Growth and development gene of upland cotton and application thereof

Abstract

The invention discloses a growth and development gene of upland cotton and application thereof, the gene Gohir.A08G240900 related to growth and development is excavated by reverse transcription of RNA of the upland cotton, and the nucleotide sequence of the gene is as shown in SEQ ID No.1. The gene can influence the plant height of the upland cotton plant, has a large expression quantity in the upland cotton with tall plants, and has a good application prospect. The expression quantity in the upland cotton with short plants is obviously reduced. Meanwhile, through a virus-induced gene silencing VIGS experiment, it is found that after being silenced, the gene Gohir.A08G240900 causes damage to plant growth and development, so that plant growth is affected, the phenotype that the plant height is remarkably reduced is shown, it is indicated that the gene Gohir.A08G240900 is a potential target spot for regulating and controlling the plant height, and a new genetic basis is provided for improving the plant height of upland cotton.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic technology, and in particular to a growth and development gene of upland cotton and an application thereof. Background Art

[0002] Cotton is the second largest crop after grain, and its production is directly related to the stable development of society and economy. With the growth of global population and the acceleration of urbanization, land resources for agricultural production are becoming increasingly scarce. How to increase cotton production on limited land resources is an important way to meet the growing demand for cotton and ensure the sustainable development of the cotton industry.

[0003] The height of cotton plants will directly affect their growth and development. If the plant height is too low, the leaves may block each other, resulting in insufficient light, affecting the efficiency of photosynthesis, and thus limiting the growth rate and yield of cotton. At the same time, if the plant height is too low, the number of fruit branches and bolls will decrease, affecting the yield of cotton. If cotton grows too high, it is easy to cause too many branches, weak overall seedlings, and easy lodging, which will affect the yield of cotton, reduce the fiber quality of cotton, and be unfavorable for mechanized harvesting, increasing picking costs.

[0004] Based on this, it is necessary to further study the genes that affect cotton plant height and understand their regulatory mechanisms, and use these genes to breed tall cotton and select cotton varieties with appropriate plant height. Increasing cotton yields is a technical problem that needs to be solved urgently. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a growth and development gene of upland cotton and application thereof.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution: a growth and development gene of upland cotton, the nucleotide sequence of the growth and development gene Gohir.A08G240900 of upland cotton is shown in SEQ ID No.1.

[0007] Furthermore, the nucleoside sequences of the upstream primer and the downstream primer for amplifying the growth and development gene Gohir.A08G240900 are shown as SEQ ID No.2 and SEQ ID No.3, respectively.

[0008] Furthermore, the present invention also provides an application of the growth and development gene Gohir.A08G240900 of upland cotton in improving the height of upland cotton plants.

[0009] Furthermore, the present invention also provides a recombinant vector comprising the growth and development gene Gohir.A08G240900.

[0010] Furthermore, the present invention also provides an application of the recombinant vector in improving the height of upland cotton plants.

[0011] Compared with the prior art, the present invention has the following beneficial effects: the present invention mines the growth-related gene Gohir.A08G240900 by reverse transcription of RNA of upland cotton, and the gene can affect the plant height of upland cotton, and the expression level is high in upland cotton with tall plants, and the expression level is significantly reduced in upland cotton with short plants. At the same time, through the virus-induced gene silencing VIGS experiment, it was found that the gene Gohir.A08G240900 caused the plant growth and development to be impaired after silencing, thereby affecting the growth of the plant, and thus showing a phenotype of significantly shortened plant height, indicating that the gene Gohir.A08G240900 is a potential target for regulating plant height, providing a new genetic basis for improving the plant height of upland cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the expression level of the growth and development gene Gohir.A08G240900 in different varieties of upland cotton;

[0013] Figure 2 Schematic diagram of the expression level of the growth and development gene Gohir.A08G240900 after VIGS silencing;

[0014] Figure 3 This is a statistical comparison of plant heights when the growth and development gene Gohir.A08G240900 was expressed and suppressed for three weeks in upland cotton;

[0015] Figure 4 This is a comparison chart of the expression and inhibition of the growth and development gene Gohir.A08G240900 in upland cotton. DETAILED DESCRIPTION

[0016] The technical solution of the present invention is further explained below in conjunction with the accompanying drawings.

[0017] Arabinogalactan proteins (AGPs) are widely distributed in plants and participate in various biological processes such as growth and development, cell division and even reproductive development of plants. In order to further confirm the role of AGP genes in the regulation of growth and development of upland cotton, two strains with higher plant heights under natural conditions (Su cotton 30 and Jinxiu cotton 1) and two strains with shorter plant heights under natural conditions (Xinluzhong 21 and Xinluzao 74) were selected. The significant differences in the expression of certain members of the AGP family in upland cotton plants were determined by RT-qPCR analysis. It was found that only one gene in the AGP family of upland cotton, Gohir.A08G240900, was significantly high in strains with higher plant heights. Therefore, the present invention provides a growth and development gene of upland cotton, the nucleotide sequence of the growth and development gene Gohir.A08G240900 of upland cotton is shown in SEQ ID No.1, and the growth and development gene Gohir.A08G240900 can directly affect the morphology of upland cotton plants.

[0018] In order to further confirm whether the growth and development gene Gohir.A08G240900 can affect the growth and development of upland cotton and even the plant type of cotton, two upland cotton varieties with tall plants in natural conditions, Sumian 30 and Jinxiumian 1, and two varieties with short plants, Xinluzhong 21 and Xinluzao 74, were selected. The terminal buds when the cotyledons were not fully expanded, with a length of less than 1 cm, were used for RNA extraction. RNA was extracted using a polysaccharide and polyphenol special RNA extraction kit (Tiangen), and reverse transcribed using a HiScriptIII RT SuperMix for qPCR (+gDNAWiper) kit (Vazyme, Nanjing, China) to obtain cDNA, and then RT-qPCR was performed to analyze the expression level of gene Gohir.A08G240900. Real-time quantitative PCR analysis was performed using the ChamQSYBR qPCR Master Mix (LowROX Premixed) kit (Vazyme, Nanjing, China). The qPCR primers for gene Gohir.A08G240900 were designed using Primer 6.0. The nucleoside sequence of the upstream primer of gene Gohir.A08G240900 is shown in SEQ ID No.2: 5'-GTCATTGTGGCGTTGTTGTTC-3', and the nucleoside sequence of the downstream primer of gene Gohir.A08G240900 is shown in SEQ ID No.3: 5'-CAATCGCAGCACCGTCATT-3'. The reaction volume was 20 μL, and the amplification program was: pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, and 40 cycles. Each gene was repeated three times biologically and three times technically. Figure 1 Figure 2 is the expression level of the growth and development gene Gohir.A08G240900 in different varieties of upland cotton. It can be seen that the expression levels of the growth and development gene Gohir.A08G240900 in the above four varieties of upland cotton are Jinxiumian No. 1, Sumian 30, Xinluzao 74 and Xinluzhong 21, from high to low, indicating that the growth and development gene Gohir.A08G240900 has a higher expression level in upland cotton with tall plant height.

[0019] In order to further explore the role of gene Gohir.A08G240900 in the growth and development of upland cotton, a VIGS vector was constructed to silence the growth and development gene Gohir.A08G240900 in upland cotton "Su Mian 30" by virus induction.

[0020] (1) Using Sumian 30 as the experimental material, the intact and similar seeds were soaked in carbendazim for disinfection, and then planted in a pot mixed with nutrient soil and vermiculite, wherein the mass ratio of nutrient soil to vermiculite was 3:1; the greenhouse temperature was maintained at 25°C, the light and dark time were set to 16 hours and 8 hours, and light and dark were given alternately;

[0021] (2) When the cotyledons of Su cotton 30 were fully expanded and the first true leaf had just appeared, a virus-induced gene silencing VIGS experiment was performed. Since the length of the Gohir.A08G240900 gene was short, its full-length sequence was connected to the pTRV2 vector for VIGS experiment: In the VIGS experiment, the upstream primer sequence of the Gohir.A08G240900 gene was as shown in SEQ ID No.4: ATGATGAGTTCAATAAAGGTGCATG, and the downstream primer sequence was as shown in SEQ ID No.5: ATGGATGAGGTAAGTAATTGCCAA; PCR was used to amplify and insert the target gene sequence into the pTRV2 vector, and the EcoR1 and BamH1 enzymes were used to treat to construct the virus-induced gene silencing vector pTRV2:Gohir.A08G240900. Then, the vector pTRV2:Gohir.A08G240900 was transformed into Agrobacterium tumefaciens (GV3101). After screening the positive clones, the bacterial solution was injected into the cotyledons of the seedlings of Su Mian 30 using a sterile syringe, and the infection was completed before the first true leaf was fully expanded. After 24 hours of dark treatment, it was transferred to the artificial climate room. About two weeks after Su Mian 30 was infected with Agrobacterium, the true leaves of the positive control TRV2:CLA1 showed obvious albino phenotype; in the third week after infection, it was observed that the true leaves of TRV2:CLA1 had completely turned albino, as shown in Figure 2. Figure 2 As shown in the left figure, it shows that the VIGS in this study can effectively silence the target gene.

[0022] The GhCLA (cloroplastos alterados) used in this study is a homologous gene of AtCLA1 in Arabidopsis thaliana that is responsible for chloroplast development, so its mutant (CLA1) has an albino phenotype. TRV belongs to the genus Tobravirus (family Virgaviridae), and the TRV vector has been shown to be useful for silencing the chloroplast alterados 1 (CLA1) gene in G. hirsutum and G. barbadense. Therefore, the silencing of the GhCLA gene can prove that the VIGS procedure of this study is correct and effective.

[0023] like Figure 2 The right picture and Figure 3 The height of the silenced plants TRV2:Gohir.A08G240900 was significantly reduced when compared with the untreated control group TRV2:00 Su Mian 30. The second true leaf of TRV2:Gohir.A08G240900 and TRV2:00 was taken to extract RNA, and the expression level was measured to verify the effect of gene silencing. RT-qPCR analysis showed that when the silenced plants were compared with the control plants, Figure 4 It can be seen that the expression of gene Gohir.A08G240900 in the virus-induced gene silencing plant pTRV2:Gohir.A08G240900 is almost 0, that is, the expression level of gene Gohir.A08G240900 in the plant after silencing is significantly inhibited. This result proves that the effect of gene silencing is successful.

[0024] Therefore, after silencing, the Gohir.A08G240900 gene causes plant growth and development to be impaired, thereby affecting plant growth, and thus showing a phenotype of significantly shorter plant height, indicating that the Gohir.A08G240900 gene is a potential target for regulating plant height, providing a new genetic basis for improving plant height of upland cotton. For upland cotton with too low plant height, the plant height of upland cotton can be increased by promoting the expression of the growth and development gene Gohir.A08G240900; for upland cotton with too high plant height, the expression of the growth and development gene Gohir.A08G240900 can be inhibited by gene editing and other methods, thereby reducing the plant height of upland cotton. Therefore, by regulating the growth and development gene Gohir.A08G240900, upland cotton has a moderate plant height, thereby increasing the cotton yield of upland cotton.

[0025] The present invention reversely transcribes RNA of upland cotton and digs out the gene Gohir.A08G240900 related to growth and development. The gene can affect the plant height of upland cotton, and the expression level is high in tall upland cotton, and the expression level is significantly reduced in short upland cotton. At the same time, through the virus-induced gene silencing VIGS experiment, it was found that the gene Gohir.A08G240900 affects the plant height after silencing, indicating that the gene Gohir.A08G240900 is a potential target for regulating plant height, providing a new genetic basis for improving the plant height of upland cotton.

[0026] The above are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions under the concept of the present invention belong to the protection scope of the present invention. It should be pointed out that for ordinary technicians in this technical field, some improvements and modifications without departing from the principle of the present invention should be regarded as the protection scope of the present invention.

Claims

1. A growth and development gene for upland cotton, characterized in that: The nucleotide sequence of the growth and development gene Gohir.A08G240900 of upland cotton is shown in SEQ ID No.

1.

2. The growth and development gene of upland cotton according to claim 1, characterized in that: The nucleoside sequences of the upstream primer and the downstream primer for amplifying the growth and development gene Gohir.A08G240900 are shown in SEQ ID No.2 and SEQ ID No.3 respectively.

3. Use of the upland cotton growth and development gene Gohir.A08G240900 described in claim 1 in improving the height of upland cotton plants.

4. A recombinant vector, characterized in that: Contains the growth and development gene Gohir.A08G240900 described in claim 1.

5. Use of the recombinant vector according to claim 4 in improving the growth of upland cotton plants.

Images