Gene loop for gene activation and inhibition control in escherichia coli and bacillus subtilis

Abstract

The invention discloses a gene loop for gene activation and inhibition control in escherichia coli and bacillus subtilis, and belongs to the technical field of gene engineering. The gene loop is composed of two parts: (1) an activation module: integrating T7RNAP controlled by a dehydrated tetracycline inducible promoter Pet and a repressor protein expression cassette corresponding to the inducible promoter on a genome to obtain a chassis strain stably expressing T7RNAP; the module is used for driving a promoter PT7t to efficiently express a gene needing to be activated; (2) an inhibition module: integrating dCpf1 controlled by Pet on the basis of a chassis strain; meanwhile, Pet is used for expressing a crRNA array, and when dCpf1 and crRNA exist at the same time, transcription inhibition of the gene can be achieved. The gene loop constructed by the invention can simultaneously control activation and inhibition of genes, realizes high-efficiency expression and complete inhibition of different genes, shows an excellent effect in production of lycopene, and has important significance in construction of escherichia coli and bacillus subtilis cell factories and research of synthetic biology.

Description

Technical Field

[0001] The invention relates to a gene circuit for controlling gene activation and inhibition in Escherichia coli and Bacillus subtilis, belonging to the technical field of genetic engineering. Background Art

[0002] Escherichia coli and Bacillus subtilis have been used as model microorganisms for studying Gram-negative and Gram-positive bacteria with their clear genetic background and mature gene manipulation technology, and have shown wide application potential in industrial biotechnology. E. coli is widely used in recombinant protein expression and metabolite production due to its short growth cycle and ability to efficiently produce target products under different conditions. B. subtilis is widely used in the production of enzyme preparations and other fermentation products due to its excellent protein secretion ability, susceptibility to bacteriophage infection, lack of endotoxin production and adaptability to complex culture media. In the construction of Escherichia coli and Bacillus subtilis cell factories, the commonly used metabolic engineering transformation strategy is to overexpress key genes or knock out competing pathways and branch pathways to enhance the desired metabolic flow and improve the yield of the target product.

[0003] The T7 expression system is an important expression system in the overexpression strategy. The T7 expression system consists of T7 RNA polymerase (T7 RNAP) derived from T7 bacteriophage and its corresponding T7 promoter. T7 RNAP has high specificity for T7 promoter and does not act on the native promoter of the host, or even on the similar bacteriophage T3 promoter; moreover, its extension speed is about 5 times faster than that of the endogenous RNA polymerase of Escherichia coli. In addition, the T7 promoter can produce very long transcripts, which is conducive to the expression of polycistronic genes, especially some gene clusters of natural products. In addition, operators (such as lacO) can be inserted into the T7 promoter to induce the transcription of the target gene. The T7 expression system has been applied to various hosts and even cell-free systems due to its simple genetic composition, high promoter specificity and good controllability.

[0004] The CRISPR-Cas (clustered regularly interspaced short palindromic repeats and CRISPR-associated proteins) system is widely used for gene transcription regulation. After the DNA enzyme of Cas9 or Cpf1 is inactivated, dCas9 or dCpf1 is obtained, which no longer has the ability to cut DNA, but can still bind to the genome under the guidance of sgRNA or crRNA, so that the steric hindrance on the genome can be used to prevent RNA polymerase from passing through, thereby weakening the transcription process; after the transcription factor with transcription activation effect is fused to dCas9, it can be targeted to the promoter under the guidance of sgRNA, so that more RNA polymerase can be recruited to enhance (activate) transcription. In addition, studies have shown that after the DNA enzyme of Cpf1 is inactivated, it still has RNA enzyme activity, so the transcription activation or inhibition of multiple genes can also be achieved through a crRNA array.

[0005] At present, there are many systems for gene activation or inhibition control in Escherichia coli and Bacillus subtilis, but gene activation or inhibition control alone cannot meet the needs of metabolic engineering, and the activation intensity and inhibition intensity do not meet the target requirements. The commonly used gene simultaneous activation and inhibition systems are the systems that combine CRISPRa and CRISPRi. The effect of the CRISPRa activation system is limited by the activated promoter target, and the activation effect is not strong, which limits its practical application in metabolic engineering. Summary of the invention

[0006] To solve the above problems, the present invention provides a gene circuit for gene activation and inhibition control in Escherichia coli and Bacillus subtilis. The gene circuit consists of an activation module and an inhibition module, the activation module is a dehydrated tetracycline-induced T7 expression system, and the inhibition module is a dehydrated tetracycline-induced CRISPRi system. Due to the rigor of the dehydrated tetracycline-induced expression system, when dehydrated tetracycline is not added, the gene circuit is in a silent state and has no effect on the growth and metabolism of cells; after adding dehydrated tetracycline, the efficient transcription of T7 RNAP realizes the activation expression of the gene, and the efficient inhibition of CRISPRi realizes the transcription inhibition of the gene. The gene circuit can realize the expression regulation of multiple genes with a single signal input.

[0007] The first object of the present invention is to provide a gene circuit for realizing gene activation and inhibition control at the same time, comprising an activation module, an inhibition module and a target gene module.

[0008] The activation module contains a tetracycline repressor protein (tetR) expression cassette and an inducible promoter P tetregulated T7 RNA polymerase expression cassette,

[0009] The inhibition module contains a tetracycline repressor protein expression cassette and an inducible promoter P tet regulated dCpf1 or dCas9 expression cassette,

[0010] The target gene module contains a hybrid promoter P T7tet expression cassette and the inducible promoter P tet The crRNA or sgRNA expression cassette regulated by the hybrid promoter P T7tet The expression cassette is located upstream of at least one target gene to be activated, and the crRNA or sgRNA expression cassette specifically recognizes at least one target gene to be inhibited.

[0011] Furthermore, the activation module is located on a first vector, the inhibition module is located on a second vector, and the target gene module is located on a third vector, which are respectively used for integration into the genome or for free expression;

[0012] Preferably, the activation module and the inhibition module are located on the first vector and the second vector respectively for integration into the genome; the hybrid promoter P in the target gene module T7tet expression cassette and the inducible promoter P tet The regulated crRNA or sgRNA expression frame is located on the same vector or on different vectors, and is used to express the target gene and the guide element (the crRNA or sgRNA) or the hybrid promoter P T7tet The expression cassette is located on a third vector for integration into the genome, which is driven by an inducible promoter P tet The regulatory crRNA or sgRNA expression cassette is located on the fourth vector for free expression.

[0013] Further, when the hybrid promoter P T7tet expression cassette and the inducible promoter P tet When the regulated crRNA or sgRNA expression cassette is located on the same vector, the hybrid promoter P T7tet With inducible promoter P tet Reverse setting.

[0014] Furthermore, when multiple genes are involved in the inhibition regulation, the crRNA or sgRNA expression frame contains a crRNA or sgRNA array; when multiple genes are involved in the activation regulation, the recombinant plasmid is used to express the hybrid promoter P T7tet The different genes are then connected.

[0015] Furthermore, the sequence of the tetracycline repressor protein is shown in SEQ ID NO.10; the hybrid promoter PT7tet The sequence is shown in SEQ ID NO.11; the inducible promoter P tet The sequence is shown in SEQ ID NO.12.

[0016] Furthermore, the target gene to be activated is a key enzyme gene in the target product synthesis pathway, and the target gene to be inhibited is an enzyme gene in a competing pathway for the synthesis of the target product.

[0017] Furthermore, the target gene to be activated includes one or more of the following:

[0018] (1) Lycopene expression gene cluster crtEBI (gene cluster crtEBI is composed of synthesis-related pathway genes pyrophosphate synthase gene crtE, phytoene synthase gene crtB and phytoene dehydrogenase gene crtI),

[0019] (2) 1-deoxy-d-xylulose-5-phosphate synthase (DXS) gene,

[0020] (3) 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) gene,

[0021] (4) c-methyl-d-erythrose-4-phosphate cytidyltransferase (IspD) gene,

[0022] (5) 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase (IspF) gene,

[0023] (6) Type 2 isopentenyl diphosphate isomerase (Fni) gene.

[0024] Furthermore, the target gene to be inhibited includes the hepS gene.

[0025] Further, the NCBI accession number of the pyrophosphate synthase gene crtE is GenBank: AAA24819.1, the NCBI accession number of the phytoene synthase gene crtB is GenBank: AAA24820.1, the NCBI accession number of the phytoene dehydrogenase gene crtI is GenBank: AAA24821.1, the NCBI accession number of the 1-deoxy-d-xylulose-5-phosphate synthase (DXS) gene is GenBank: BAA12576.1, and the NCBI accession number of the 1-deoxy-d-xylulose-5-phosphate reducing isothiocyanate isomerase is GenBank: BAA12577.1. The NCBI accession number of the DXR gene is GenBank: CAB13528.2, the NCBI accession number of the c-methyl- d -erythrose-4-phosphate cytidyltransferase (IspD) gene is GenBank: AAA21794.1, the NCBI accession number of the 2-c-methyl- d -erythritol-2,4-cyclopyrophosphate synthase (IspF) gene is GenBank: AAA21795.1, and the NCBI accession number of the type 2 isopentenyl diphosphate isomerase (Fni) gene is GenBank: BAB32625.1.

[0026] Furthermore, the nucleotide sequence of the hepS gene is shown in SEQ ID NO.4.

[0027] Furthermore, the sequence of the crRNA used to inhibit the gene hepS is shown in SEQ ID NO.5.

[0028] Furthermore, the gene circuit can be used for the regulation of genes in Escherichia coli or Bacillus subtilis.

[0029] The second object of the present invention is to provide a recombinant strain, wherein the recombinant strain uses Escherichia coli or Bacillus subtilis as a host to introduce the gene circuit.

[0030] Further, the activation module or the inhibition module is integrated and expressed, and the hybrid promoter P is integrated and expressed or expressed in isolation. T7tet expression cassette or an inducible promoter P tet Regulated crRNA or sgRNA expression cassette;

[0031] The hybrid promoter P T7tet The expression cassette is then connected to the target gene to be activated or to the hybrid promoter P T7tet The expression cassette replaces the promoter in front of the target gene to be activated on the genome.

[0032] Furthermore, the activation module and the inhibition module are integrated into the host genome. Preferably, when the host is Escherichia coli, the activation module is integrated at the leuO site, and the inhibition module is integrated at the gsk site; when the host is Bacillus subtilis, the activation module is integrated at the ydjC site, and the inhibition module is integrated at the lacA site.

[0033] Further, when the host is Bacillus subtilis, the target gene module for free expression includes the recombinant plasmid pHT-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pHT-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 pHT01 was used as a template to connect P T7tet promoter, Riboj ribozyme and RBS, and the hybrid promoter P was set in reverse T7tet and the inducible promoter P tet The target gene gene1 to be activated is located at the promoter P T7tet Afterwards, the crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet After that. The carrier skeleton pHT-P T7tet The sequence of is shown in SEQ ID NO.8, and the sequence of RBS is shown in SEQ ID NO.15.

[0034] Further, when the host is Bacillus subtilis, the hybrid promoter P is integrated and expressed T7tet expression cassette, episomal expression is expressed by the inducible promoter P tet Regulated crRNA or sgRNA expression cassette, including recombinant plasmid pHT-P when expressed in free form tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pHT-P tet -crRNA gene2 / sgRNA gene2 pHT01 was used as a template to connect P tet The crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after.

[0035] Furthermore, when the host is Escherichia coli, the target gene module for free expression includes the recombinant plasmid pBBR-P T7tet -gene1-P tet -crRNAgene2 / sgRNA gene2 The recombinant plasmid pBBR-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 pBBR1MCS-2 plasmid was used as template to connect P T7tet promoter, Riboj ribozyme and RBS, and the hybrid promoter P was set in reverse T7tet and the inducible promoter P tet The target gene gene1 to be activated is located at the promoter P T7tet Afterwards, the crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet After that. The carrier skeleton pHT-P T7tet The sequence of is shown in SEQ ID NO.8, and the sequence of RBS is shown in SEQ ID NO.15.

[0036] Furthermore, when the host is Escherichia coli, the hybrid promoter P is integrated and expressed T7tet expression cassette, episomal expression is expressed by the inducible promoter P tet Regulated crRNA or sgRNA expression cassette, including recombinant plasmid pBBR-P when expressed in free form tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pBBR-P tet -crRNA gene2 / sgRNA gene2 pBBR1MCS-2 plasmid was used as template to connect P tet The crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after.

[0037] Furthermore, the recombinant strain is transformed as follows:

[0038] (i) integrating and expressing the activation module and the inhibition module,

[0039] (ii) Replace the promoter of the following gene on the genome with the hybrid promoter P T7tet :

[0040] 1-deoxy-d-xylulose-5-phosphate synthase (DXS) gene, 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) gene, c-methyl-d-erythrose-4-phosphate cytidyltransferase (IspD) gene, 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase (IspF) gene, isopentenyl diphosphate isomerase type 2 (Fni) gene,

[0041] (iii) Using a hybrid promoter P T7tet Free expression of lycopene expression gene cluster crtEBI,

[0042] (iv) Using an inducible promoter P tet The crRNA or sgRNA is expressed episomally, and the crRNA or sgRNA specifically recognizes the hepS gene.

[0043] Furthermore, the recombinant strain is transformed as follows:

[0044] (i) integrating and expressing the activation module and the inhibition module,

[0045] (ii) Replace all promoters of the ribDEAHT gene cluster on the genome with the hybrid promoter P T7tet ,

[0046] (iii) Using an inducible promoter P tet The crRNA or sgRNA is expressed episomally, and the crRNA or sgRNA specifically recognizes the ribC gene.

[0047] Furthermore, the nucleotide sequence of the ribC gene is shown in SEQ ID NO.6.

[0048] Furthermore, the sequence of the crRNA used to inhibit gene ribC is shown in SEQ ID NO.7.

[0049] Furthermore, the recombinant Bacillus subtilis uses B. subtilis G600 as a host strain, and the recombinant Escherichia coli uses E. coli K12 as a host strain.

[0050] The third object of the present invention is to provide application of the gene circuit or the recombinant strain in biosynthesis.

[0051] Furthermore, the biosynthesized products include lycopene (preferably) and riboflavin.

[0052] The fourth object of the present invention is to provide a method for producing lycopene, comprising the step of fermentation production using the recombinant strain.

[0053] Furthermore, the fermentation production includes: culturing the recombinant strain under suitable conditions, and the culture system includes the inducer tetracycline.

[0054] Furthermore, the recombinant strain is cultured in a seed culture medium to obtain a seed solution, and then the seed solution is inoculated into a fermentation culture medium for fermentation production.

[0055] Furthermore, the seed culture medium includes LB culture medium.

[0056] Furthermore, the fermentation medium includes TB medium.

[0057] A fifth object of the present invention is to provide a method for promoting biosynthesis of Bacillus subtilis or Escherichia coli, wherein the gene circuit is introduced into a starting strain of Bacillus subtilis or Escherichia coli.

[0058] Furthermore, the Bacillus subtilis or Escherichia coli starting bacteria are modified or unmodified strains.

[0059] Beneficial effects of the present invention:

[0060] The gene circuit for gene activation and inhibition control in Escherichia coli and Bacillus subtilis constructed by the present invention consists of two parts: (1) Activation module: The dehydrated tetracycline-inducible promoter P was integrated into the genomes of E. coli K12 and B. subtilis G600 respectively using the CRISPR / Cpf1 Bacillus subtilis multi-gene editing system. tet The T7 RNAP and the repressor protein expression cassette corresponding to the inducible promoter (P 21 -tetR*) to obtain chassis strains K12T7T and BST7T that stably express T7 RNAP; this module is used to drive the hybrid T7 promoter P T7tet (2) Inhibition module: Based on strains K12T7T and BST7T, P tet The strains K12T7Tt and BST7Tt were obtained by controlling dCpf1. tet When dCpf1 and crRNA are present at the same time, gene transcription inhibition can be achieved. In the absence of the inducer anhydrotetracycline, the activation and inhibition modules of the gene circuit are both in a silent state and have no effect on the growth and metabolism of the strain; when anhydrotetracycline is added, the activation module and the inhibition module function at the same time to achieve activation and inhibition control of the gene. vegThe expressed color fluorescent protein mScarlet3 was integrated into strains K12T7Tt and BST7Tt to obtain K12T7Tt-msc and BST7Tt-msc; superfolderGFP (sfGFP) was used as the activation gene to verify the function of the gene circuit. Finally, the gene circuit was applied to the production of lycopene in Bacillus subtilis. By activating the gene cluster crtEBI and the genes of 1-deoxy-d-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), c-methyl-d-erythrose-4-phosphate cytidyltransferase (IspD), 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase (IspF) and type 2 isopentenyl diphosphate isomerase (Fni) in the MEP pathway of lycopene synthesis pathway, and inhibiting hepS, 3.61 times of lycopene production was achieved compared with wild strains. The gene circuit for gene activation and inhibition control in Escherichia coli and Bacillus subtilis constructed by the present invention can control gene activation and inhibition simultaneously, and realize efficient expression and complete inhibition of different genes. It has important significance for the construction of Escherichia coli and Bacillus subtilis cell factories and synthetic biology research. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Schematic diagram of the genetic circuits controlling gene activation and repression in Escherichia coli and Bacillus subtilis.

[0062] Figure 2 Schematic diagram of the construction of CRISPR-related plasmids in Escherichia coli.

[0063] Figure 3 Schematic diagram of the construction of CRISPR-related plasmids in Bacillus subtilis.

[0064] Figure 4 Characterization of genetic circuits.

[0065] Figure 5 To characterize the lycopene metabolic pathway and the application of gene circuits to regulate lycopene production. DETAILED DESCRIPTION

[0066] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0067] The scheme involved in the present invention is as follows:

[0068] The present invention provides an activation module based on T7 RNAP ( Figure 1): This module was developed by integrating the anhydrotetracycline-inducible promoter P into the genomes of E. coli K12 and B. subtilis G600 using the CRISPR / Cpf1 E. coli and B. subtilis multi-gene editing systems. tet The T7 RNAP and the repressor protein expression cassette corresponding to the inducible promoter (P 21 -tetR*), namely P 21 -tetR*-P tet -T7 RNAP expression cassette, to obtain chassis strains K12T7T and BST7T that stably express T7 RNAP. This module is used to drive the hybrid T7 promoter P T7tet The expression of P T7tet Can be on the genome or plasmid (pBBR-P T7tet , pHT-P in Bacillus subtilis T7tet ) to efficiently express the target gene;

[0069] In one embodiment of the present invention, a CRISPR / Cpf1-based Bacillus subtilis multi-gene editing system is used to integrate genes in Escherichia coli and Bacillus subtilis. The system is described by Zhu et al. in Combining CRISPR–Cpf1 and Recombineering Facilitates Fast and Efficient Genome Editing in Escherichia coli. ACS Synthetic Biology, 2022 and Wu et al. in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817–1825.

[0070] In one embodiment of the present invention, E. coli K12 is a wild strain; B. subtilis G600 is a wild-type strain B. subtilis 168 in which six extracellular protease genes of the wild B. subtilis 168 strain are inactivated, has high conversion efficiency, and can effectively produce protein; the strain is described by Li et al. in A genetic toolkit for efficient production of secretory protein in Bacillus subtilis. Bioresource Technology, 2022.

[0071] In one embodiment of the present invention, the Genbank accession number of T7 RNAP is NC_001604.1, the amino acid sequence thereof is shown as SEQ ID NO.9, and the amino acid sequence of tetR* is shown as SEQ ID NO.10.

[0072] In one embodiment of the present invention, the plasmid required to integrate the T7 RNAP expression cassette using the CRISPR / Cpf1 Escherichia coli and Bacillus subtilis multi-gene editing system is as follows: 21 -tetR*-P tet -T7 RNAP expression cassette pcrEG-S1-T7RNAP and pcrF19-S1-T7RNAP. They are respectively formed by connecting pcrEG and pcrF19NM2 vectors with genomic homologous fragments.

[0073] In one embodiment of the present invention, the above plasmids are transformed into E. coli K12 and B. subtilis G600, respectively, using the methods described in the CRISPR / Cpf1 Escherichia coli and Bacillus subtilis multi-gene editing systems to obtain engineered strains K12T7T and BST7T.

[0074] In one embodiment of the present invention, the specific steps of the method are as follows:

[0075] 1. First, construct crRNA plasmids of different integration plasmids, use primer annealing to obtain small crRNA fragments, and then use T4 ligase to connect to pcrEG and pcrF19NM2 plasmids to obtain pcrEG-cr-S1 and pcrF19-cr-S1, respectively.

[0076] 2. Connect the expression frame of the gene to be edited and the genomic homologous fragment to the vectors pcrEG-cr-S1 and pcrF19-cr-S1 respectively to obtain 21 -tetR*-P tet -T7 RNAP expression cassette containing EG-S1-T7 RNAP and PCR F19-S1-T7 RNAP.

[0077] 3. Transform the Cpf1 expression plasmids pEcCpf1 and pHT-xcR6 into E. coli K12 and B. subtilis G600, respectively, and prepare them into competent cells;

[0078] 4. The plasmids pcrEG-S1-T7RNAP and pcrF19-S1-T7RNAP in step 2 were respectively transferred into the competent cells in step 3. After successful integration, the plasmids were eliminated to obtain the engineered strains K12T7T and BST7T, respectively.

[0079] The expression plasmids in Escherichia coli and Bacillus subtilis were pBBR-P T7tet and pHT-P T7tet , the plasmids all carry a hybrid T7 promoter P T7tet , which is specifically recognized by T7 RNAP T7 The nucleotide sequence of the tetO operon is shown in SEQ ID NO.11. T7tet Both were inhibited by the constitutively expressed repressor protein, and the double inhibition reduced the leaky expression of the system. After adding the inducer anhydrotetracycline, P T7tet Driven by its specific T7 RNAP, the target gene is highly expressed.

[0080] The present invention provides an activation and inhibition module ( Figure 1 ): This module is integrated into the genome of strains K12T7T and BST7T. tet (SEQ ID NO.12) controlled by dCpf1 and the repressor protein expression cassette corresponding to the inducible promoter (P 21 -tetR*), namely P 21 -tetR*-P tet -dCpf1 expression cassette, and the chassis strains K12T7Tt and BST7Tt that stably express dCpf1 were obtained. The crRNA array was prepared by P tet Control, reverse connection in pBBR-P T7tet and pHT-P T7tet The plasmid pBBR-P T7tet -P tet -cr and pHT-P T7tet -P tet -cr. The simultaneous expression of dCpf1 and crRNA arrays in this module can achieve gene repression.

[0081] In one embodiment of the present invention, the plasmid required to integrate the dCpf1 expression cassette using the CRISPR / Cpf1 Escherichia coli and Bacillus subtilis multi-gene editing system is: 21 -tetR*-P tet pcrEG-S2-dCpf1 and pcrF19-S2-dCpf1 containing -dCpf1 expression cassettes. They were formed by connecting pcrEG and pcrF19NM2 vectors with genomic homologous fragments, respectively.

[0082] In one embodiment of the present invention, the above plasmids are transformed into K12T7T and BST7T respectively using the method described in the CRISPR / Cpf1 Escherichia coli and Bacillus subtilis multi-gene editing system to obtain engineered strains K12T7Tt and BST7Tt. The specific steps of the method are the same as above.

[0083] Characterization of the gene circuit for gene activation and inhibition control in Escherichia coli and Bacillus subtilis in the present invention: This characterization method uses green fluorescent protein sfGFP as an activation gene and red fluorescent protein mScarlet3 as a repression gene to verify the fluorescence expression of cells under conditions without and with the addition of dehydrotetracycline.

[0084] In one embodiment of the present invention, a constitutive promoter P is used. veg Drive its expression, P veg -mScarlet3 expression cassette was integrated into K12T7Tt and BST7Tt, respectively, to obtain strains K12T7Tt-msc and BST7Tt-msc.

[0085] In one embodiment of the present invention, the plasmid required for integrating mScarlet3 using the CRISPR / Cpf1 Escherichia coli and Bacillus subtilis multi-gene editing system is: veg -mScarlet3 expression cassettes, pcrEG-S3-mScarlet3 and pcrF19-S3-mScarlet3, which are formed by connecting pcrEG and pcrF19NM2 vectors with genomic homologous fragments, respectively.

[0086] In one embodiment of the present invention, the Genbank accession number of the sfGFP is BAP77013.1. sfGFP is connected to pBBR-P T7tet -P tet -cr and pHT-P T7tet -P tet -cr, obtain pBBR-P T7tet -sfGFP-P tet -cr and pHT-P T7tet -sfGFP-P tet -cr, used for activation verification; on this basis, the crRNA sequence of mScarlet3 was added, and three different crDNAs were selected to obtain the plasmid pBBR-P T7tet -sfGFP-P tet -cr-(1-3) and pHT-P T7tet -sfGFP-P tet -cr-(1-3).

[0087] In one embodiment of the present invention, pBBR-P T7tet -sfGFP-P tet -cr-(1-3) and pHT-P T7tet -sfGFP-P tet -cr-(1-3) were transformed into strains K12T7Tt-msc and BST7Tt-msc, respectively; they were then cultured in liquid culture medium without anhydrotetracycline and in liquid culture medium with 0.5uM anhydrotetracycline, respectively, and their fluorescence expression intensity was detected after 24 hours.

[0088] The present invention provides a method for regulating the synthesis of metabolites in Bacillus subtilis using a gene circuit for gene activation and inhibition control. The metabolite is lycopene, an endogenous metabolite of Bacillus subtilis, and the regulation method includes replacing the promoter of the metabolite synthesis gene on the genome to achieve its activation expression regulation and using a plasmid to express crRNA targeting different genes to achieve inhibition and regulation expression.

[0089] In one embodiment of the present invention, the genes of 1-deoxy-d-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), c-methyl-d-erythrose-4-phosphate cytidyltransferase (IspD), 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase (IspF) and type 2 isopentenyl diphosphate isomerase (Fni) that activate the MEP pathway in lycopene synthesis, and the exogenous lycopene expression gene cluster crtEIB are introduced, which uses the engineered strain BST7Tt as the starting strain, replaces the promoters of dxS, dxR, ispDF, fni with P T7tet , and use P T7tet The gene cluster crtEIB was expressed, and the inhibition module was used to inhibit hepS to achieve the expression of lycopene. The integration plasmid used was pcrF19-P T7tet -dxS, pcrF19-P T7tet -dxR, pcrF19-P T7tet -ispDF, pcrF19-P T7tet -fni, the expression plasmid is pHT-P T7tet -crtEIB and pHT-P T7tet -crtEIB-P tet -cr-hepS integrated lycopene production strains were L1 to L11 (e.g. Figure 5 B).

[0090] The invention relates to the application of the gene circuit for gene activation and inhibition control in the regulation of metabolite synthesis in Bacillus subtilis. The method comprises culturing the genetically engineered bacteria under suitable conditions and detecting the yield of the products therein.

[0091] The materials and methods involved in the present invention are as follows:

[0092] (I) Strains and vectors

[0093] Plasmid construction was carried out in E. coli DH5α, and the constructed plasmids were transformed into E. coli K12 and B. subtilis G600 for integration. The vectors pEcCpf1, pcrEG, pHT-xcR6 and pcrF19NM2 used were described by Zhu et al. in Combining CRISPR–Cpf1 and Recombineering Facilitates Fast and Efficient Genome Editing in Escherichia coli. ACS Synthetic Biology, 2022 and Wu et al. in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817–1825. The vectors pHT-01 and pBBR1-MCS2 used were commercial plasmids.

[0094] (II) Culture medium

[0095] B. subtilis seeds and E. coli were cultured in LB medium (containing 10 g tryptone, 5 g yeast powder and 10 g NaCl per liter). TB medium (g / L): peptone 12, yeast powder 24, NaCl 10, 4 mL glycerol, 2.31 KH2PO4, 12.54 K2HPO4. Shake flask fermentation medium (g / L): glucose 85, tryptone 15, yeast powder 15, urea 6, glycerol 5, MgSO4·7H2O 3, K2HPO4·3H2O 12.5, KH2PO42.5. Glucose and MgSO4·7H2O need to be sterilized separately from other ingredients and added before inoculation.

[0096] (III) Fluorescence measurement

[0097] The relative fluorescence intensity of sfGFP was measured using the multifunctional microplate reader Cytation 3 (Berteng Instruments, Inc., USA) according to the method of Yang S, Liu Q, Zhang Y, et al. Construction and characterization of broad-spectrum promoters for synthetic biology [J]. ACS Synthetic Biology, 2018, 7 (1): 287–291.

[0098] (IV) Lycopene determination method

[0099] Sample treatment: Take 600 μL of bacterial solution, wash and resuspend, add 600 μL of ethyl acetate, ultrasonically disrupt, centrifuge at 12000×g for 8 minutes, aspirate the upper layer of ethyl acetate, dilute appropriately, pass through the membrane and enter the liquid phase bottle; after passing through the membrane, directly enter the liquid phase bottle. Liquid phase detection: CI8 column, injection 10 μL, column temperature 40℃, mobile phase acetonitrile: methanol: isopropanol = 5:3:2, flow rate 1.0 mL / min, detection time 30 minutes, UV absorption wavelength 474nm.

[0100] (V) Riboflavin determination method

[0101] 200 μL of the fermentation culture was added to 800 μL of 0.05 M NaOH. After centrifugation at 10,000 × g for 2 minutes, the supernatant was collected and diluted with 0.1 M acetic acid-sodium acetate buffer (pH 4.42). Subsequently, the absorption at 444 nm was measured. The riboflavin concentration was calculated using the standard equation: Y = (OD444-0.0203) × DF / 0.0163 (R 2 =0.9997; OD444, absorbance at 444nm; Y, riboflavin concentration (mg / L); DF, dilution factor; after dilution, OD444 was controlled within the range of 0.1 to 0.8).

[0102] Example 1: Construction of CRISPR plasmids in gene circuits

[0103] Zhu et al. described in Combining CRISPR–Cpf1 and Recombineering Facilitates Fast and Efficient Genome Editing in Escherichia coli. ACS Synthetic Biology, 2022 and Wu et al. described in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817–1825 that the CRISPR / Cpf1 system in Escherichia coli consists of a double plasmid pEcCpf1 and pcrEG. The plasmid pEcCpf1 and plasmid pcrEG are used to integrate genes into the Escherichia coli genome. The plasmid pEcCpf1 is an expression vector for the gene Fncpf1 and λ-Red recombinase system, contains a pSC101 replicon and has kanamycin resistance. λ-Red recombinase is derived from λ phage of Escherichia coli and is used to promote homologous recombination in Escherichia coli. λ-Red recombinase is expressed through an inducible promoter P araB Regulate expression. Since the plasmid contains the sacB gene, sucrose will be toxic to cells when present in the culture medium, so the plasmid can be eliminated. Plasmid pcrEG is a crRNA array expression vector containing a pMB1 replicon and spectinomycin resistance. It includes a crRNA array insertion region and a homology arm insertion region, wherein both ends of the crRNA array insertion region contain Eco31I restriction sites, which can be used for rapid assembly of crRNA, and the homology arm insertion region contains the sfgfp gene, which can be used for rapid screening after homology arm insertion. The crRNA array insertion region contains P upstream j23119Promoter for the expression of the desired crRNA array. The CRISPR / Cpf1 system in Bacillus subtilis consists of a dual plasmid pHT-XCR6 and pcrF19NM2. Plasmid pHT-XCR6 (ampicillin resistance in Escherichia coli and chloramphenicol resistance in Bacillus subtilis) is a Cpf1 expression vector, in which Cpf1 is induced and regulated by xylose; in addition, the plasmid also contains the NgAgo protein gene to improve the efficiency of homologous recombination during gene editing. Plasmid pcrF19NM2 (kanamycin resistance in both Escherichia coli and Bacillus subtilis) is a thermosensitive plasmid in Bacillus subtilis. It cannot replicate when cultured above 37°C. It is used as a crRNA expression vector to express crRNA; and the homologous repair template can be inserted into it, and its homologous template insertion region contains the mCherry gene for insertion screening.

[0104] like Figure 2-3 As shown, a total of 3 pcrEG and 8 pcrF19NM2 series plasmids need to be constructed for genetic manipulation. This series of plasmids consists of four parts: plasmid backbone, upstream homology arm, downstream homology arm, and insertion (replacement) sequence. The plasmid construction method, primer design, and verification primer design are all described by Zhu et al. in Combining CRISPR–Cpf1 and Recombineering Facilitates Fast and Efficient Genome Editing in Escherichiacoli. ACS Synthetic Biology, 2022 and Wu et al. in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817–1825.

[0105] (I) Primers used to construct plasmids

[0106] 1)P 21 -tetR*-P tet -T7 RNAP expression cassette integration plasmids pcrEG-S1-T7RNAP and pcrF19-S1-T7RNAP were constructed. The inserted sequence consisted of the constitutively expressed repressor protein expression cassette P 21 -tetR* and T7 RNAP expression cassette P tet-T7 RNAP, the nucleotide sequence of which is shown in SEQ ID NO. 1. The integration sites are both S1 sites in Escherichia coli and Bacillus subtilis (i.e., the leuO gene in Escherichia coli and the ydjC gene in Bacillus subtilis), and the primers used to construct the plasmid are:

[0107]

[0108] 2) P 21 -tetR*-P tet -dCpf1 expression cassette integration plasmids pcrEG-S2-dCpf1 and pcrF19-S2-dCpf1, the inserted sequence consists of the constitutively expressed repressor protein expression cassette P 21 -tetR* and dCpf1 expression cassette P tet -dCpf1, whose nucleotide sequence is shown in SEQ ID NO.2 (wherein dCpf1 is Cpf1 with amino acid 917 replaced by Ala, the amino acid sequence is shown in SEQ ID NO.3, and the Genbank accession number of Cpf1 is ASK09413.1). The integration sites are both S2 sites in Escherichia coli and Bacillus subtilis (dCpf1 is integrated in the lacA site of Bacillus subtilis and the gsk site of Escherichia coli), and the primers used to construct the plasmid are:

[0109]

[0110]

[0111] 3) P veg -mScarlet3 expression cassette integrated into plasmid pcrEG-S3-mScarlet3 and

[0112] pcrF19-S3-mScarlet3, the inserted sequence is under the strong constitutive promoter P veg The integration site is the S3 site (i.e., the pflA and ybbU genes) in both Escherichia coli and Bacillus subtilis. The primers used to construct the plasmid are:

[0113]

[0114] 4) Construction of activation module integration plasmid: The integration plasmid is pcrF19-P T7tet -dxS, pcrF19-P T7tet -dxR, pcrF19-P T7tet -ispDF, pcrF19-P T7tet -fni, using promoter P T7tet Replace endogenous promoter;

[0115]

[0116] 5) The promoter of the riboflavin biosynthesis endogenous gene cluster ribDEAHT is P T7tet Integration plasmid pcrF19-P T7tet -rib can promote the P T7tet To replace the endogenous promoter, the primers used were

[0117]

[0118]

[0119] 6) The crRNA sequence targeting the hepS gene (SEQ ID NO.4) is gccaatctgaacacgaaattaaa (SEQ ID NO.5). The crRNA sequence targeting the ribC gene (SEQ ID NO.6) is caatggcgtttgcaatattggct (SEQ ID NO.7).

[0120] 7) Other validation primers are as follows:

[0121]

[0122] (II) Plasmid construction method

[0123] 1) crRNA ligation

[0124] Connection of a single crRNA: At this time, crRNA can be directly designed with a pair of primers with overlapping regions, and then denatured and annealed to form primer dimers with sticky ends. Use Bio-Tech's 5X Annealing Buffer for DNAOligos, with a primer concentration of 10uM, 20uL of upstream and downstream primers (gene name-cr-F / R) in a 50uL system, and 10uL of Annealing Buffer. The reaction conditions are: 98℃2min, 0.1℃ / S cooling to 4℃ and then keeping warm. Dilute the dimer 10 times, take 1uL and connect it to the vectors pcrEG-Li ​​and pcrF19NM2-Li after Eco31 I digestion.

[0125] After crRNA was connected, it was transferred into E. coli DH5α competent cell and colony PCR verification was performed using verification primers SfGFP-VR and mcherry-VR and gene name-cr-F respectively.

[0126] 2) Amplification and ligation of homology arms

[0127] Using gene name-U1000-F and gene name-U1000-R, the Escherichia coli and Bacillus subtilis genomes were used as templates to amplify the upstream homology arms of different genes, respectively; using gene name-D1000-F and gene name-D1000-R, the Escherichia coli and Bacillus subtilis genomes were used as templates to amplify the downstream homology arms of different genes, respectively. T7tet -F amplify the integrated expression cassette; the PCR product is recovered using a DNA purification kit.

[0128] The plasmid with successful crRNA connection was linearized using primers pcrEG-LiF and pcrEG-LiR or pcrF19-LiF and pcrF19-LiR. The plasmid vector, upstream and downstream homology arms, and inserted (replaced) gene fragments were connected using the Bio-Sky Seamless Cloning Kit and transferred into the E. coli DH5α competent state. The transformants were verified and sequenced using P23119-F / pcrEG-VR and Pveg-VF / Hominsert-R.

[0129] Example 2: Construction of chassis strains in gene circuits

[0130] The plasmid constructed in Example 1 was used to perform gene editing on Escherichia coli K12, comprising the following steps (the antibiotic concentrations described below are: kanamycin: 50 μg / mL, spectinomycin: 100 μg / mL):

[0131] (1) First, the Cpf1 expression vector pEcCpf1 was transformed into Escherichia coli and spread on LB medium plates containing kanamycin to obtain positive colonies.

[0132] (2) Inoculation culture: Prepare competent E. coli containing plasmid pEcCpf1, add arabinose at a final concentration of 10 mM to induce the expression of the homologous recombinase on the plasmid, add the integration plasmid pcrEG-S1-T7RNAP to the competent culture, ice bath for 30 min, heat shock at 42°C for 90 s, add 1 mL of LB medium and culture for 1.5-2 h, then centrifuge at 5000 g for 3 min, discard 900 μL of medium, leave 100 μL of medium, resuspend the cells and spread them on LB plates containing kanamycin and spectinomycin.

[0133] (3) After a single colony is grown, the gene editing status is verified by colony PCR (primers ECOS1-GF and RNAP-VR). For positive strains, only the second plasmid (i.e., crRNA expression plasmid) can be eliminated, while the pEcCpf1 plasmid is left in the bacteria. Repeat the above steps, and transfer pcrEG-S2-dCpf1 and pcrEG-S3-mScarlet3 into Escherichia coli in turn. ECOS2-GF and dCpf1-VR are used to verify whether dCpf1 is inserted, and ECOS3-GF and mScarlet3-VR are used to verify whether mScarlet3 is inserted. The strains K12T7T, K12T7Tt, and K12T7Tt-msc (in which only the activation module P is integrated) are obtained in turn. 21 -tetR*-P tet -T7 RNAP expression cassette for strain K12T7T, and integration of activation module P 21 -tetR*-P tet -T7 RNAP expression cassette and repression module P 21 -tetR*-P tet The strain with -dCpf1 expression cassette is K12T7Tt, and the strain with pcrEG-S3-mScarlet3 integrated on the basis of strain K12T7Tt is K12T7Tt-msc).

[0134] (4) The plasmid elimination method is described in Amodified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli.

[0135] The Cpf1 protein expression plasmid pHT-XCR6 of the CRISPR / Cpf1 system was transferred into the competent state of Bacillus subtilis G600, and coated on LB plates containing kanamycin and chloramphenicol resistance respectively to wait for single colonies to grow. Then the strain G600-XCR6 transformed with pHT-XCR6 was made into a competent state, and the pcrF19-S1-T7RNAP constructed in Example 1 was transformed. The plasmid was added to the competent state and cultured for two hours. After that, the plate was not directly coated, but the bacterial liquid was centrifuged (4000rmp, 2min) and resuspended in 500μL LB containing chloramphenicol, kanamycin and 3% xylose for overnight culture. The next day, it was centrifuged and concentrated to 150μL and coated with LB plates added with chloramphenicol, kanamycin and 3% xylose. After growing a single colony, colony PCR can be performed to verify whether gene editing is completed. The successfully verified single colony was inoculated into 2 mL of LB containing 0.006% SDS for overnight culture, streaked on LB plates, and spot-plated to verify whether the pcrF19-S1-T7RNAP plasmid and pHT-XCR6 plasmid were eliminated. The strain with successful elimination of the two plasmids was named BST7T; the strain with only successful elimination of the pcrF19-S1-T7RNAP plasmid was named BST7T-XCR6 for the next step. The promoter integration plasmids pcrF19-S2-dCpf1, pcrF19-S3-mScarlet3, and pcrF19-P T7tet -dxS, pcrF19-P T7tet -dxR, pcrF19-P T7tet -ispDF, pcrF19-P T7tet -fni, pcrF19-P T7tet According to the above steps (transformation - post-culture - plating - colony PCR verification - plasmid elimination), the engineered strain BST7Tt, BST7Tt-msc, and lycopene production strains (L1-L11, see Figure 5 ) and BST7Tt-rib.

[0136] Example 3: Construction of expression plasmid required for gene circuit

[0137] 1) Expression plasmid of gene circuit

[0138]

[0139] 2) In the above table, pHT-series plasmids are used for transformation of Bacillus subtilis, and pBBR-series plasmids are used for transformation of Escherichia coli. The specific construction is as follows:

[0140] Activation plasmid: pHT-P T7tet and pHT-P T7tet -sfGFP, pHT-P T7tet-sfGFP plasmid is based on pHT-T7Ls plasmid using P T7tet -LiF / LiR replaced the repressor protein tetR binding site tetO, in which pHT-GP0s plasmid used pHT01 as template and connected P veg Promoter, Riboj ribozyme, RBS and sfGFP expression cassette, pHT-P T7tet -sfGFP plasmid contains P veg The promoter was replaced by P T7tet Promoter. pHT-P T7tet The nucleotide sequence of is shown in SEQ ID NO. 8. This plasmid was used as a template to construct the remaining plasmids.

[0141] Delete-LiF / LiR to pHT-P T7tet -sfGFP was PCR-generated to obtain pHT-P T7tet Expression plasmid; on this basis, use T7-GFP-F / R to template pHT-P T7tet -sfGFP and pHT-P T7tet PCR was performed and the fragment was connected to the pBBR1-MCS2 vector to obtain pBBR-P T7tet -sfGFP and pBBR-P T7tet ; Use cr-LiF / LiR to convert P tet -crRNA fragments were connected to the above four expression plasmids to obtain pBBR-P tet -cr, pHT-P tet -cr, pBBR-P T7tet -sfGFP-P tet -cr and

[0142] pHT-P T7tet -sfGFP-P tet -crPCR. The product was recovered using a DNA purification kit and ligated using the Bio-Tech Seamless Cloning Kit. Transformed into E. coli DH5α competent cells. The transformants were verified using verification primers and sequenced.

[0143] The primers required are as follows:

[0144]

[0145]

[0146] Example 4: Characterization of Gene Circuits

[0147] The expression plasmid pBBR-P T7tet -sfGFP-Ptet -cr-(1-3) and

[0148] pHT-P T7tet -sfGFP-P tet -cr-(1-3) was transferred into the corresponding strain and inoculated into a 96-well plate at 37 degrees with a 1% inoculation amount. Inducers (0.1uM Escherichia coli and 0.5uM Bacillus subtilis) were added under the condition of 37 degrees well shaker at 750rpm and the absorbance (OD) at 600nm was detected by microplate reader. 600 ) and the fluorescence values ​​of sfGFP / mScarlet3 (excitation light 480nm, emission light 516nm; excitation light 569nm, emission light 605nm), and the standardized relative fluorescence value was calculated using the formula:

[0149]

[0150] The sequences of crRNA1 to 3 are as follows:

[0151] crRNA1:TGAGGTTTAAAGTGCACATGGAA;

[0152] crRNA2:GTTGGGATATCCTTAGTCCTCAA;

[0153] crRNA3: CACCAGATGGACCCGTAATGCAA

[0154] like Figure 4 As shown, the gene circuit achieved the expected effect of simultaneous activation and inhibition of gene expression in both Escherichia coli and Bacillus subtilis; in the absence of added inducers, the expression of mScarlet3 was slightly reduced, possibly because leaky expression allowed the inhibition module to take effect.

[0155] Example 5: Gene circuits for regulating the synthesis of lycopene

[0156] The strains L1 to L11 constructed in Example 2 were transformed into pHT-P T7tet-crtEIB were used for shake flask fermentation. The fermentation process was as follows: (1) Plate culture: Take the -80℃ preserved strain and streak it on the activated plate, culture it at 37℃ for 12h, and subculture it once; (2) Shake flask seed culture: Use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 50mL Erlenmeyer flask containing 10mL seed culture medium, seal it with nine layers of gauze, and culture it at 37℃ and 220rpm for 10h; (3) Shake flask fermentation culture: Inoculate it into a 250mL Erlenmeyer flask containing fermentation medium (final volume is 40mL) at an inoculum amount of 4% of the volume of the seed culture solution, seal it with nine layers of gauze, and culture it at 37℃ and 200r / min with shaking, add induction tetracycline respectively, and the fermentation cycle is 24h.

[0157] The fermentation results showed that ( Figure 5 ), compared with 64.28 mg / L of the wild strain, the final yield of L11 was 232.1 mg / L, the highest yield reported and 3.61 times that of the wild strain. The results showed that the gene circuit can effectively regulate the production of lycopene.

[0158] Example 6: Gene circuits for regulating riboflavin synthesis

[0159] Based on the strain BST7Tt-rib constructed in Example 2, the regulatory plasmid pHT-P tet -cr RibC , strain BST7Tt-rib-Cr-ribC was obtained; it was fermented with the control strain G600 in a shake flask. The fermentation process is as follows: (1) Plate culture: take the -80℃ preserved strain and streak it on the activation plate, culture it at 37℃ for 12h, and subculture it once; (2) Shake flask seed culture: use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 50mL Erlenmeyer flask containing 10mL seed culture medium, seal it with nine layers of gauze, and culture it at 37℃ and 220rpm for 10h; (3) Shake flask fermentation culture: inoculate it into a 250mL Erlenmeyer flask containing fermentation medium (final volume is 40mL) at an inoculum amount of 4% of the volume of the seed culture solution, seal it with nine layers of gauze, and culture it at 37℃ and 200r / min with shaking, add induction tetracycline respectively, and the fermentation cycle is 24h.

[0160] The fermentation results showed that the final yield of BST7Tt-rib-Cr-ribC was 48.3 mg / L, 32.2 times that of the wild strain (1.5 mg / L). The results indicated that the gene circuit can effectively regulate the production of riboflavin.

[0161] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A gene circuit that simultaneously realizes gene activation and inhibition control, characterized in that: Including activation module, inhibition module and target gene module: The activation module contains a tetracycline repressor protein expression cassette and an inducible promoter P tet regulated T7 RNA polymerase expression cassette, The inhibition module contains a tetracycline repressor protein expression cassette and an inducible promoter P tet regulated dCpf1 or dCas9 expression cassette, The target gene module contains a hybrid promoter P T7tet expression cassette and the inducible promoter P tet The crRNA or sgRNA expression cassette regulated by the hybrid promoter P T7tet The expression cassette is located upstream of at least one target gene to be activated, and the crRNA or sgRNA expression cassette specifically recognizes at least one target gene to be inhibited.

2. The gene circuit according to claim 1, characterized in that Contain at least one of the following characteristics: (1) integrating and expressing the activation module; (2) integrating and expressing the inhibition module; (3) Integrate or episomal expression of the hybrid promoter P in the target gene module T7tet expression cassette and / or driven by an inducible promoter P tet Regulated crRNA or sgRNA expression cassette; (4) The gene circuit is used for gene regulation in Escherichia coli or Bacillus subtilis.

3. The gene circuit according to claim 2, characterized in that Contain at least one of the following characteristics: (1) When the hybrid promoter P T7tet expression cassette and the inducible promoter P tet When the regulated crRNA or sgRNA expression cassette is located on the same vector, the hybrid promoter P T7tet With inducible promoter P tet Reverse setting; (2) When expressed in a free manner, the hybrid promoter P T7tet The expression cassette is connected to the target gene to be activated; when integrated expression is used, the hybrid promoter P T7tet The expression cassette replaces the promoter in front of the target gene to be activated on the genome.

4. The gene circuit according to claim 1, characterized in that The sequence of the tetracycline repressor protein is shown in SEQ ID NO.10; the hybrid promoter P T7tet The sequence is shown in SEQ ID NO.11; the inducible promoter P tet The sequence is shown as SEQ ID NO.

12.

5. The gene circuit according to claim 1, characterized in that Contain at least one of the following characteristics: (1) The target gene to be activated is a key enzyme gene in the synthesis pathway of the target product; (2) The target gene to be inhibited is an enzyme gene in a competitive pathway for the synthesis of the target product; (3) The target gene to be activated includes one or more of the following: Lycopene expression gene cluster crtEBI, 1-deoxy-d-xylulose-5-phosphate synthase gene, 1-deoxy-d-xylulose-5-phosphate reductoisomerase gene, c-methyl-d-erythrose-4-phosphate cytidyltransferase gene, 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase gene, Isopentenyl diphosphate isomerase type 2 gene; (4) The target gene to be inhibited includes the hepS gene; (5) the target gene to be activated includes the riboflavin synthesis gene cluster ribDEAHT; (6) The target gene to be inhibited includes the ribC gene.

6. The gene circuit according to claim 5, characterized in that Contain at least one of the following characteristics: (1) The NCBI accession number of the pyrophosphate synthase gene crtE is GenBank: AAA24819.1, the NCBI accession number of the phytoene synthase gene crtB is GenBank: AAA24820.1, the NCBI accession number of the phytoene dehydrogenase gene crtI is GenBank: AAA24821.1, the NCBI accession number of the 1-deoxy-d-xylulose-5-phosphate synthase gene is GenBank: BAA12576.1, the NCBI accession number of the 1-deoxy-d-xylulose-5-phosphate reductoisomerase gene is GenBank: CAB13528.2, the NCBI accession number of the c-methyl-d-erythrose-4-phosphate cytidyltransferase gene is GenBank: AAA21794.1, and the NCBI accession number of the 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase gene is GenBank: AAA21795.1, the NCBI accession number of type 2 isopentenyl diphosphate isomerase gene is GenBank: BAB32625.1; (2) The nucleotide sequence of the hepS gene is shown in SEQ ID NO.4; (3) The sequence of crRNA used to inhibit gene hepS is shown in SEQ ID NO.5; (4) The nucleotide sequence of the ribC gene is shown in SEQ ID NO.6; (5) The sequence of crRNA used to inhibit gene ribC is shown in SEQ ID NO.

7.

7. A recombinant strain, characterized in that: The recombinant strain uses Escherichia coli or Bacillus subtilis as a host to introduce the gene circuit according to any one of claims 1 to 6.

8. The recombinant strain according to claim 7, characterized in that Contain at least one of the following characteristics: (1) When the host is Bacillus subtilis, the target gene module for free expression includes the recombinant plasmid pHT-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pHT-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 pHT01 was used as a template to connect P T7tet promoter, Riboj ribozyme and RBS, and the hybrid promoter P was set in reverse T7tet and the inducible promoter P tet The target gene gene1 to be activated is located at the promoter P T7tet Afterwards, the crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after; (2) When the host is Bacillus subtilis, the hybrid promoter P is integrated and expressed T7tet expression cassette, episomal expression is expressed by the inducible promoter P tet Regulated crRNA or sgRNA expression cassette, including recombinant plasmid pHT-P when expressed in free form tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pHT-P tet -crRNA gene2 / sgRNA gene2 pHT01 was used as a template to connect P tet The crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after; (3) When the host is Escherichia coli, the target gene module for free expression includes the recombinant plasmid pBBR-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pBBR-P T7tet -gene1-P tet -crRNA gene2 / sgRNA gene2 pBBR1MCS-2 plasmid was used as template to connect P T7tet promoter, Riboj ribozyme and RBS, and the hybrid promoter P was set in reverse T7tet and the inducible promoter P tet The target gene gene1 to be activated is located at the promoter P T7tet Afterwards, the crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after; (4) When the host is Escherichia coli, the hybrid promoter P is integrated and expressed T7tet expression cassette, episomal expression is expressed by the inducible promoter P tet Regulated crRNA or sgRNA expression cassette, including recombinant plasmid pBBR-P when expressed in free form tet -crRNA gene2 / sgRNA gene2 The recombinant plasmid pBBR-P tet -crRNA gene2 / sgRNA gene2 pBBR1MCS-2 plasmid was used as template to connect P tet The crRNA or sgRNA of the target gene gene2 to be inhibited is located at the promoter P tet after.

9. The recombinant strain according to claim 7 or 8, characterized in that Contain at least one of the following characteristics: (1) The recombinant strain has undergone the following transformations: (i) integrating and expressing the activation module and the inhibition module, (ii) Replace the promoter of the following gene on the genome with the hybrid promoter P T7tet : 1-deoxy-d-xylulose-5-phosphate synthase (DXS) gene, 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR) gene, c-methyl-d-erythrose-4-phosphate cytidyltransferase (IspD) gene, 2-c-methyl-d-erythritol-2,4-cyclopyrophosphate synthase (IspF) gene, isopentenyl diphosphate isomerase type 2 (Fni) gene, (iii) Using a hybrid promoter P T7tet Free expression of lycopene expression gene cluster crtEBI, (iv) Using an inducible promoter P tet Freely expressing crRNA or sgRNA, wherein the crRNA or sgRNA specifically recognizes the hepS gene; (2) The recombinant strain has undergone the following transformations: (i) integrating and expressing the activation module and the inhibition module, (ii) Replace all promoters of the ribDEAHT gene cluster on the genome with the hybrid promoter P T7tet , (iii) Using an inducible promoter P tet Freely expressing crRNA or sgRNA, wherein the crRNA or sgRNA specifically recognizes the ribC gene; (3) The sequence of RBS is shown in SEQ ID NO.

15.

10. The recombinant strain according to claim 7, characterized in that The host bacteria of the recombinant Bacillus subtilis include B. subtilis G600, and the host bacteria of the recombinant Escherichia coli include E. coliK12.

11. Use of the gene circuit according to any one of claims 1 to 6 or the recombinant strain according to any one of claims 7 to 10 in biosynthesis.

12. The use according to claim 11, characterized in that: The products of the biosynthesis include lycopene or riboflavin.

13. A method for producing lycopene, characterized in that: The method comprises the step of using the recombinant strain according to any one of claims 7 to 10 for fermentation production.

14. The method according to claim 13, characterized in that Contain at least one of the following characteristics: (1) The fermentation production comprises: culturing the recombinant strain under suitable conditions, and the culture system includes an inducer tetracycline; (2) The seed culture medium used in fermentation production includes LB medium; (3) The fermentation medium used in fermentation production includes TB medium.

15. A method for promoting biosynthesis of Bacillus subtilis or Escherichia coli, characterized in that: The gene circuit according to any one of claims 1 to 6 is introduced into a starting bacillus subtilis or Escherichia coli.

Images