Method for detecting editing efficiency of plant multi-gene editing vector

Abstract

The invention discloses a method for detecting the editing efficiency of a plant polygene editing vector. Comprising the following steps: (1) designing sgRNA according to a plurality of target genes of a plant to be edited and constructing a plant multi-gene editing vector; (2) transforming the constructed plant polygene editing vector into a hairy root of a plant; (3) identifying hairy roots of positive transgenic plants; (4) detecting the editing efficiency of the plant polygene editing vector; wherein the transformation comprises the following steps: (a) preparing an agrobacterium mycoderm; (b) scratching the root tips of the germinated plant seeds in a 1 / 2CO liquid culture medium to generate wounds; (c) scratching the wound of the seed on an agrobacterium pellicle, and culturing on a 1 / 2CO solid culture medium; and (d) after the wound of the root tip expands, transferring into a 1 / 2 screening culture medium, and continuously culturing to obtain the hairy root of the transgenic plant. Through the detection method, the gRNA can be more effectively screened, so that efficient gene editing is realized, and the experimental period is greatly shortened.

Description

Technical Field

[0001] The present invention relates to a method for detecting plant gene editing efficiency, and in particular to a method for detecting the editing efficiency of a plant multi-gene editing vector, and belongs to the field of detecting plant multi-gene editing efficiency. Background Art

[0002] The development of diversified gene editing tools is an important foundation for conducting gene function research and achieving targeted genetic improvement. Alfalfa is an important forage crop, but the efficiency of alfalfa gene editing needs to be further improved, and it is urgent to develop gene editing tools and detection methods suitable for alfalfa.

[0003] Since alfalfa is an autotetraploid and self-incompatible, it is necessary to use T 0 It is particularly important to obtain homozygous gene-edited materials in the first generation. The selection of gRNA has a great influence on the efficiency of gene editing, and the genetic transformation cycle of alfalfa is long and the efficiency is low. If gRNA screening and evaluation are not performed before stable genetic transformation, the transgenic materials obtained after long-term genetic transformation will not be edited, which greatly increases the workload. Therefore, it is crucial to develop a gRNA detection method. At the same time, the selection of multiple gRNAs will help to obtain homozygous alfalfa gene-edited materials. Therefore, multiple efficient gRNAs are screened through the detection method to achieve efficient gene editing, which will greatly shorten the experimental cycle and reduce the workload.

[0004] Alfalfa is mainly harvested for its aboveground biomass, and its quality decreases rapidly with the onset of reproductive growth. Therefore, delaying the flowering time of alfalfa will help to harvest a larger biomass while ensuring less loss of quality. Using gene editing technology, we study the flowering regulatory genes of alfalfa, analyze the functions of each member, and then create alfalfa materials with appropriate flowering periods to help its agricultural production practice. Summary of the invention

[0005] The main purpose of the present invention is to provide a method for detecting the editing efficiency of a plant multi-gene editing vector, which can more effectively screen gRNA and thus achieve efficient gene editing.

[0006] To achieve the above object, the technical solution adopted by the present invention includes:

[0007] A method for detecting the editing efficiency of a plant multi-gene editing vector, comprising:

[0008] (1) designing sgRNA according to multiple target genes of the plant to be edited and constructing a plant multi-gene editing vector; (2) transforming the constructed plant multi-gene editing vector into plant hairy roots; (3) identifying positive transgenic plant hairy roots; (4) detecting the editing efficiency of the plant multi-gene editing vector; wherein the transformation comprises: (a) preparing an Agrobacterium biofilm; (b) scratching the root tips of germinated plant seeds in a 1 / 2CO liquid culture medium to produce wounds; (c) scratching the wounds of the seeds on the Agrobacterium biofilm and then placing them on a 1 / 2CO solid culture medium for culture; (d) after the root tip wound swells, transferring it to a 1 / 2 screening culture medium for continued culture to obtain transgenic plant hairy roots.

[0009] In a preferred embodiment of the present invention, the composition of the 1 / 2CO liquid culture medium is as follows: each 1L of culture medium contains the following ingredients: 2.215g MS, 15g sucrose, the balance is water, and the pH value is 5.8-6.0.

[0010] In a preferred embodiment of the present invention, the composition of the 1 / 2CO solid culture medium is as follows: each 1L of culture medium contains the following ingredients: 2.215g MS, 15g sucrose, 7g agar powder, and the balance is water. After high-temperature sterilization, 1mL of acetosyringone is added, the final concentration is 100mM, and the pH value is 5.8-6.0.

[0011] In a preferred embodiment of the present invention, the composition of the 1 / 2 screening culture medium is as follows: each 1L of culture medium contains the following ingredients: 2.215g MS, 15g sucrose, 7g agar powder, and the balance is water. After high-temperature sterilization, 500μL Cef and 1mL Hyg are added, and the pH value is 5.8-6.0; wherein the concentration of Cef is 200mg / mL; and the concentration of Hyg is 2.5mg / mL.

[0012] In a preferred embodiment of the present invention, the wounds of the seeds are vertically scratched on the Agrobacterium biofilm and then placed on a 1 / 2CO solid culture medium in a uniform direction. Finally, the 1 / 2 solid CO culture medium is vertically placed in a greenhouse environment with the hypocotyl of the seeds facing downward for cultivation.

[0013] In a preferred embodiment of the present invention, the plant is a legume; preferably, the legume is alfalfa; more preferably, the alfalfa is alfalfa.

[0014] In a preferred embodiment of the present invention, the multigenes in step (1) include: MsTFL1a gene, MsTFL1b gene, MsTFL1c gene and MsBFT gene.

[0015] In a preferred embodiment of the present invention, the sgRNA of the multi-gene editing vector in step (1) comprises:

[0016] (1) a target sequence T1 having a nucleotide sequence as shown in SEQ ID NO.1;

[0017] (2) a target sequence T2 having a nucleotide sequence as shown in SEQ ID NO.2;

[0018] (3) a target sequence T3 having a nucleotide sequence as shown in SEQ ID NO. 3;

[0019] (4) a target sequence T4 having a nucleotide sequence as shown in SEQ ID NO.4;

[0020] (5) a target sequence T5 having a nucleotide sequence as shown in SEQ ID NO.5;

[0021] (6) a target sequence T6 having a nucleotide sequence as shown in SEQ ID NO.6;

[0022] (7) target sequence T7 whose nucleotide sequence is shown in SEQ ID NO.7;

[0023] (8) a target sequence T8 having a nucleotide sequence as shown in SEQ ID NO.8;

[0024] (9) a target sequence T9 having a nucleotide sequence as shown in SEQ ID NO.9;

[0025] (10) a target sequence T10 having a nucleotide sequence as shown in SEQ ID NO.10;

[0026] (11) a target sequence T11 having a nucleotide sequence as shown in SEQ ID NO.11;

[0027] (12) The target sequence T12 whose nucleotide sequence is shown as SEQ ID NO.12.

[0028] In a preferred embodiment of the present invention, in step (3), SEQ ID NO. 13 and SEQ ID NO. 14 are used as specific primers to perform PCR amplification and identify positive transgenic alfalfa hairy roots.

[0029] In a preferred specific embodiment of the present invention, the method for detecting the editing efficiency of the plant multi-gene editing vector in step (4) comprises: designing amplification primers within 100 bp upstream and downstream of the target gene site to perform PCR amplification to obtain the target fragment and perform sequencing, and analyzing and calculating the editing efficiency of the target gene based on the sequencing results.

[0030] The method for detecting the editing efficiency of the plant multi-gene editing vector provided by the present invention has a simpler and faster transformation process. The culture medium used in the transformation process is a 1 / 2CO culture medium or a 1 / 2 screening culture medium that is easy to operate and prepare. By using the detection method, gRNA can be more effectively screened, thereby achieving efficient gene editing and greatly shortening the experimental cycle. The present invention has application prospects in detecting the editing efficiency of editing vectors.

[0031] Definitions of terms used in this invention

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0033] The term "sgRNA expression cassette" refers to a DNA capable of expressing a corresponding sgRNA in a plant cell, which DNA may include not only a promoter for driving the transcription of the coding sequence of the corresponding sgRNA, but also a terminator for terminating the transcription of the coding sequence of the corresponding sgRNA.

[0034] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0035] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0036] The term "gene editing vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, and selection markers engineered to be expressed in plant cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 are the nucleotide sequences of the 12 sgRNAs and their locations on the genes;

[0038] Figure 2 Schematic diagram of the multi-gene editing vector pHSE401-MsU6d1;

[0039] Figure 3 Diagram of the process of transforming alfalfa hairy roots with plant multi-gene editing vectors;

[0040] Figure 4 Statistical graph of editing efficiency of different targets;

[0041] Figure 5 This is a statistical diagram of the efficiency of different editing types for each target. DETAILED DESCRIPTION

[0042] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the scope of protection of the present invention.

[0043] Test Example 1 Construction and identification of positive transgenic plants

[0044] 1 Construction of plant multi-gene editing vector

[0045] Based on the Xinjiang Daye reference genome, primers were designed for the CDS regions of MsTFL1a (MS.gene050329), MsTFL1b (MS.gene73577), MsTFL1c (MS.gene43049) and MsBFT (MS.gene98252). PCR amplification was performed using KOD high-fidelity amplification enzyme and Zhongmu 1 DNA as a template. The PCR products were then ligated to T 0 The vector was transfected into Escherichia coli DH5α and cultured at 37°C for 1 hour. The vector was then spread onto LB solid medium containing kanamycin at a final concentration of 50 μg / mL and placed in a 37°C incubator for overnight culture. After monoclonal plaques appeared, colony PCR was performed using M13F and M13R primers. After confirming successful connection, sequencing was performed and the results were analyzed.

[0046] Based on the sequencing results, sgRNAs were designed in the conserved regions of the genes and screened using the online website CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), resulting in 12 sgRNAs ( Figure 1 ). Based on the alfalfa multi-gene editing vector pHSE401-MsU6d1, the relevant vector construction primers were designed. The intermediate vector pT-gtMsU6g1 / d3 was used as a template to amplify the sgRNA module to obtain the sgRNA-scaffold-AtU6t-tRNA-MsU6 fragment, which was then integrated into the final vector pHSE401-MsU6d1 ( Figure 2 ).

[0047] The nucleotide sequences of the 12 sgRNAs are as follows:

[0048] T1: AACACTAAGCAAGTTTACAATGG (SEQ ID NO.1);

[0049] T2: CCAGATGTCCCTGGCCCTAGTGA (SEQ ID NO. 2);

[0050] T3: CCCTAGTGATCCGTAACCTGAAGG (SEQ ID NO.3);

[0051] T4:CCCCAAGCATGAAAATGACTGTG (SEQ ID NO.4);

[0052] T5: CATGAGGTCCTTCTATACACTGG (SEQ ID NO.5);

[0053] T6: CCCTGATGTTCCTGGCCCTAGTG (SEQ ID NO. 6);

[0054] T7: ACCAAGCCAAGGATTGAGATTGG (SEQ ID NO.7);

[0055] T8: CCTCTTTACACTGGTATTATATT (SEQ ID NO.8);

[0056] T9: CCCTTCCTTCTTCAGTTACCAC (SEQ ID NO.9);

[0057] T10: CCAAGTGTAAGAATGAATGTGAC (SEQ ID NO.10);

[0058] T11: CCTAGTCCTAGTGATCCACATTT (SEQ ID NO.11);

[0059] T12:TCCTAGTGATCCACATTTAAGGG (SEQ ID NO. 12).

[0060] 2 Plant multi-gene editing vector transformation

[0061] The process of transforming alfalfa hairy roots with plant multi-gene editing vectors Figure 3 The following are the specific test steps.

[0062] (1) Biofilm preparation: The successfully constructed plasmid was transferred into Agrobacterium rhizogenes Ar1193. After identification, a small amount of colonies was added to 2 mL of TY liquid medium for small shaking. Cultured at 28°C, 200 rpm for 12 hours. Then, 200-400 μL of the small shaking bacterial solution was spread on the TY solid medium, covering the entire surface of the medium. Then, it was placed in a 28°C incubator for 24 hours. A layer of biofilm was observed on the surface of the medium.

[0063] (2) Seed germination: Disinfect alfalfa seeds with 6% sodium hypochlorite (note that the skin needs to be broken) for 35 minutes, then wash them 5 times with sterile water in a clean bench, and finally spread them on 1 / 2 MS culture medium. Place them in a dark incubator to germinate for 36 hours until the hypocotyl grows to 1-1.5 cm.

[0064] (3) Agrobacterium infection and co-cultivation: After the biofilm and seeds are prepared at the same time, take a small amount of 1 / 2CO liquid culture medium into a culture dish in a clean bench, and put the seeds in. Use a sterilized scalpel to vertically cut 3-5 mm at the root tip to create a wound. Then use sterilized tweezers to pick up the cut seeds, vertically scratch the seed wound on the biofilm, and then place them on the 1 / 2CO solid culture medium in a uniform direction. Agrobacterium can be observed sticking to the root tip cut. After all seeds are processed, the 1 / 2CO culture medium is placed vertically in a greenhouse environment with the hypocotyl facing downward for cultivation.

[0065] (4) Selection culture: After 5 days of culture, the wound can be observed to swell. Then, 1 / 2 of the screening culture medium is transferred and the culture is still placed vertically in the greenhouse. After about 10 days, the hairy roots can be taken for identification. If longer and more hairy roots are needed to meet the needs of subsequent experiments, subculture can be carried out to allow them to continue to grow.

[0066] The formula of the culture medium used above is as follows:

[0067] TY medium: 5g tryptone, 3g yeast extract powder, dilute to 1L, sterilize at 121℃ for 20min. If preparing TY solid medium, add 15g agar powder. Prepare 1M calcium chloride solution, sterilize at 121℃ for 20min, add 10mL sterile 1M calcium chloride solution, 500μL 25mg / mL Rif, 1mL 50mg / mL Kan to each 1L sterilized TY medium.

[0068] 1 / 2MS medium: 2.215g MS, 15g sucrose, 7g agar powder, dilute to 1L, pH 5.8-6.0, high temperature sterilization at 121℃, 20min.

[0069] 1 / 2CO liquid culture medium: 2.215g MS, 15g sucrose, dilute to 1L, pH 5.8-6.0, high temperature sterilization at 121℃, 20min.

[0070] 1 / 2CO solid medium: 2.215g MS, 15g sucrose, 7g agar powder, dilute to 1L, pH 5.8-6.0, after high temperature sterilization at 121℃, 20min, add 1mL 100mM acetosyringone.

[0071] 1 / 2 screening medium: 2.215g MS, 15g sucrose, 7g agar powder, dilute to 1L, pH 5.8-6.0, after high temperature sterilization at 121℃, 20min, add 500μL 200mg / mL Cef and 1mL 2.5mg / mL Hyg.

[0072] Note: Agrobacterium rhizogenes Ar1193 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd. MS: Murashige & Skoog Basal Medium with Vitamins. The pH value was adjusted using 1M KOH solution. Agar powder was added after the pH value was adjusted.

[0073] 3. Identification of positive transgenic plants

[0074] The DNA of the hairy roots was extracted by the CTAB method, and then the specific primers Primer F / Primer R were selected for PCR amplification and identification. The PCR amplification system is shown in Table 1, and the amplification program of the PCR reaction is shown in Table 2. After the PCR was completed, the PCR product was added to a 1% agarose gel and electrophoresed at 220V for 15 minutes. After the electrophoresis was completed, the electrophoresis results were observed in a gel imager to identify the positive hairy roots.

[0075] The nucleotide sequences of primers Primer F and Primer R are as follows:

[0076] Primer F: GTAAAACGACGGCCAGT (SEQ ID NO. 13);

[0077] Primer R: GTAGATCTCATTGATAGCTC (SEQ ID NO. 14).

[0078] Table 1 PCR amplification system

[0079]

[0080] Table 2 PCR amplification program

[0081]

[0082]

[0083] Experimental Example 2 Plant multi-gene editing vector editing efficiency detection test

[0084] 1 Test method

[0085] HI-TOM sequencing technology was used to determine and analyze the editing forms of the target sites. Based on the target site, amplification primers were designed within 100 bp upstream and downstream. T1, T2, and T3 were amplified using primers MsTFL1C-HiTOM-F / MsTFL1C-HiTOM-R, T4 and T5 were amplified using primers MsTFL1A-HiTOM-F1 / MsTFL1A-HiTOM-R1, T6 was amplified using primers MsTFL1A-HiTOM-F2 / MsTFL1A-HiTOM-R2, T7, T8, and T9 were amplified using primers MsTFL1B-HiTOM-F / MsTFL1B-HiTOM-R, T10 was amplified using primers MsBFT-HiTOM-F1 / MsBFT-HiTOM-R1, and T11 and T12 were amplified using primers MsBFT-HiTOM-F2 / MsBFT-HiTOM-R2.

[0086] The nucleotide sequences of primers MsTFL1A-HiTOM-F1 / R1, MsTFL1A-HiTOM-F2 / R2, MsTFL1B-HiTOM-F / R, MsTFL1C-HiTOM-F / R, MsBFT-HiTOM-F1 / R1, and MsBFT-HiTOM-F2 / R2 are as follows:

[0087] MsTFL1A-HiTOM-F1:ggagtgagtacggtgtgcTGTCTCAAGAACCACTAATTG;

[0088] MsTFL1A-HiTOM-R1: gagttggatgctggatggAAATAGAGAATAAACGTGAGAT。

[0089] MsTFL1A-HiTOM-F2: ggagtgagtacggtgtgcCAACTATCATTGTGTGTGTGC;

[0090] MsTFL1A-HiTOM-R2: gagttggatgctggatggCCAGTGCAAGTGTTCTCTTAG。

[0091] MsTFL1B-HiTOM-F: ggagtgagtacggtgtgcCAACCACAAAAATGACTGTAAC;

[0092] MsTFL1B-HiTOM-R: gagttggatgctggatggCATTTCTATAATTATGTATGAGATG。

[0093] MsTFL1C-HiTOM-F: ggagtgagtacggtgtgcAATGTCTGTCACTTACAACACT;

[0094] MsTFL1C-HiTOM-R: gagttggatgctggatggGTTCAAGTTATATGTATAACATACC。

[0095] MsBFT-HiTOM-F1: ggagtgagtacggtgtgcATGTCTAGGCCATTGGAACC;

[0096] MsBFT-HiTOM-R1: gagttggatgctggatggACCCTTGGCTTGTTCATAAC。

[0097] MsBFT-HiTOM-F2: ggagtgagtacggtgtgcACTTGTAGATCATGACAGACC;

[0098] MsBFT-HiTOM-R2: gagttggatgctggatggCCTGGAATATCTGTAACCATC。

[0099] 2 Test results

[0100] The statistical results of the editing efficiency of different targets are as follows Figure 4As shown, the four knockout vectors tested 23, 26, 23, and 20 hairy roots, respectively, and obtained 14, 15, 15, and 14 edited hairy roots, respectively. The average efficiency of T1 was 13.4% (the highest efficiency was 88.0%), the average efficiency of T2 was 4.1% (the highest efficiency was 60.1%), the average efficiency of T3 was 15.5% (the highest efficiency was 88.0%), the average efficiency of T4 was 1.5% (the highest efficiency was 36.6%), the average efficiency of T5 was 6.8% (the highest efficiency was 37.8%), the average efficiency of T6 was 5.7% (the highest efficiency was 28.6%), and the average efficiency of T7 was 1. The average efficiency is 28.5% (the maximum efficiency is 87.2%), the average efficiency of T8 is 2.7% (the maximum efficiency is 29.2%), the average efficiency of T9 is 15.0% (the maximum efficiency is 66.2%), the average efficiency of T10 is 5.4% (the maximum efficiency is 27.8%), the average efficiency of T11 is 10.5% (the maximum efficiency is 80.4%), and the average efficiency of T12 is 5.7% (the maximum efficiency is 39.2%).

[0101] Statistics of different target editing types are as follows Figure 5 As shown, three types of editing, deletion, insertion, and substitution, occurred at each target site; among them, deletion was the main mutation form.

Claims

1. A method for detecting the editing efficiency of a plant multi-gene editing vector, comprising: (1) designing sgRNA according to multiple target genes of the plant to be edited and constructing a plant multi-gene editing vector; (2) transforming the constructed plant multi-gene editing vector into plant hairy roots; (3) identifying positive transgenic plant hairy roots; (4) detecting the editing efficiency of the plant multi-gene editing vector; characterized in that the transformation includes: (a) preparing Agrobacterium biofilm; (b) scratching the root tip of germinated plant seeds in 1 / 2CO liquid culture medium to produce wounds; (c) scratching the wound of the seed on the Agrobacterium biofilm and then placing it on 1 / 2CO solid culture medium for culture; (d) after the root tip wound swells, transferring it to 1 / 2 screening culture medium for further culture to obtain transgenic plant hairy roots.

2. The detection method according to claim 1, characterized in that: The composition of the 1 / 2CO liquid culture medium is as follows: each 1L of the culture medium contains the following ingredients: 2.215g MS, 15g sucrose, the balance is water, and the pH value is 5.8-6.

0.

3. The detection method according to claim 1, characterized in that: The composition of the 1 / 2CO solid culture medium is as follows: each 1L of the culture medium contains the following ingredients: 2.215g MS, 15g sucrose, 7g agar powder, and the balance is water. After high-temperature sterilization, 1mL of acetosyringone is added, and the pH value is 5.8-6.0; wherein the concentration of acetosyringone is 100mM.

4. The detection method according to claim 1, characterized in that: The composition of the 1 / 2 screening culture medium is as follows: each 1L culture medium contains the following ingredients: 2.215g MS, 15g sucrose, 7g agar powder, and the balance is water. After high-temperature sterilization, 500μLCef and 1mL Hyg are added, and the pH value is 5.8-6.0; wherein the concentration of Cef is 200mg / mL; and the concentration of Hyg is 2.5mg / mL.

5. The detection method according to claim 1, characterized in that: The wounds of the seeds were vertically scratched on the Agrobacterium biofilm and then placed on a 1 / 2CO solid culture medium in a uniform direction. Finally, the 1 / 2 solid CO culture medium was vertically placed in a greenhouse environment with the hypocotyl of the seeds facing downward for cultivation.

6. The detection method according to claim 1, characterized in that: The plant is a legume; preferably, the legume is alfalfa; more preferably, the alfalfa is alfalfa.

7. The detection method according to claim 1, characterized in that: The multiple genes described in step (1) include: MsTFL1a gene, MsTFL1b gene, MsTFL1c gene and MsBFT gene.

8. The detection method according to claim 1, characterized in that: The sgRNA of the multi-gene editing vector described in step (1) includes: (1) a target sequence T1 having a nucleotide sequence as shown in SEQ ID NO.1; (2) a target sequence T2 having a nucleotide sequence as shown in SEQ ID NO.2; (3) a target sequence T3 having a nucleotide sequence as shown in SEQ ID NO. 3; (4) a target sequence T4 having a nucleotide sequence as shown in SEQ ID NO.4; (5) a target sequence T5 having a nucleotide sequence as shown in SEQ ID NO.5; (6) a target sequence T6 having a nucleotide sequence as shown in SEQ ID NO.6; (7) target sequence T7 whose nucleotide sequence is shown in SEQ ID NO.7; (8) a target sequence T8 having a nucleotide sequence as shown in SEQ ID NO.8; (9) a target sequence T9 having a nucleotide sequence as shown in SEQ ID NO.9; (10) a target sequence T10 having a nucleotide sequence as shown in SEQ ID NO.10; (11) a target sequence T11 having a nucleotide sequence as shown in SEQ ID NO.11; (12) The target sequence T12 whose nucleotide sequence is shown as SEQ ID NO.

12.

9. The detection method according to claim 1, characterized in that: In step (3), SEQ ID NO. 13 and SEQ ID NO. 14 are used as specific primers to perform PCR amplification and identify positive transgenic alfalfa hairy roots.

10. The detection method according to claim 1, characterized in that: The method for detecting the editing efficiency of the plant multi-gene editing vector described in step (4) includes: designing amplification primers within 100 bp upstream and downstream of the target gene site to perform PCR amplification to obtain the target fragment and perform sequencing, and analyzing and calculating the editing efficiency of the target gene based on the sequencing results.

Images