Application of corn ZmMAPKKK17 gene in improvement of cold stress resistance of plants

Abstract

The invention relates to the field of genetic engineering and plant genetic breeding, and provides application of a corn ZmMAPKKK17 gene in improvement of cold stress resistance of plants. A low-temperature-resistant maize inbred line B144 and a low-temperature-sensitive maize inbred line Q319 are used as test materials, a low-temperature-resistant physiological response mechanism of maize is disclosed, a ZmMAPKKK17 functional gene is cloned and subjected to structural analysis, phylogenetic tree analysis and subcellular localization analysis, cytological response of the ZmMAPKKK17 gene for regulating and controlling low-temperature resistance in a germination period is determined, and the low-temperature-resistant maize inbred line B144 and the low-temperature-sensitive maize inbred line Q319 are used as test materials. According to the present invention, the ZmMAPKKK17 gene is used as the gene, the gene interacting with the ZmMAPKKK17 gene in corn is screened and verified by combining yeast two-hybrid, Pull-Down, BiFC, Co-IP and other technologies, the action mechanism of the ZmMAPKKK17 gene participating in the corn germination period low temperature resistance regulation is analyzed, and the theoretical basis and the technical support are provided for the creation of the cold region corn low temperature resistance new germplasm and the cultivation of the new variety.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and plant genetic breeding, and in particular to corn ZmMAPKKK17 Application of genes in improving plant tolerance to cold stress. Background Art

[0002] corn( Zea mays L.) is one of the most important food crops in the world and occupies a pivotal position in my country's agricultural production. Corn is a thermophilic crop with an optimum growth temperature of 25℃-32℃. It is susceptible to low temperature and chilling damage during its growth and development, and will show chilling damage symptoms when the temperature is 10℃ or below. Low temperature and chilling damage has different effects on different growth and development stages of corn. When corn seeds suffer from low temperature and freezing damage during the soil germination period, corn seeds stop germinating, causing seed vitality and seed germination rate to be severely reduced, causing serious impact on production. When corn seedlings suffer from low temperature and chilling damage during their growth and development, the field emergence rate is significantly reduced, inhibiting the normal growth and development of seedlings, and the growth of corn plants is short, affecting fruiting and reproductive capacity, and in severe cases, it can lead to plant death. Therefore, conducting research on the mechanism of corn's tolerance to low temperatures, breeding and creating new corn germplasm with strong low temperature resistance are effective measures to deal with low temperature and chilling damage.

[0003] Most studies have shown that low temperature tolerance in the germination period of maize is a complex quantitative genetic trait controlled by multiple genes, and the genes controlling inheritance are different at different growth stages. McConnell et al. studied the germination ability of three thermophilic inbred lines and three low temperature tolerant inbred lines and their F1, F2 and backcross populations, and found that the epistatic, additive and dominant gene effects of germination ability under low temperature were significant. Revilla et al. conducted double-row hybridization on five inbred lines with different low temperature tolerance, and after double identification indoors and in the field, found that the genetic regulation of the high germination rate and low temperature tolerance trait conforms to the additive-dominant model. Hund et al. used F 2:3 Population, the QTL of maize bud development under low temperature stress was located, and it was found that the main effect QTL on chromosome 5 could explain 12% of the variation of germination index. Ma Yanhua et al. used the segregation population and detected 5 QTLs related to low temperature tolerance of maize on chromosomes 2, 4, 6 and 10 with the relative germination rate at 10℃ / 25℃. Hu et al. conducted a genome-wide association analysis on 282 core maize inbred lines from the United States using the germination rate under low temperature conditions as an identification index, and discovered 17 SNPs associated with germination traits on chromosomes 1, 2, 4, 6, 7 and 9, respectively. In general, due to the different positioning populations and mapping methods used by domestic and foreign scholars, the obtained QTLs related to low temperature tolerance during maize germination are less consistent, and the main effect QTL of low temperature tolerance during maize germination has not yet been located. Summary of the invention

[0004] The present invention aims to provide corn ZmMAPKKK17 Application of genes in improving plant tolerance to cold stress.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides corn ZmMAPKKK17 Application of genes in improving plant tolerance to cold stress.

[0006] In the present invention, the ZmMAPKKK17 The gene is a gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 2.

[0007] corn ZmMAPKKK17 The nucleotide sequence of the gene is: i) the nucleotide sequence shown in SEQ ID NO: 1; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0008] Furthermore, the plant includes but is not limited to corn.

[0009] In a second aspect, the present invention provides a method for improving the cold tolerance of plants, the method comprising: using genetic engineering means to overexpress in plants ZmMAPKKK17 Gene.

[0010] The overexpression method may be selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) By introducing enhancers.

[0011] Preferably, the Agrobacterium-mediated method is used to ZmMAPKKK17 The gene was transferred into corn plants to obtain ZmMAPKKK17 Transgenic plants with overexpressed genes.

[0012] In a third aspect, the present invention provides the use of the transgenic plant obtained according to the method in plant breeding.

[0013] Further, breeding methods include but are not limited to transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0014] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention uses the low-temperature resistant corn inbred line B144 and the low-temperature sensitive corn inbred line Q319 as experimental materials to reveal the physiological response mechanism of corn to low temperature resistance and clone ZmMAPKKK17 Functional genes were analyzed for structure, protein physicochemical properties, phylogenetic tree, and subcellular localization to clarify their biological functions. qRT-PCR technology was used to analyze the tissue expression of the gene to clarify ZmMAPKKK17 Gene regulation of low temperature tolerance in germination period: cytological response, combined with yeast two-hybrid, Pull-Down, BiFC and Co-IP techniques to screen and verify the gene regulation of low temperature tolerance in maize ZmMAPKKK17 Gene-to-gene interaction analysis ZmMAPKKK17 The mechanism of action of genes involved in the regulation of low temperature resistance of corn during the germination period provides a theoretical basis and technical support for the creation of new low-temperature-resistant corn germplasms and the breeding of new varieties in cold-regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Picture 1 In Example 1 of the present invention ZmMAPKKK17 Gene amplification electrophoresis.

[0016] Picture 2 In Example 1 of the present invention ZmMAPKKK17 Homologous sequence alignment and phylogenetic tree analysis.

[0017] Picture 3 The low temperature stress treatment in Example 1 of the present invention ZmMAPKKK17 Relative expression levels in maize roots during germination.

[0018] Picture 4 The low temperature stress treatment in Example 1 of the present invention ZmMAPKKK17 Relative expression levels in maize germination sprouts.

[0019] Picture 5A In Example 1 of the present invention ZmMAPKKK17 The subcellular localization results, specifically 35S:: ZmMAPKKK17-GFP localization results. From left to right are fluorescence channel, chloroplast fluorescence channel, bright field, and overlay.

[0020] Picture 5B In the embodiment of the present invention ZmMAPKKK17 Subcellular localization results, specifically 35S::GFP localization results. From left to right are fluorescence channel, chloroplast fluorescence channel, bright field, and overlay.

[0021] Picture 6A This is the overexpression vector map in Example 2 of the present invention.

[0022] Picture 6B This is the knockout vector map in Example 2 of the present invention.

[0023] Picture 7 This is a flow chart of the genetic transformation stages of corn in Example 2 of the present invention.

[0024] Picture 8 This is the molecular detection result of the corn genetically modified material in Example 2 of the present invention.

[0025] Picture 9 This is a comparative analysis of the physiological indicators of the corn transgenic materials in Example 2 of the present invention.

[0026] Picture 10 The corn in Example 2 of the present invention ZmMAPKKK17 The germination rate of the gene overexpression strain was significantly higher than that of the wild type.

[0027] Picture 11 The cold tolerance of corn transgenic materials under low temperature stress in Example 2 of the present invention, the two plants on the left are non-knockout plants, and the two plants on the right are corn ZmMAPKKK17 Gene knockout plants. DETAILED DESCRIPTION

[0028] The present invention investigates the physiological response of different corn inbred lines to low temperature stress. After suffering from low temperature stress, a large amount of active oxygen will accumulate in the plant body. In order to maintain its normal life activity metabolism, the antioxidant system in the plant body will effectively remove the active oxygen, thereby reducing the damage of oxidative stress. The research results show that the low temperature tolerant inbred line B144 and the low temperature sensitive inbred line Q319 (Yu Tao; Zhang Jianguo; Cao Jingsheng; Cai Quan; Li Xin; Sun Yan; LiSinan; Li Yunlong; Hu Guanghui; Cao Shiliang; Liu Changhua; Wang Gangqing; WangLishan; Duan Yajuan. Leaf transcriptomic response mediated by cold stress in two maize inbred lines with contrasting tolerance levels[J]. Genomics, 2021,113(2):782-794.https: / / doi.org / 10.1016 / j.ygeno.2021.01.018. Or, Yu, T.; Zhang, J.; Ma, X.; Cao, S.; Li, W.; Yang, G. A Multi-Omics View of Maize's(Zea mays L.) Response to Low Temperatures During the Seedling Stage. Int. J.Mol. Sci. 2024, 25, 12273. https: / / doi.org / 10.3390 / ijms252212273) showed a trend of increasing first and then decreasing, indicating that low temperature stress can induce the production of antioxidant enzymes, and the enhancement of SOD and POD activities plays a key role in improving the low temperature tolerance of the low temperature tolerant maize inbred line B144. However, with the extension of low temperature time, the degree of oxidative damage to cells deepens, so the activity of antioxidant enzymes produced in the plant body also weakens. Studies have shown that the content of malondialdehyde (MDA) is inversely proportional to the low temperature tolerance of maize. In the present invention, the content of malondialdehyde in the leaves of B144 and Q319 both showed an increasing trend under low temperature stress, and the content of malondialdehyde in B144 was significantly lower than that in Q319, which further proved that the content of MDA is indeed inversely proportional to cold tolerance. Studies have shown that soluble sugar, as an osmotic regulating substance, can stabilize the osmotic pressure of plants, prevent excessive water loss of protoplasm, and improve the adversity regulation ability of plants.Under low temperature stress, the soluble sugar content in B144 and Q319 showed a trend of first rising and then falling, and the overall content was higher than that in the initial stage of low temperature, and the increase of B144 was greater. It shows that the content of soluble sugar is proportional to the cold tolerance of corn. The root system of the plant seedling stage is more sensitive to low temperature than the leaves. The root activity reflects the root system's ability to absorb water and nutrients, and then has a direct impact on the growth of the aboveground part. In the present invention, as the low temperature treatment time is extended, the root activity of B144 and Q319 both show a downward trend. In addition, the root activity of Q319 decreases much more than that of B144, indicating that the corn material with a larger root activity value has a stronger adaptability to low temperature. Studies have reported that low temperature stress exacerbates the degradation of chlorophyll and inhibits the photosynthetic system of plants. The present invention found that after being subjected to low temperature stress, the chlorophyll content in B144 and Q319 showed a downward trend.

[0029] There are also large differences in the tolerance of corn varieties with different genotypes to low temperature stress. The present invention uses two corn inbred lines with different cold tolerance to study the changes in morphological and physiological and biochemical indicators under low temperature stress at the seedling stage, providing a basis for cultivating cold-tolerant corn germplasm resources.

[0030] The present invention uses 6 identification indicators such as relative germination index to conduct GWAS (genome-wide association analysis) on a natural population of 296 excellent corn inbred lines from home and abroad. As a result, 14 SNP sites related to low temperature tolerance during germination were detected, and the phenotypic variation explained was between 4.84% and 9.68%. In the previous study, the strong low temperature tolerance corn inbred line B144 and the low temperature sensitive corn inbred line S319 identified in the natural population were used as parents to mate F 2:3 The germination rate of seeds under low temperature stress was investigated at 5°C. Four candidate regions related to low temperature resistance during maize germination were located on chromosomes 1, 3, and 7 using BSA-seq technology. ZmMAPKKK17 Genes were revealed through gene overexpression and gene knockout experiments ZmMAPKKK17 Genes have the function of improving plant cold tolerance.

[0031] Specific methods include: (1) Physiological and biochemical indicators of cold tolerance were used to explore the physiological responses of two different genotypes of corn materials to low temperature stress. The results showed that low temperature stress caused a significant decrease in SOD activity, POD activity, soluble sugar content, root activity and chlorophyll content in plant leaves, but the malondialdehyde content showed an upward trend, indicating that the malondialdehyde content was inversely proportional to the cold tolerance of corn. B144 showed stronger cold tolerance. The joint participation of soluble sugar content and multiple antioxidant enzymes was the response mechanism for the formation of cold tolerance in corn seedlings.

[0032] (2) Using the cold-tolerant maize inbred line B144 as the experimental material, we successfully cloned ZmMAPKKK17 Cold-tolerant gene, which encodes 377 amino acids, bioinformatics analysis showed that the promoter region of the gene contained multiple cis-acting elements related to adverse stress. Phylogenetic tree analysis showed that the protein was closely related to Miscanthus quinquefolius and sorghum, and its homologous genes were closely related to abiotic stress.

[0033] (3) Fluorescence quantitative PCR results showed that the gene was induced to express in both roots and shoots during the germination period of maize by low temperature stress. The expression level of the gene in roots induced by low temperature stress was 16.56 times that of the control, and the expression level of the gene in shoots induced by low temperature stress was 2.17 times that of the control, indicating that the gene was specifically expressed in the root tissue.

[0034] (4) The subcellular localization expression vector was successfully constructed, and the subcellular localization results showed that ZmMAPKKK17 The protein aggregates in the cell in granular form and is mainly located in the nucleus.

[0035] (5) Through the yeast two-hybrid experiment, 30 initial positive colonies were screened from the corn yeast two-hybrid library. After BLAST comparison analysis of the plasmid DNA sequencing results of the positive clones in the yeast colonies, the results showed that these genes were coding genes for 25 different proteins.

[0036] (6) The protein interactions of the four candidate genes screened were verified by GST pull-down, co-immunoprecipitation (Co-IP) and bimolecular fluorescence complementation (BiFC) techniques. The results showed that ZmMAPKKK17 Protein and LOC542176 , LOC118474710 , LOC100286253 These three genes have protein interactions, but not with LOC103628994.

[0037] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0038] Example 1 ZmMAPKKK17 Gene cloning and bioinformatics analysis 1. Test materials and treatments The plump and uniform B144 seeds were selected, sown in a culture pot containing nutrient soil and vermiculite (volume ratio of 3:1), and cultured in a constant temperature incubator at 25°C to extract corn genomic DNA.

[0039] 2. Test methods 2.1 Primer design and synthesis According to NCBI ZmMAPKKK17 The full-length sequence of LOC103651289 was used to design primers for PCR amplification (Table 1).

[0040] Table 1 Primer sequences 2.2 Total DNA extraction The total DNA of corn leaves was extracted using a plant genomic DNA extraction kit (a new plant genomic DNA extraction kit purchased from Beijing Kangwei Century Biotechnology Co., Ltd.). The specific extraction method was referred to the kit manual. The designed primers were used to amplify the target gene, and the integrity of the extracted DNA was detected by 1.5% agarose gel electrophoresis. With 1 µL of genomic DNA as the template, PCR amplification was performed using a 25 µL PCR reaction system, which included 12.5 µL of 2× GC buffer I, 0.5 µL of upstream primer (10 µmol / L), 0.5 µL of downstream primer (10 µmol / L), 0.2 µL of dNTP (10 mM), 0.2 µL of Taq enzyme (5 U / μl), 1 µL of DNA template, and 10.1 µL of ddH2O. The PCR amplification program was as follows: 95°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 2 min, 33 cycles; 72°C repair extension for 7 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0041] 2.3 Bioinformatics analysis In order to further explore the physical and chemical properties, transmembrane region, secondary structure, tertiary structure, subcellular localization and interaction protein of the protein encoded by the gene, the Softberry website was used for gene structure prediction and ORF analysis; the ProtParamtool analysis of the ExPASy website was used. ZmMAPKKK17 The physicochemical properties and primary structure of the gene-encoded protein were analyzed; its hydrophilicity and hydrophobicity were predicted using the online tool ProtScale on the ExPASy website; its subcellular localization was predicted using the LocTREE3 website; its secondary structure was predicted using the NPSA-PRABI online software; the tertiary structure, protein interaction and GO analysis were predicted using the Uniprot online software; its protein transmembrane domain was found using TMHMM 2.0; and its protein was selected in the NCBI database. ZmMAPKKK17 The homologous sequences of different species with high homology were downloaded and the phylogenetic tree was constructed using the Neighbor-Joining method in MEGA11 software.

[0042] 3. Results and Analysis 3.1 ZmMAPKKK17 Gene cloning and identification The PCR amplification products were separated by 1% agarose gel electrophoresis, and a specific band of about 1000 bp was obtained ( Picture 1 The target fragment was recovered, connected, and transformed, and the positive single clone was selected for sequencing. The sequencing results showed that the gene contained 1 exon, no intron, and the open reading frame length was 1134bp, encoding a total of 377 amino acids, proving that the gene was successfully cloned. ZmMAPKKK17 Gene.

[0043] 3.2 ZmMAPKKK17 Gene phylogenetic tree analysis The BLAST search was performed on the NCBI website. ZmMAPKKK17 The amino acid sequences of proteins homologous to other plants were analyzed. The results showed that there were 100 proteins with the same sequence. ZmMAPKKK17 The protein sequences are highly similar. Among them, 27 homologous proteins from different plants (sequence identity greater than 60%) were selected for sequence alignment and phylogenetic tree analysis using MEGA software. The results showed that ZmMAPKKK17 Egg white and Miscanthus quinquefolius LOC136455008 ) and sorghum ( LOC8068066) Belong to the same branch ( Picture 2 ), ZmMAPKKK17 and LOC136455008 The homology reached 88.31%. LOC8068066 The homology of the two strains is as high as 83.14%, indicating that they are closely related.

[0044] 4. ZmMAPKKK17 Analysis of expression patterns in maize In this example, the cold-tolerant maize inbred line B144 was used as the experimental material. The seeds were placed in a culture dish for germination. After the roots and buds grew out, they were treated at low temperature (5°C). The roots and buds of the maize seedlings were selected after 0, 2, 4, 6, 8, 10, 12, 24, 36, and 48 h of treatment, and were quickly placed in liquid nitrogen and stored at -80°C for RNA extraction. ZmMAPKKK17 qRT-PCR expression analysis in roots and shoots.

[0045] ZmMAPKKK17 The results of gene expression in different tissues under low temperature stress showed that the gene was expressed in both roots and shoots during the germination period of corn. ZmMAPKKK17 The gene was expressed under low temperature stress and the results showed that the gene could be upregulated in response to low temperature stress. In the root, the expression of the gene under low temperature stress was 16.56 times that of the control ( Picture 3 ), in the buds, the expression level of this gene under low temperature stress was 2.17 times that of the control ( Picture 4), indicating that the gene is mainly expressed specifically in root tissue. ZmMAPKKK17 The gene is highly expressed in the root system and actively responds to low temperature stress, but its specific function and mode of action need further verification.

[0046] 5. ZmMAPKKK17 Subcellular localization analysis The experimental material was B73 corn leaves. ZmMAPKKK17 -linker-osgfp transformed maize protoplasts, the results are as follows Picture 5A and Picture 5B As shown, the fluorescence signal of the control group is evenly distributed throughout the protoplasts, while the fluorescence signal of the experimental group shows a large fluorescence aggregation. ZmMAPKKK17 The protein is localized in the cell nucleus.

[0047] Example 2 ZmMAPKKK17 Obtaining transgenic plants 1 Test materials 1.1 Plant materials The maize recipient material used for maize genetic transformation was B104.

[0048] 1.2 Strains and vectors Escherichia coli DH5α competent cells, Agrobacterium Agl0 competent cells.

[0049] The vector maps of overexpression vectors and CRISPR / Cas9 knockout vectors are as follows: Picture 6A and Picture 6B shown.

[0050] Overexpression vector p3301 (Beijing Bomeixingao Technology Co., Ltd.), knockout vector pos sas9 (Beijing Bomeixingao Technology Co., Ltd.). sgRNA sequences are as follows: sgRNA-1: CCCGCGGCCTTGACCGTCAAGAGG sgRNA-2: CGTACACGCGAGACATCACGCGG sgRNA-3:TTCGCTGCCGTCCACAAGATTGG The three sequences of sgRNA-1, sgRNA-2, and sgRNA-3 were connected in series and then inserted into the knockout vector pos sas9 for editing the target gene ZmMAPKKK17 .

[0051] 2. Test methods 2.1 Primer sequence information (1) Primer sequences used for overexpression vector construction F:ACTAGGGTCTCGCACCATGGACGCCTCCGTGGCGAA R:ACTAGGGTCCTACCGTCATGTAGCAAATGCACTGCGGCCTTC UBI-F:TTAGCCCTGCCTTCATACGC NOS-R:ATCATCGCAAGACCGGCAAC (2) Primer sequences used for knockout vector construction Primers for amplifying the sgRNA expression cassette: Cas-9-gRT1:CCGCGGCCTTGACCGTCAAGgttttagagctagaaat Cas-9-OsU6aT1:CTTGACGTCAAGGCCGCGGCggcagccaagccagca Cas-9-gRT2:CGTACACGCGAGACATCACGgttttagagctagaaat Cas-9-OsU6bT2:CGTGATGTCTCGCGTGTACGCaacacaagcggcagc Cas-9-gRT3:TTCGCTGCCGTCCACAAGATgttttagagctagaaat Cas-9-OsU3T3:ATCTTGTGGACGGCAGCGAATgccacggatcatctgc UF:CTCCGTTTTACCTGTGGAATCG gRNA-R::CGGAGGAAAATTCCATCCAC Pps-R:TTCAGAggtctcT accgACTAGTATGGAATCGGGCAGCAAAGG Pgs-L:AGCGTGggtctcG ctcg ACGCGTATCCATCCACTCCAAGCTC SP-L:GCGGTGTCATCTATGTTACTAG SP-R:TGCAATAACTTCGTATAGGC 2.2 Construction of plant overexpression vector 2.2.1 Amplification and recovery of target fragments The PCR reaction system was as follows: 2× PCR buffer 25µl, 2mM dNTPs 10µl, upstream and downstream primers 1µl each, 10 µmol / L KOD-FX 1µl, cDNA template 1µl, and finally water was added to make up to 50µl.

[0052] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 62°C for 30 sec, extension at 68°C for 90 sec, 32 cycles, and final extension at 68°C for 5 min.

[0053] Cut out the 1134 bp electrophoresis fragment and use an agarose gel DNA recovery kit (DP209-03) to recover the target fragment; follow the instructions of the kit.

[0054] 2.2.2 Enzyme digestion and ligation reaction The extracted plasmid was connected to the expression vector through LR reaction. The connection system is shown in Table 2. The reaction program was 37℃5min, 20℃5min, 15 cycles.

[0055] Table 2 Enzyme digestion and ligation reaction (overexpression vector) 2.2.3 Transformation of E. coli competent cells (1) Take a tube of 100 μL of DH5a competent E. coli cells and mix with 2-5 μL of ligation product and incubate on ice for 30 minutes; (2) Rapidly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and ice bath for 2 minutes; (3) Add 500 μL LB liquid medium and mix well; (4) Incubate at 37°C and 200 rpm for 45 min to allow the cells to return to normal growth. (5) Spread the bacterial solution evenly on a Kana-resistant LB solid medium plate; (6) After 30 min, place the culture in a 37°C incubator and culture overnight.

[0056] (7) Conduct colony PCR testing and pick out the positive plaques detected for bacterial shaking.

[0057] The colony PCR amplification system is as follows: 2×Taq MIX: 10ul, UBI-F primer 0.5ul, NOS-R primer 0.5ul, pick a small amount of colonies and add water to make up to 20ul.

[0058] The colony PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 90 sec, 25 cycles, and final extension at 72°C for 5 min.

[0059] 2.2.4 Plasmid extraction and sequencing verification of positive bacterial fluid The plasmid extracted from the positive plaque was subjected to Sanger sequencing using sequencing primers NOS-R / UBI-F. If the sequencing result sequence was consistent with the target fragment sequence, the overexpression vector was successfully constructed.

[0060] 2.3 Construction of plant CRISPR / Cas9 knockout vector 2.3.1 Overlap PCR and nested PCR amplification of sgRNA expression cassettes (1) First round of PCR amplification of U6 promoter and gRNA The pU6 amplification system was as follows: 2×Pfu MIX 5ul, UF primer 0.2ul, OsU6aT1 primer 0.2ul, OsU6a template 0.1ul, and ddH2O was added to make the volume to 10ul.

[0061] The gRNA amplification system is as follows: 2×Pfu MIX 5ul, gRNA-R primer 0.2ul, gRT1 primer: 0.2ul, sgRNA template: 0.1ul, add ddH2O to make up to 10ul.

[0062] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 20 sec, annealing at 55°C for 20 sec, extension at 72°C for 20 sec, 32 cycles, and final extension at 72°C for 5 min.

[0063] (2) Second round of PCR amplification of sgRNA expression cassette The sgRNA expression cassette amplification system is as follows: 2×Pfu MIX 25ul, Pps-R primer 1ul, Pgs-L primer 1ul, first-round pU6 product 0.5ul, first-round gRNA product 0.5ul, add ddH2O to make up to 50ul.

[0064] PCR reaction conditions were the same as above.

[0065] Cut out the 500-600 bp electrophoresis fragment and use a gel recovery kit to recover the target fragment; follow the instructions of the kit.

[0066] 2.3.2 Enzyme digestion and ligation reaction The extracted plasmid was connected to the expression vector through LR reaction. The connection system is shown in Table 3. The reaction program was 37℃5min, 20℃5min, 15 cycles.

[0067] Table 3 Restriction digestion and ligation reaction (knockout vector) 2.3.3 Competent transformation of E. coli and PCR detection The steps of recombinant plasmid transformation and colony PCR detection are the same as above. Colony PCR detection is performed using primer pair SP-L / SP-R, and the positive plaques detected are picked and shaken.

[0068] 2.3.4 Plasmid extraction and sequencing verification of expression vector positive bacterial solution 2.4 Agrobacterium-mediated transformation of maize B104 The specific conversion steps are as follows: (1) Harvest the young ears of corn 8-12 days after pollination. The young embryos in the young ears should be at the normal development stage, 1.0-1.5mm, and milky white.

[0069] (2) Remove the young ear husks, separate the corn kernels, and use a scalpel blade to cut off the top tissue of the corn kernels; insert the scalpel blade into the exposed endosperm to separate the young embryo.

[0070] (3) During the collection process, place the cells in a 3M mannitol hypertonic culture medium at room temperature for about 2 hours, then soak them in 2.0 ml LS-inf, wash them twice, and remove the culture medium for later use.

[0071] (4) Cultivate the Agrobacterium containing the target plasmid in YP liquid medium containing the corresponding antibiotics and culture it in the dark at 28°C with shaking for 12-16 hours.

[0072] (5) Collect the cells at 5000 rpm for 5-8 min and suspend them in an appropriate amount of LS-inf-AS medium to a concentration of 1×10 7 cells / ml, i.e. OD 600 It is about 0.3, and the liquid is prepared before use.

[0073] (6) Remove the culture medium from the material, add 1.5 ml of Agrobacterium infection solution, shake evenly and gently for 30 seconds, and place at room temperature for 5 minutes.

[0074] (7) Transfer the suspended embryos and bacterial solution to an empty plate, absorb 0.7 ml of Agrobacterium infection solution, and then absorb the remaining bacterial solution with sterile filter paper.

[0075] (8) Transfer the infected embryos to the newly prepared LS-AS medium with the scutellum facing upwards. Cover the culture dish with sealing film and culture the infected material in the dark at 25°C for 3 days.

[0076] (9) Transfer the embryos to LSD1.5A medium, 25 embryos per dish, and cover the dish with sealing film. Incubate in the dark at 28℃ for 10 days as the first round of screening.

[0077] (10) Transfer the embryos to LSD1.5B medium, 25 embryos per dish, and cover the dish with sealing film. Incubate in the dark at 28°C for 14 days as the second round of screening.

[0078] (11) Cut off the type I callus from the scutellum, the size of which is 3-5 mm, and transfer the embryos to LSD1.5B medium, 25 pieces / dish, and cover the culture dish with sealing film. Culture in the dark at 28℃ for 14 days as the third round of screening.

[0079] (12) Cut the callus from (11) to a size of 2-3 mm, transfer the embryos to LSZ medium, 25 pieces / dish, cover the culture dish with sealing film, and culture at 25℃ in the light for 14 days.

[0080] (13) Transfer the regenerated seedlings to LSF medium, seal with a plastic cap, and culture at 25°C in the light for 14 days.

[0081] (14) Transfer the regenerated plants to flower pots and add appropriate amount of soil. Plant the transgenic seedlings in a greenhouse, grow them for 3-4 months, and harvest the seeds.

[0082] 2.5 Physiological and biochemical analysis of transgenic plants (1) Prepare transgenic corn materials that have grown to the three-leaf, one-heart stage.

[0083] (2) Control treatment: 25℃, 24h; low temperature treatment: 4℃, 24h.

[0084] (3) Weigh 0.1 g of leaves, add the extract and place in a mortar for homogenization in an ice bath. Centrifuge for 10 minutes, take the supernatant and place on ice for testing.

[0085] (4) Use plant SOD, POD, and MDA assay kits to measure absorbance. For detailed steps, refer to their instructions. Use a portable chlorophyll meter to measure the chlorophyll content of corn leaves. After the results are measured, perform a significance analysis.

[0086] 3. Results and Analysis 3.1 Obtaining transgenic plant lines The genetic transformation of B104 was carried out by Agrobacterium-mediated transformation, which was divided into infection stage (A), screening stage (B), differentiation stage (C), emergence stage (D), rooting stage (E and F) and field stage (G and H). The pictures of each stage are shown in Figure 1. Picture 7 shown.

[0087] 3.2 Molecular Detection of Genetically Modified Corn Materials DNA was extracted from the harvested transgenic corn kernels, and the corn endosperm was taken to detect whether the corn kernels were positive transgenic materials through PCR. The electrophoresis results of some plants were as follows: Picture 8 The results showed that most of the tested corn materials were positive transgenic materials (with bands), a small number were negative materials (without bands), and the bands of some materials were fuzzy and needed further verification.

[0088] 3.3 Physiological and biochemical analysis of cold resistance in transgenic maize Under low temperature stress, SOD, POD and chlorophyll contents showed a downward trend, while MDA showed an upward trend. Under low temperature stress, compared with transgenic negative materials, transgenic positive materials have better cold tolerance. Picture 9 .

[0089] We successfully obtained overexpression and gene knockout transgenic maize plants by Agrobacterium-mediated genetic transformation of maize. Bar Gene molecular detection was used to screen out positive transgenic materials and negative transgenic materials, and the cold resistance function was identified. Under low temperature stress, the germination rate of the overexpression strain was significantly higher than that of the wild type ( Picture 10 The results showed that the germination rate of the overexpression strain was 85%, while that of the wild type was 60%). By measuring various physiological and biochemical indicators under low temperature stress, the SOD, POD and chlorophyll content of the overexpression strain were significantly higher than those of the wild type material, indicating that the overexpression strain has a higher tolerance to cold.

[0090] ZmMAPKKK17 Chilling tolerance of gene knockout transgenic maize materials under low temperature stress Picture 11 .

[0091] Example 3 Screening of corn using yeast two-hybrid technology ZmMAPKKK17 Interacting Protein As a molecular biology technique, the yeast two-hybrid system has the advantages of being powerful and widely used. It is currently mainly used to study the interaction between proteins in biological cells. As one of the largest members of plant protein kinases, MAPKKK family genes play a key role in plant growth and development, defense response, and stress response. ZmMAPKKK17Protein-protein interactions are important for elucidating ZmMAPKKK17 Regulating the growth and development mechanism of corn is of great significance.

[0092] 1. Test Materials The yeast strain was AH109, ​​and the yeast two-hybrid bait vectors were pGBKT7, pGADT7, pGBKT7-laminC, and pGADT7-largeT.

[0093] 2. Test methods 2.1 pGBKT7- ZmMAPKKK17 Bait vector construction ZmMAPKKK17 After synthesis, it was constructed into the pGBKT7 vector, and subsequent experiments were performed after correct sequencing.

[0094] 2.2 Self-activation detection of bait genes Yeast transformation: Transform various plasmids into recipient bacteria AH109 and observe the results. See Table 4 for yeast transformation reaction types.

[0095] Table 4 Yeast transformation reaction types 3. Results and Analysis The present invention obtained the ZmMAPKKK17 The 25 interacting encoded proteins were protein phosphokinase PP2C, maize DnaJA6 protein, heat shock protein, NAC transcription factor, protein kinase, serine / threonine protein phosphatase PP2A, chaperone protein, etc. By consulting the literature, we screened out 4 proteins related to plant stress response, namely maize protein phosphokinase, NAC transcription factor, protein kinase and serine / threonine protein phosphatase to further verify the protein interaction relationship in vivo and in vitro. ZmMAPKKK17 The interacting proteins are mined and analyzed to lay the foundation for in-depth research on the molecular mechanism and metabolic network of corn signal transduction pathways.

[0096] Example 4 ZmMAPKKK17 Interacting protein verification In this example, GST pull-down, co-immunoprecipitation (Co-IP) and bimolecular fluorescence complementation (BiFC) techniques were used to verify and detect the interactions between different proteins. ZmMAPKKK17 The protein interacts with other proteins, providing support for further experiments.

[0097] 1. Pull-Down Experiment The results showed that GST- ZmMAPKKK17Protein interactions with His-NM_00139903, His-XM_03596374, and His-NM_00115914, GST- ZmMAPKKK17 There was no interaction with His-XM_00865020.

[0098] 2. Co-IP Experiment Through the Pull-Down experiment, we found that 3 genes interacted with the target gene, and further used Co-IP technology to verify the protein interaction. The prey protein + empty tag was the control group, and the prey protein + bait protein was the experimental group. The prey protein signal was detected in the experimental group of the IP group, but not in the control group, indicating that the two interacted. ZmMAPKKK17 and LOC542176 , LOC118474710 , LOC100286253 There are protein interactions.

[0099] 3. BiFC Experimental Results Through Pull-Down and Co-IP experiments, we confirmed ZmMAPKKK17 and LOC542176 , LOC118474710 , LOC100286253 BiFC experiments were further used to verify that the ZmMAPKKK17 and LOC100286253 The two genes interact with each other and may be localized in the nucleus and cytoplasm, but the expression effect is weak; ZmMAPKKK17 and LOC542176 There is interaction, the interaction location may be in the nucleus and cytoplasm, and the interaction strength is strong; ZmMAPKKK17 and LOC118474710 There is an interaction between the two genes, which may be located in the cell nuclear region, and the expression effect is general.

[0100] This example uses GST pull-down, co-immunoprecipitation (Co-IP) and bimolecular fluorescence complementation (BiFC) techniques to verify ZmMAPKKK17 and protein kinase ( LOC100286253), Zea mays protein phosphokinase PP2C ( LOC542176) and maize NAC transcription factor ( LOC118474710) There is a protein interaction relationship. Among them, protein phosphatase 2C (PP2C) is an important member of protein phosphatases, which can regulate the life activities of eukaryotic cells. Studies have shown that PP2C is involved in plant resistance to low temperature stress, and overexpression of corn in tobacco ZmPP2C2 The strains of Phenylaceae had higher germination rate, germination speed and antioxidant enzyme activity under low temperature stress, which enhanced the tolerance to cold stress. ZmPP2C2It is a positive regulatory factor for plant resistance to low temperature stress. In addition, PP2Cs can also play a role in drought stress through MAPK signaling. The F subfamily members in maize ZmPP84 By dephosphorylation ZmMEK1 ,inhibition Zm-MEK1-Zm-SIMK1 Signaling pathway that negatively regulates stomatal closure and drought stress. OsSIPP2C1 It is a PP2C protein involved in abiotic stress and early ear development, and can respond to salt and drought stress. ZmPP2C-A The expression of NAC is strongly induced by various stresses (such as drought, temperature, salt and ABA), and is expressed in large quantities under these stresses, thereby reducing water loss, reducing proline accumulation, and improving plant survival. The NAC transcription factor family is one of the largest plant-specific transcription factor families, regulating plant growth and development and stress response by affecting the transcription level of target genes. Some NAC genes related to abiotic stress have been found in corn, and overexpression ZmSNAC13 It will promote the expression of genes such as PYL9 and DREB3, thereby enhancing the drought and salt tolerance of Arabidopsis. ZmNAC55 The expression of ZmNAC55 It can improve the cold resistance and drought resistance of Arabidopsis. ZmNAC111 Drought resistance of maize can be enhanced by upregulating the expression of drought stress-related genes. It can be seen that NAC transcription factors and protein phosphatases play important functions in plant growth and development and response to biotic or abiotic stress.

[0101] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Corn ZmMAPKKK17 The application of genes in improving plant tolerance to cold stress; Said ZmMAPKKK17 The gene is a gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The plants include corn.

3. A method for improving cold tolerance of plants, characterized in that: The method comprises: using genetic engineering means to overexpress in plants ZmMAPKKK17 Gene; Said ZmMAPKKK17 The gene is the same as the gene described in claim 1.

4. The method according to claim 3, characterized in that The overexpression method is selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) By introducing enhancers.

5. The method according to claim 3 or 4, characterized in that: The plants include corn.

6. The method according to claim 5, characterized in that The Agrobacterium-mediated method was used to ZmMAPKKK17 The gene was transferred into corn plants to obtain ZmMAPKKK17 Transgenic plants with overexpressed genes.

7. Use of the transgenic plant obtained by the method according to any one of claims 3 to 6 in plant breeding.

8. The use according to claim 7, characterized in that: Breeding methods include transgenic, hybridization, backcrossing, selfing or asexual reproduction.

Images