mg·L -1 The culture was cultured in LB solid medium containing ampicillin at 37°C in the dark for 16 hours, and a single clone was placed in PCR mix. The positive clone was identified by PCR reaction and sequenced to determine the nucleotide sequence of the FaAL6 gene.

[0034] Figure 1 It is the PCR gel electrophoresis diagram of FaAL6 gene cloning. The open reading frame length of FaAL6 gene sequence is 768bp. The nucleotide sequence of FaAL6 gene is shown in SEQ ID NO.1. FaAL6 gene encodes 304 amino acids (including the stop codon), and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0035] Example 2

[0036] Construction of FaAL6 binary expression vector and RNAi interference vector

[0037] 1) Construction of FaAL6 binary expression vector: The positive monoclonal plasmid DNA of Example 1 and the plasmid DNA carrying the pCMABIA1302 vector were double-digested with Bgl II and Spe I, respectively. After reacting at 37°C for 12 hours, agarose gel electrophoresis was performed, and the full-length FaAL6 gene and pCMABIA1302 vector fragments after digestion were recovered using a gel recovery kit. FaAL6 was then ligated to the pCMABIA1302 vector fragment after digestion using T4 ligase. The ligation product was transformed into E. coli by heat shock method and coated with 50 mg·L -1The culture was carried out in LB medium containing kanamycin at 37°C in the dark for 16 hours. The positive clones were identified by PCR and sequenced to obtain a single clone whose nucleotide sequence was exactly the same as that in Example 1. The plasmid DNA of the single clone was introduced into Agrobacterium tumefaciens GV3101 to obtain a positive single clone 1302-FaAL6.

[0038] 2) Construction of RNAi interference vector: A fragment of about 240 bp was selected near the 5' end of the FaAL6 gene, avoiding the conserved domain, and a primer pair for the fragment was designed:

[0039] FaAL6-TRVF:CG GAATTC TCATGGTTGCTTGCTGTTGC

[0040] FaAL6-TRVR:CG GGATCC TGGTGGCGACATCTTTACCC

[0041] The underlined lines represent the EcoR I and BamH I restriction sites, respectively.

[0042] The monoclonal plasmid DNA of Example 1 was used as a template to amplify the FaAL6 gene fragment by PCR. The PCR product was purified and recovered, and then connected to the pMD19-T vector. The ligated product was then transformed into E. coli by heat shock method and coated with 50 mg·L -1 The culture medium was incubated in the dark at 37°C for 16 hours on LB medium containing ampicillin. After positive clones were detected by PCR, sequencing analysis was performed to determine the monoclonal clone with the same sequence as in Example 1. The plasmid DNA of the monoclonal clone and the plasmid DNA carrying the TRV2 vector were double-digested with EcoR I and BamH I, respectively, and subjected to agarose gel electrophoresis. The 200-300bp fragment and the TRV2 vector fragment after enzyme digestion were recovered using a gel recovery kit, and the fragment was connected to the TRV2 vector fragment after double enzyme digestion by T4 ligase. After sequencing, a positive monoclonal clone whose sequence matched that of Example 1 was obtained, and its plasmid DNA was extracted to transform Agrobacterium tumefaciens GV3101 to obtain the positive monoclonal clone FaAL6-TRV2, the sequence of which is shown in SEQ ID NO.3.

[0043] Figure 2 This is the plasmid map of the plant overexpression vector pCAMBIA1302-GFP carrying the GFP tag;

[0044] Figure 3 This is the plasmid map of TRV2 for the VIGS system.

[0045] Example 3

[0046] Transient expression of FaAL6 gene in strawberry fruit and its effect on strawberry fruit firmness

[0047] Agrobacterium tumefaciens carrying 1302-FaAL6, 1302 (control), FaAL6-TRV2 and TRV2 (control) in Example 2 were respectively injected into strawberry fruits at the green-white stage through needles using disposable 1 mL syringes to allow the carried vectors to be transiently expressed in the strawberry fruits.

[0048] In order to reduce the impact of fruit-to-fruit and growth factor changes on fruit phenotypic changes, the expression vector / silencing vector and empty vector were injected into the left and right sides of the fruit respectively.

[0049] When testing the hardness of a fruit, the hardness of 2-3 different positions needs to be measured. In order to facilitate the hardness test, the whole fruit injection method is adopted, that is, the needle is inserted into the fruit through the fruit stalk, and the injection liquid is injected. The fruit hardness is compared after the fruit is fully ripe.

[0050] The specific steps are as follows:

[0051] 1) Agrobacterium tumefaciens GV3101 carrying pCMABIA1302-FaAL6, pCMABIA1302 (control), FaAL6-TRV2 and TRV2 (control) were cultured in LB solid medium (containing 50 mg·L -1 Kanamycin and 50 mg L -1 After obtaining a single clone by streaking on the rifampicin, pick a single clone and inoculate it into 20 mL containing 50 mg·L -1 Kanamycin and 50 mg L -1 Rifampicin was added to the LB liquid medium and shaken at 200 rpm for 12 h at 28 °C until the OD 600 About 0.6-0.8;

[0052] 2) Transfer the bacterial solution in 1) to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 5 min at room temperature, discard the supernatant, and collect the colonies;

[0053] 3) Use the impregnation solution (containing MES with a final concentration of 1.0 mol·L -1 , the final concentration of MgCl2 is 1.0 mol·L -1 The final concentration of acetosyringone was 1.0 mol·L -1 ) Resuspend the colony to obtain injection solution;

[0054] 4) Select strawberry green-white fruits with uniform size and no deformity, and use a 1mL sterile syringe to draw the injection solution. To observe the phenotypic changes of the fruit, insert the needle to a depth of 0.5cm from the surface of the fruit, and squeeze out 100μL of injection solution. To measure the fruit hardness and other indicators, insert the needle 1cm from the fruit stalk, and then squeeze 500μL of injection solution into the fruit. The injected strawberry fruits are set up in three replicates, with three fruits in each replicate.

[0055] 5) Take fruit samples for real-time quantitative analysis 3 days after injection; observe the phenotypic changes of strawberry fruits and take photos about 10 days after injection; after the fruit is fully ripe, use a texture analyzer to measure the fruit hardness. Method for measuring fruit hardness using a texture analyzer: Analyze the hardness of strawberry fruit using a texture analyzer, select a TA39 probe, and insert it 6mm into the fruit at a speed of 0.5mm / s. The insertion position is a point at the equator of the fruit and its opposite side, and the average of the two measured values ​​is the hardness of the fruit.

[0056] Experimental results:

[0057] See also Figure 4-Figure 8 . Figure 4 This is a comparison of fruit phenotypes after transient expression of the FaAL6 gene, where 1302 indicates that the strawberry fruit was injected with the pCAMBIA1302 empty vector, FaAL6-1302 indicates that the strawberry fruit was injected with the FaAL6-1302 fusion expression vector; TRV2 indicates that the strawberry fruit was injected with the TRV2 and TRV1 empty vectors; FaAL6-TRV2 indicates that the strawberry fruit was injected with the FaAL6-TRV2 recombinant vector and the TRV1 empty vector. It can be seen that overexpression of the FaAL6 gene in the fruit inhibits fruit ripening, while interference with FaAL6 gene expression promotes fruit ripening.

[0058] Figure 5 The figure is a comparison of the expression levels of FaAL6 and FaPL1 in strawberry fruit after transient expression; A in the figure is the expression level of the FaAL6 gene in the fruit after injection of the FaAL6-1302 fusion expression vector, B is the expression level of the FaPL1 gene in the fruit after injection of the FaAL6-1302 fusion expression vector, C is the expression level of the FaAL6 gene in the fruit after injection of the FaAL6-TRV2 vector, and D is the expression level of the FaPL1 gene in the fruit after injection of the FaAL6-TRV2 vector. It can be seen that the expression of the FaAL6 gene in the strawberry fruit injected with the FaAL6-1302 fusion expression vector increased, while the expression level of FaPL1 decreased; the expression of the FaAL6 gene in the strawberry fruit injected with the FaAL6-TRV2 vector decreased, while the expression level of FaPL1 increased. Increasing the expression of the FaAL6 gene inhibits the transcriptional activity of the FaPL1 gene, thereby slowing down the softening process of the fruit. Figure 6This is a comparison of fruit hardness after transient expression. Compared with the control, the hardness of strawberry fruit injected with the FaAL6-1302 fusion expression vector increased significantly, while the hardness of strawberry fruit injected with the FaAL6-TRV2 vector decreased significantly, indicating that the expression of the FaAL6 gene is related to the hardness of strawberry, and increasing the expression of the FaAL6 gene is beneficial to improving the hardness of strawberry fruit.

[0059] Figure 7 This is a comparison of pectin lyase activity in fruits after transient expression. Pectin lyase hydrolyzes pectin in the cell wall components, resulting in the destruction of the cell wall structure and accelerating the softening of the fruit. Compared with the control, the pectin lyase activity of strawberry fruits injected with the FaAL6-1302 fusion expression vector was significantly reduced, while the pectin lyase activity of strawberry fruits injected with the FaAL6-TRV2 vector was increased.

[0060] Figure 8 This is a comparison of pectin content in fruits after transient expression. WSP is water-soluble pectin, CBP is covalent pectin, and ISP is ionic pectin. It can be seen that WSP was significantly reduced when FaAL6 was overexpressed, while the ISP content did not change significantly. In the strawberry fruit with transient inhibition of FaAL6 gene expression, WSP increased significantly compared with the control, and CBP content decreased. Pectin is an important component of the cell wall. Increasing FaAL6 gene expression can increase the pectin content in strawberry fruit, thereby increasing the fruit hardness.

[0061] The above implementation modes are only used to illustrate the technical solutions of the present invention, but not to limit the present invention. Although the present invention has been described in detail with reference to the above implementation modes, those skilled in the art should understand that any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A FaAL6 gene related to strawberry fruit firmness, characterized in that: The nucleotide sequence of the FaAL6 gene is shown in SEQ ID NO.

1.

2. The FaAL6 gene related to strawberry fruit firmness according to claim 1, characterized in that: The amino acid sequence encoded by the FaAL6 gene is shown in SEQ ID NO.

2.

3. Use of the FaAL6 gene as claimed in claim 1 in regulating the firmness of strawberry fruit.

4. The use according to claim 3, characterized in that By increasing the expression or activity of the FaAL6 gene, the firmness of the strawberry fruit is increased; by inhibiting the expression or activity of the FaAL6 gene, the firmness of the strawberry fruit is reduced.

5. The use according to claim 4, characterized in that The expression of the FaAL6 gene is improved by using a FaAL6 overexpression vector, wherein the FaAL6 overexpression vector is pCAMBIA1302-FaAL6, and the PCR product of the FaAL6 gene is obtained by using strawberry fruit cDNA as a template, and then connected to a pCAMBIA1302-GFP vector.

6. The use according to claim 4, characterized in that The expression of the FaAL6 gene is inhibited by an RNAi interference vector, wherein the RNAi interference vector is FaAL6-TRV2. The PCR product of the FaAL6 gene is obtained by using strawberry fruit cDNA as a template and connected to the TRV2 vector in the VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.

3.

7. A construct for increasing the expression of FaAL6 gene in strawberry, characterized in that: Contains the FaAL6 gene as claimed in claim 1.

8. A construct for reducing or eliminating the expression of the FaAL6 gene in strawberry, characterized in that It includes siRNA complementary to the target mRNA of the FaAL6 gene.

9. A host cell, characterized in that Containing the construct according to claim 7, or containing the construct according to claim 8.

10. Use of the construct according to claim 7 or 8 or the host cell according to claim 9 in regulating strawberry fruit firmness.

Images