Method for efficiently electrically transforming bifidobacteria and application of bifidobacteria

Abstract

The invention belongs to the field of microbial genetic engineering, and particularly relates to a method for efficiently electrically transforming bifidobacterium and application of the bifidobacterium. Specifically, the invention discloses the escherichia coli-bifidobacterium shuttle plasmid suitable for various bifidobacteria, and the electrotransformation conditions of bifidobacterium longum are explored in the aspects of ice bath time, washing buffer solution, ethanol addition amount, culture medium components, electroporation voltage, bacterial growth stage, recovery time and the like; finally, efficient transformation of the bifidobacterium longum and the bifidobacterium animalis can be realized, and the electrotransformation efficiency of the bifidobacterium longum, especially the bifidobacterium longum, is improved by more than 300 times, so that the requirement of gene editing on the transformation efficiency can be met, and the method has a good practical application value.

Description

Technical Field

[0001] The invention belongs to the field of microbial genetic engineering, and specifically relates to a method for efficiently electrotransforming bifidobacteria and an application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Bifidobacterium colonizes the gastrointestinal tract in the early stages of human life. As an important component of intestinal microorganisms, it has been present throughout the human life cycle. 3% of the intestinal microbiota of ordinary adults is composed of bacteria of the genus Bifidobacterium. As intestinal probiotics, Bifidobacterium has the functions of regulating the balance of intestinal flora, preventing intestinal pathogenic infections by producing short-chain fatty acids or prebiotic oligosaccharides, relieving irritable bowel syndrome, treating lactose intolerance, preventing inflammation, and inducing anti-tumor effects of tumor-specific T cells. These probiotic effects mean that Bifidobacterium or its active ingredients have great potential for application in commercial food or medical fields. In view of the reliable safety of Bifidobacterium and its effective probiotic effects, the infant Bifidobacterium subspecies of Bifidobacterium longum has been commercially applied. Although the probiotic function of Bifidobacterium has been studied extensively, little is known about the specific mechanism of the probiotic function of Bifidobacterium or its active products, which has hindered the engineering and application of Bifidobacterium.

[0004] Bifidobacterium has high culture requirements. The optimal growth temperature of human bifidobacterium is generally 36-38℃, while the optimal growth temperature of animal-derived bifidobacterium is generally 41-43℃. During commercial processing and storage, bifidobacterium may be exposed to conditions exceeding its optimal growth temperature or high oxygen concentration, which increases the technical cost of wild-type bifidobacterium preservation and application. However, genetic modification of bifidobacterium provides the possibility to fully tap its probiotic potential and enhance its robustness. As a Gram-positive bacterium, bifidobacterium is limited by a complex restriction-modification system and a thick cell wall, which leads to its low exogenous DNA conversion efficiency, which in turn leads to great challenges in genetic manipulation. In addition, due to the species specificity of bifidobacterium, most genetic engineering elements such as promoters or replicons from the genomes of other strains are not suitable for bifidobacteria, and even genetic elements between different species of bifidobacteria are not universal. Exploring plasmids that can stably exist and replicate in important bifidobacteria and efficient transformation methods has become a prerequisite for genetic modification and mechanism exploration of bifidobacteria.

[0005] Electrotransformation, also known as high-voltage electroporation (electroporation for short), is a cell transformation method that uses a high-intensity electric field to instantly increase the permeability of the cell membrane, thereby allowing nucleic acids and other chemicals to enter the target cell. The electrotransformation method has the advantages of simple operation, wide application range, and low cost, and is often used in a variety of genetic operations. Studies have shown that the electrotransformation efficiency of bifidobacteria can be significantly improved by optimizing conditions such as culture medium, electrotransformation voltage, washing buffer, and recovery time. Ai, Lianzhong et al. successfully improved the electrotransformation efficiency of Bifidobacterium animalis AR668 to 2.15×10 by optimizing the electrotransformation conditions. 5 CFU / μg DNA. It has also been reported that Bifidobacterium longum 105-A has 10 4 -10 6 However, when we used the same electroporation conditions to electroporate different species of animal Bifidobacterium and longum Bifidobacterium, we were unable to achieve the electroporation efficiency of the same type of Bifidobacterium described above, indicating that the species specificity of Bifidobacterium is also an important aspect that seriously hinders the gene editing of different types of Bifidobacterium. Summary of the invention

[0006] In view of the above prior art, the present invention aims to provide a method for efficient electrotransformation of bifidobacteria and its application. Specifically, the present invention optimizes the conditions for electrotransformation of bifidobacteria, successfully constructs a shuttle plasmid suitable for Escherichia coli-multiple bifidobacteria and performs methylation modification on the plasmid, and finally greatly improves the electrotransformation efficiency of bifidobacteria. Based on the above research results, the present invention is completed.

[0007] In order to achieve the above technical objectives, the technical solution provided by the present invention is as follows:

[0008] In a first aspect of the present invention, an Escherichia coli-Bifidobacterium shuttle plasmid is provided, wherein the Escherichia coli-Bifidobacterium shuttle plasmid may be a shuttle plasmid having chloramphenicol resistance, such as p15A-cm-BBori-cat (SEQ ID NO.1), p15A-cm-pMB1-cat (SEQ ID NO.2), or a shuttle plasmid having spectinomycin resistance, such as p15A-cm-BBori-spect (SEQ ID NO.3) and p15A-cm-pMB1-spect (SEQ ID NO.4);

[0009] The construction method of the above-mentioned plasmid includes: constructing an Escherichia coli-Bifidobacterium shuttle plasmid, electro-transforming GB05-dir with an Escherichia coli plasmid replicon and a chloramphenicol resistance gene fragment (p15A-cm) available in Escherichia coli, a replicon derived from Bifidobacterium bifidum / Bifidobacterium longum and a chloramphenicol resistance gene fragment (BBori / pMB1-cat) available in Bifidobacterium, and utilizing its homologous recombination ability to realize the construction of a complete plasmid, thereby obtaining p15A-cm-BBori-cat and p15A-cm-pMB1-cat; and replacing the chloramphenicol resistance gene fragment (BBori / pMB1-cat) available in Bifidobacterium with a spectinomycin resistance gene fragment (BBori / pMB1-spect) available in Bifidobacterium, thereby obtaining p15A-cm-BBori-spect and p15A-cm-pMB1-spect.

[0010] Furthermore, the Escherichia coli-Bifidobacterium shuttle plasmid is methylated, thereby further improving the electro-transformation efficiency of Bifidobacterium.

[0011] The methylation treatment method includes using a methyltransferase to perform methylation modification on the shuttle plasmid. The methyltransferase may be a methyltransferase BAD-1233 derived from Bifidobacterium adolescentis ATCC15703.

[0012] Furthermore, the methylation treatment method includes: using the anhydrotetracycline-induced promoter Ptet to control the heterologous expression of the methyltransferase BAD-1233 in Escherichia coli, and after the host Escherichia coli is transformed into the Escherichia coli-Bifidobacterium shuttle plasmid, anhydrotetracycline is added to the culture medium to achieve methylation of the target plasmid; further, extracting the methylated plasmid and then electro-transforming Bifidobacterium longum.

[0013] The second aspect of the present invention provides the use of the Escherichia coli-Bifidobacterium shuttle plasmid in improving the efficiency of electroporation of Bifidobacterium.

[0014] The bifidobacterium includes Bifidobacterium longum, Bifidobacterium animalis, etc., among which Bifidobacterium longum is preferred.

[0015] The third aspect of the present invention provides a method for efficient electrotransformation of Bifidobacterium, the method comprising:

[0016] S1. Preparation of competent cells: inoculate bifidobacteria into a medium containing NaCl and culture to the logarithmic phase, centrifuge and remove the supernatant; resuspend the cells in a buffer, centrifuge and remove the supernatant, and add glycerol;

[0017] S2. Electroporation of competent cells: Add anhydrous ethanol and plasmids to the competent cells, perform electroporation, and resuscitate the competent cells.

[0018] Wherein, in step S1, the NaCl concentration is 0.05-0.2M, wherein data show that Bifidobacterium longum has a higher electroporation efficiency when the NaCl concentration in the culture medium is 0.2M, so 0.2M is preferred;

[0019] The logarithmic phase is preferably the mid-logarithmic phase, OD 600 ≈0.3;

[0020] The buffer may be any one of glycerol, SA buffer, water and CaCl2, wherein the competent cells obtained by washing Bifidobacterium longum with SA buffer have the highest electroporation efficiency, and therefore SA buffer is preferred.

[0021] In the step S2, the plasmid is the above-mentioned Escherichia coli-Bifidobacterium shuttle plasmid; the amount of anhydrous ethanol added is 2-4% (v / v) of the total electrotransformation system, preferably 4%; the electric shock voltage intensity in the electric shock treatment is 1500-4000V, further 1750-3000V; wherein 3000V is the optimal electric shock voltage parameter for the electrotransformation of Bifidobacterium longum; the recovery time is 2-10h, preferably 10h.

[0022] Furthermore, in the above method, the bifidobacterium includes Bifidobacterium longum, Bifidobacterium animalis, etc., among which Bifidobacterium longum is preferred.

[0023] A fourth aspect of the present invention provides the use of the above-mentioned Escherichia coli-Bifidobacterium shuttle plasmid or the method for efficient electrotransformation of Bifidobacterium in gene editing of Bifidobacterium.

[0024] Beneficial technical effects of one or more of the above technical solutions:

[0025] The above technical scheme discloses an Escherichia coli-Bifidobacterium shuttle plasmid suitable for a variety of bifidobacteria, and at the same time explores the electroporation conditions of Bifidobacterium longum by adjusting the ice bath time, washing buffer, ethanol addition amount, culture medium composition, electroporation voltage, bacterial growth stage, recovery time, etc., to achieve an electroporation efficiency of more than 300 times of Bifidobacterium, especially Bifidobacterium longum, thereby achieving efficient transformation of Bifidobacterium longum and Bifidobacterium animalis, thereby meeting the requirements of gene editing for transformation efficiency, and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1Optimization of electrotransformation conditions promotes the improvement of electrotransformation efficiency of Bifidobacterium longum; A. Schematic diagram of chloramphenicol resistance plasmid p15A-cm-BBori-cat and spectinomycin resistance plasmid p15A-cm-BBori-spect used in the optimization of electrotransformation conditions of Bifidobacterium longum; B. Determination of the growth of Bifidobacterium longum in culture medium supplemented with different concentrations of NaCl; C. Culture to OD 600 =Electroporation was performed when the pH was about 0.4; D. Increasing the electroporation voltage can effectively overcome the barrier of the cell wall of Bifidobacterium longum; E. Adding 4 μl of anhydrous ethanol to the final 100 μl electroporation system can significantly improve the electroporation efficiency; F. The transformation efficiency was evaluated by prolonging the recovery time; G. The electroporation efficiency of Bifidobacterium in an ice bath; H. The sensitivity of Bifidobacterium to electroporation at different stages of the logarithmic phase; I. Four washing buffers for preparing competent cells were selected to study their effects on the transformation efficiency.

[0027] Figure 2 The optimized electrotransformation conditions were used to improve the electrotransformation efficiency of animal Bifidobacterium; A. the plasmids p15A-cm-pMB1-cat and p15A-cm-pMB1-spect were used for electrotransformation of animal Bifidobacterium; B. the availability of p15A-cm-pMB1-cat and p15A-cm-pMB1-spect in Bifidobacterium longum was detected; C. the electrotransformation efficiency of animal Bifidobacterium was compared by using the electrotransformation methods before and after optimization using the two plasmids p15A-cm-pMB1-cat and p15A-cm-pMB1-spect.

[0028] Figure 3 The p15A-cm-pMB1-spect plasmid was methylated using a methyltransferase from Bifidobacterium adolescentis to further improve the electro-transformation efficiency; wherein, A. a schematic diagram of the expression vector of the methyltransferase gene BAD-1233 and a control plasmid without the BAD-1233 gene (having the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively); B. the effect of the plasmids methylated and non-methylated with the methyltransferase BAD-1233 on the electro-transformation efficiency of Bifidobacterium longum. DETAILED DESCRIPTION

[0029] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0030] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0031] The present invention is further described below in conjunction with examples. The present invention is further described below by way of examples, but the present invention is not limited to the scope of the embodiments described. Based on the embodiments in the present invention, any variation of the present invention by those skilled in the art without making a creative premise all belongs to the protection scope of the present invention. Meanwhile, in the embodiments of the present invention, unless otherwise specified, all preparation raw materials are commercially available products well known to those skilled in the art.

[0032] Reagents and instruments:

[0033] In the present embodiment, the reagent is mainly a molecular biology experimental reagent, and the primer required for plasmid construction is synthesized from Shanghai Shenggong Biotechnology Co., Ltd., and the restriction endonuclease is from New England Biolabs, and the DNA polymerase is from the ApexHF HSDNAPolymerase FSMaster Mix of Accurate Biology, and the antibiotic is purchased from Invitrogen. The electroporator uses the American Biorad electroporator and the 2mm electroporator cup of the same brand. The long bifidobacterium (Bifidobacterium longum ATCC15697) involved in the invention is purchased from the China Medical Bacteria Collection Management Center, and the 0233 culture medium is purchased as a formula for this strain, and Escherichia coli GB05 comes from this laboratory, and animal bifidobacteria come from the research group of Professor He Zhen of the Sixth Affiliated Hospital of Sun Yat-sen University.

[0034] 0233 medium formula: soy peptone 5g / L, tryptone 5g / L, yeast extract 10g / L, glucose 10g / L, L-cysteine ​​0.5g / L, salt solution 40mL, agar powder 15g / L. (Salt solution formula: calcium chloride 0.2g / L, magnesium sulfate heptahydrate 0.48g / L, dipotassium hydrogen phosphate 1g / L, potassium dihydrogen phosphate 1g / L, sodium bicarbonate 10g / L, sodium chloride 2g / L)

[0035] Sucrose-ammonium citrate (SA) buffer: sucrose was added to 1 mmol / L ammonium citrate buffer (pH=6.0) to a final concentration of 0.5 M.

[0036] Method for initial electrotransformation of Bifidobacterium:

[0037] (1) Bifidobacterium was inoculated into 1.2 mL of 0233 medium without additional NaCl at a 1 / 12 inoculum volume and grown in an anaerobic chamber at 35°C until the late logarithmic phase (OD 600 ≈0.4); centrifuge the cells at 4°C 10000rpm for 1 min, discard the supernatant; resuspend the cells with 1mL of ice-cold 10% glycerol, centrifuge at 4°C 10000rpm for 1min, discard the supernatant, repeat this step once; add 90μL of 10% glycerol to the Ep tube.

[0038] (2) Electroporation of competent cells: Add 1 μg of plasmid to the competent cells, mix well by pipetting, and place on ice for 30 min; transfer the bacterial solution to a 2 mm precooled electroporation cup on ice, set the electroporation parameters to 2500V 200Ω25μF, and perform electroporation; add 1 mL of antibiotic-free 0233 culture medium to the electroporation cup, mix well by pipetting, and transfer to an EP tube. After puncturing the EP tube, revive the cells in an anaerobic incubator at 35°C for 2 h; dilute the bacterial solution appropriately and spread it on a 0233 agar plate containing 10 μg / mL chloramphenicol; and culture in an anaerobic incubator at 35°C until a single colony grows (36-48 h).

[0039] Positive colonies detected by bacterial liquid PCR:

[0040] PCR primer cat-Check-F: CGACCTCAAGATCAAGTAC

[0041] PCR primer cat-Check-R:TCCTGCATGATAACCATCAC

[0042] PCR primer spect-Check-F:TTCTCTCCCTGTGCCGGGTTCTCCGCCTGTGCGCGTTGTTCTGGCCATGCGAATTCCCATTAAATAATA

[0043] PCR primerspect-Check-R:GGTCGATTTTCGTTCGTGA

[0044] Primers cat-Check-F / cat-Check-R were used to detect Bifidobacterium transformants of p15A-cm-BBori-cat, and primers spect-Check-F / spect-Check-R were used to detect Bifidobacterium transformants of plasmid p15A-cm-BBori-spect.

[0045]

[0046] PCR reaction procedure:

[0047]

[0048] The calculation method of absolute electroporation efficiency in this study was as follows: the bifidobacteria (diluted or undiluted) revived by electroporation were spread on 0233 agar plates with corresponding resistance, and the same Ep tube bacterial solution was diluted 10 5 The cells were plated on 0233 agar plates without antibiotics, and the total number of transformants and the total number of viable bacteria were calculated based on the single colonies grown on the plates. The absolute editing efficiency was calculated according to "absolute editing efficiency = total number of transformants / total number of viable bacteria × 100%".

[0049] Example 1: Improving the electrotransformation efficiency of Bifidobacterium longum using optimized electrotransformation conditions. Figure 1 As shown, we obtained the optimized electroporation conditions:

[0050] We used p15A-cm-BBori-Cat plasmid as substrate to detect the electroporation efficiency of Bifidobacterium longum ( Figure 1 A); Bifidobacterium was inoculated into 0233 medium containing different concentrations of additional NaCl at an inoculum size of 1 / 12 to detect the effect of NaCl concentration in the medium on the growth rate of Bifidobacterium longum ( Figure 1 B); In order to control a single variable, choose OD 600 The data showed that when the NaCl concentration in the culture medium was 0.2 M, the electro-transformation efficiency of Bifidobacterium longum was higher, 0.00008589%, which was about 11 times that of the initial electro-transformation efficiency of 0.00000760% ( Figure 1 C); Under the above optimal conditions, the electrotransformation efficiency of Bifidobacterium longum under different intensities of electric shock voltage (1750V-3000V) was detected. The data showed that when the electric shock voltage was in the range of 1750-3000V, the electrotransformation efficiency of Bifidobacterium longum increased with the increase of voltage. 3000V was determined to be the optimal electric shock voltage parameter for the electrotransformation of Bifidobacterium longum ( Figure 1 D); before electroporation, adding 4 μL of anhydrous ethanol to 100 μL of Bifidobacterium longum competent cells can effectively improve the electroporation efficiency of Bifidobacterium longum ( Figure 1 E); The recovery time of Bifidobacterium after electroporation also has a significant effect on its electroporation efficiency. When the recovery time is 10h, it has a higher electroporation efficiency. Considering that a longer recovery time may be seriously affected by cell autolysis and division, 10h is determined as the final recovery time (1F); After the competent cells of Bifidobacterium longum are mixed with 4μL of anhydrous ethanol and 1μg of plasmid, a series of gradient ice bath times are controlled to detect the changes in electroporation efficiency. The results show that ice bathing is not conducive to improving the electroporation efficiency of Bifidobacterium longum ( Figure 1 G); Considering the differences in the ability of competent cells prepared at different stages of the logarithmic growth phase to accept exogenous DNA, we prepared competent cells of Bifidobacterium longum at different time points after inoculation and compared the electroporation efficiency. The experimental data showed that Bifidobacterium longum cultured for 11 hours after inoculation had a stronger ability to accept exogenous DNA, and the electroporation efficiency could reach 0.00321821% ( Figure 1 H); Under the optimal conditions explored above, we tried to change the washing buffer of the competent cells. Among the four washing buffers of 10% glycerol, SA buffer, water and 20mM CaCl2, the competent cells obtained by washing Bifidobacterium longum with SA buffer had the highest electroporation efficiency of 0.00320469% ( Figure 1 I), which is about 400 times the electroporation efficiency before optimization.

[0051] Summary of experimental results - optimized electrotransformation method for Bifidobacterium:

[0052] (1) Preparation of competent cells: Bifidobacterium was inoculated into 1.2 mL of 0233 medium supplemented with 0.2 M NaCl at a 1 / 12 inoculum volume and grown in an anaerobic chamber at 35°C until the mid-logarithmic phase (OD 600 ≈0.3); centrifuge the cells at 4°C 10000rpm for 1 min, and discard the supernatant; resuspend the cells with 1mL of ice-cold SA buffer, centrifuge at 4°C 10000rpm for 1min, and discard the supernatant; resuspend the cells with 1mL of ice-cold SA buffer, centrifuge at 4°C 10000rpm for 1min, and discard the supernatant; add 90μL of 10% glycerol to the Ep tube.

[0053] (2) Electroporation of competent cells: Add 2 μL of anhydrous ethanol and 1 μg of plasmid to the competent cells and mix well by pipetting; immediately transfer the bacterial solution to a 2 mm electroporation cup, set the electroporation parameters to 3000V 200Ω25 μF, and perform electroporation; add 1 mL of antibiotic-free 0233 culture medium to the electroporation cup, pipette and mix well, and then transfer to an EP tube. After puncturing the EP tube, revive the tube in an anaerobic chamber at 35°C for 10 h; appropriately dilute the bacterial solution and spread it on a 0233 agar plate with a chloramphenicol concentration of 10 μg / mL; and culture in an anaerobic chamber at 35°C until a single colony grows (36-48 h).

[0054] Example 2: Construction of a new Escherichia coli-Bifidobacterium shuttle vector and use of optimized Bifidobacterium longum electrotransformation conditions to improve the electrotransformation efficiency of Bifidobacterium animalis. Figure 2 As shown in the figure, we constructed plasmids p15A-cm-pMB1-cat and p15A-cm-pMB1-spect ( Figure 2 A), the two new plasmids were electroporated into Bifidobacterium longum and the transformation efficiency was 0.0059% and 0.0088% respectively ( Figure 2 B). The p15A-cm-pMB1-cat / p15A-cm-pMB1-spect plasmids were used to electro-transform animal Bifidobacterium. The results showed that the optimized method could increase the electro-transformation efficiency of animal Bifidobacterium by about 27 times ( Figure 2 C).

[0055] Example 3: Using Escherichia coli to heterologously express the methyltransferase methylation plasmid p15A-cm-pMB1-spect from Bifidobacterium adolescentis, the electroporation efficiency of Bifidobacterium longum was further improved. Figure 3 As shown, firstly, the methyltransferase expression plasmid pBBR1-Ptet-BAD1233-AMP and the empty vector pBBR1-AMP ( Figure 3 A), respectively electro-transform Escherichia coli GB05, dilute and spread on a solid LB medium containing 100 μg / mL ampicillin resistance after recovery, select single clones and identify them correctly by PCR, and then obtain the experimental group GB05 expressing BAD-1233 methyltransferase and the control group GB05 not expressing BAD-1233 methyltransferase; respectively electro-transform the Escherichia coli-Bifidobacterium shuttle plasmid p15A-cm-pMB1-spect into the experimental group and the control group obtained above, dilute and spread on a solid LB medium containing 100 μg / mL ampicillin and 10 μg / mL chloramphenicol resistance after recovery, select single clones and identify them; take 30 μL of the correctly identified strain and transfer it to 1.17 mL containing 50 μg / mL ampicillin and 5 μg / mL chloramphenicol Liquid LB medium with mycin resistance was placed in a 37°C shaker for 10 hours, 12 μL of dehydrated tetracycline inducer (2 mg / mL) was added and placed in a 37°C shaker for 1 hour, plasmids were extracted, and methylated p15A-cm-pMB1-spect and pBBR1-Ptet-BAD1233-AMP mixed plasmids and unmethylated p15A-cm-pMB1-spect and pBBR1-AMP mixed plasmids were obtained; 2 μg of each of the two mixed plasmids was electrotransformed into Bifidobacterium longum, and 1 ml of 0233 liquid culture medium without antibiotics was used to recover in an anaerobic box at 35°C for 10 hours, and after dilution, it was spread on 0233 solid culture medium containing 100 μg / mL spectinomycin, and the absolute electrotransformation efficiency was calculated based on the number of single colonies on the plate. The results showed that the plasmid methylated with the methyltransferase BAD-1233 from Bifidobacterium adolescentis can increase the electrotransformation efficiency of Bifidobacterium longum by 1 times ( Figure 3 B).

[0056] In this example, the electrotransformation method of Bifidobacterium longum was successfully optimized, achieving an approximately 400-fold increase in the electrotransformation efficiency of Bifidobacterium longum. The electrotransformation efficiency of Bifidobacterium longum was further increased by using a methylation treatment plasmid. The optimized electrotransformation method significantly increased the electrotransformation efficiency of animal Bifidobacterium longum.

[0057] It should be noted that the above examples are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention is described in detail with reference to the given examples, those skilled in the art may modify or replace the technical solution of the present invention as needed without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. An Escherichia coli-Bifidobacterium shuttle plasmid, characterized in that: The Escherichia coli-Bifidobacterium shuttle plasmid is a shuttle plasmid with chloramphenicol resistance, such as p15A-cm-BBori-cat, p15A-cm-pMB1-cat, or a shuttle plasmid with spectinomycin resistance, such as p15A-cm-BBori-spect and p15A-cm-pMB1-spect; The nucleotide sequence of the shuttle plasmid is shown in SEQ ID NO.1-4.

2. The Escherichia coli-Bifidobacterium shuttle plasmid according to claim 1, characterized in that The Escherichia coli-Bifidobacterium shuttle plasmid is methylated.

3. The Escherichia coli-Bifidobacterium shuttle plasmid according to claim 2, characterized in that The methylation treatment method includes using a methyltransferase to perform methylation modification on the above-mentioned shuttle plasmid; the methyltransferase is the methyltransferase BAD-1233 derived from Bifidobacterium adolescentis ATCC15703.

4. Use of the Escherichia coli-Bifidobacterium shuttle plasmid according to any one of claims 1 to 3 in improving the efficiency of electroporation of Bifidobacterium. Furthermore, the bifidobacterium includes Bifidobacterium longum and Bifidobacterium animalis; preferably Bifidobacterium longum.

5. A method for efficient electrotransformation of bifidobacteria, characterized in that: The method comprises: S1. Preparation of competent cells: inoculate bifidobacteria into a medium containing NaCl and culture to the logarithmic phase, centrifuge and remove the supernatant; resuspend the cells in a buffer, centrifuge and remove the supernatant, and add glycerol; S2. Electroporation of competent cells: Add anhydrous ethanol and plasmids to the competent cells, perform electroporation, and resuscitate the competent cells.

6. The method according to claim 5, characterized in that In step S1, the NaCl concentration is 0.05-0.2M, preferably 0.2M; The logarithmic phase is preferably the mid-logarithmic phase, OD 600 ≈0.3; The buffer is any one of glycerol, SA buffer, water and CaCl2; preferably SA buffer.

7. The method according to claim 5, characterized in that In the step S2, the plasmid is the Escherichia coli-Bifidobacterium shuttle plasmid according to any one of claims 1 to 3.

8. The method according to claim 5, characterized in that In step S2, the amount of anhydrous ethanol added is 2-4% (v / v) of the total electroporation system, preferably 4%; the electric shock voltage intensity in the electric shock treatment is 1500-4000V, further 1750-3000V; most preferably 3000V; the recovery time is 2-10h, preferably 10h.

9. The method according to claim 5, characterized in that The bifidobacterium includes Bifidobacterium longum and Bifidobacterium animalis, and is preferably Bifidobacterium longum.

10. Use of the Escherichia coli-Bifidobacterium shuttle plasmid according to any one of claims 1 to 3 or the method for efficient electrotransformation of Bifidobacterium according to any one of claims 5 to 9 in gene editing of Bifidobacterium.

Images