Application of reagent for activating endogenous gene expression of dendrobium officinale or activating endogenous gene expression of dendrobium officinale in increasing dendrobine content of dendrobium officinale and method

Abstract

The invention provides application of a reagent for activating endogenous gene expression of dendrobium officinale or activating endogenous gene expression of dendrobium officinale in increasing the content of dendrobine in dendrobium officinale and a method, and particularly belongs to the technical field of dendrobine production. According to the application of the reagent for activating the endogenous gene expression of the dendrobium officinale kimura ex migo or activating the endogenous gene expression of the dendrobium officinale kimura ex migo in increasing the dendrobine content of the dendrobium officinale kimura ex migo, the endogenous genes comprise HMGR, MCT, STR1 and CYP94C1; the reagent for activating the endogenous gene expression of dendrobium officinale comprises sgRNA, an expression cassette, a vector or a host cell. By activating the expression of endogenous genes HMGR, MCT, STR1 and CYP94C1 of dendrobium officinale, the yield of dendrobine can be increased, specifically, the content of dendrobine in dendrobium officinale plants can be increased, and an effective way is provided for diversification of dendrobine biological sources.

Description

Technical Field

[0001] The invention belongs to the technical field of dendrobium alkaloid production, and particularly relates to an application and method of an agent for activating the expression of endogenous genes of Dendrobium officinale or activating the expression of endogenous genes of Dendrobium officinale in improving the content of dendrobium alkaloid in Dendrobium officinale. Background Art

[0002] Dendrobium is a sesquiterpenoid alkaloid contained in a few species of Dendrobium. Its content is high in Dendrobium nobile, up to 0.4%, while its content is relatively low in other species of Dendrobium. Currently, a large number of studies have shown that dendrobium has a wide range of biological activities, such as anti-cancer, antioxidant, anti-viral, and liver protection. Due to the cumbersome chemical synthesis steps and high cost, the main source is still extracted from Dendrobium nobile, which is increasingly unable to meet the needs of production and research, and it is urgent to diversify its biological sources.

[0003] Dendrobium catenatum has a low content of dendrobine, which can usually only be detected after treatment with symbiotic bacteria or methyl jasmonate (MeJA), indicating that it contains the reaction substrates required for dendrobine synthesis and has a complete metabolic pathway. Dendrobium catenatum has a large biomass, is relatively easy to genetically transform, has mature artificial propagation technology, and has a wide industrial planting area. It is suitable as a transformation receptor material to increase dendrobine production through gene expression regulation, thereby diversifying the biological sources of dendrobine, alleviating the huge pressure on wild resources and commercial production of Dendrobium catenatum, and further enhancing the development and utilization value of Dendrobium catenatum.

[0004] Using biotechnology to regulate the expression of key genes in metabolic pathways to increase the yield of target compounds is a research hotspot in this field. However, there is still a lack of a molecular regulation method that can effectively increase the content of dendrobine in Dendrobium officinale. Summary of the invention

[0005] The purpose of the present invention is to provide an application and method of an agent for activating the expression of endogenous genes of Dendrobium officinale or activating the expression of endogenous genes of Dendrobium officinale in increasing the content of dendrobine in Dendrobium officinale. By activating the expression of endogenous genes HMGR, MCT, STR1 and CYP94C1 of Dendrobium officinale, the yield of dendrobine can be increased, and specifically the content of dendrobine can be increased in Dendrobium officinale plants, providing an effective way to diversify the biological sources of dendrobine.

[0006] The present invention provides an application of an agent for activating the expression of endogenous genes of Dendrobium officinale or activating the expression of endogenous genes of Dendrobium officinale in improving the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the agent for activating the expression of endogenous genes of Dendrobium officinale includes sgRNA, an expression cassette, a vector or a host cell.

[0007] The present invention also provides an application of a reagent for activating the expression of endogenous genes of Dendrobium officinale using CRISPRa or activating the expression of endogenous genes of Dendrobium officinale using CRISPRa in improving the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the reagent for activating the expression of endogenous genes of Dendrobium officinale using CRISPRa includes sgRNA, an expression cassette, a vector or a host cell.

[0008] The present invention also provides sgRNA for activating the expression of endogenous genes in Dendrobium officinale, wherein the sgRNA includes sgRNA for MCT: MCTsgRNA1 and MCTsgRNA2, sgRNA for HMGR: HMGRsgRNA1 and HMGRsgRNA2, sgRNA for STR1: STR1sgRNA1 and STR1sgRNA2, and sgRNA for CYP94C1: CYP94C1sgRNA1 and CYP94C1sgRNA2;

[0009] The nucleotide sequence of the MCTsgRNA1 is shown in SEQ ID NO.1; the nucleotide sequence of the MCTsgRNA2 is shown in SEQ ID NO.2; the nucleotide sequence of the HMGRsgRNA1 is shown in SEQ ID NO.3; the nucleotide sequence of the HMGRsgRNA2 is shown in SEQ ID NO.4; the nucleotide sequence of the STR1sgRNA1 is shown in SEQ ID NO.5; the nucleotide sequence of the STR1sgRNA2 is shown in SEQ ID NO.6; the nucleotide sequence of the CYP94C1sgRNA1 is shown in SEQ ID NO.7; the nucleotide sequence of the CYP94C1sgRNA2 is shown in SEQ ID NO.8.

[0010] The present invention also provides an expression cassette for activating the expression of endogenous genes in Dendrobium officinale, wherein the expression cassette comprises sgRNA targeting MCT, sgRNA targeting HMGR, sgRNA targeting STR1 and sgRNA targeting CYP94C1 among the sgRNAs described in the above technical solution.

[0011] Preferably, the expression cassette further comprises a CRISPRa transcriptional activation domain.

[0012] The present invention also provides a vector for activating the expression of endogenous genes in Dendrobium officinale, wherein the vector comprises the expression cassette described in the above technical solution.

[0013] Preferably, the vector is a plant expression vector containing a dCas9 transcriptional activation element.

[0014] The present invention also provides a host cell for activating the expression of endogenous genes of Dendrobium officinale, wherein the host cell comprises the vector described in the above technical solution.

[0015] The present invention also provides a method for increasing the content of dendrobium alkaloids in Dendrobium officinale by activating endogenous gene expression in Dendrobium officinale by using CRISPRa, comprising the following steps: constructing a vector containing the sgRNA described in the above technical solution; and transforming Dendrobium officinale with the vector.

[0016] Preferably, the transformation comprises transforming the stem nodes and stem base of the seedlings of Dendrobium officinale, or transforming the protoplasts or mesophyll cells of Dendrobium officinale.

[0017] The present invention provides an application of an agent for activating endogenous gene expression of Dendrobium officinale or activating endogenous gene expression of Dendrobium officinale in improving the content of dendrobine in Dendrobium officinale. The present invention uses Dendrobium officinale as a material, four key genes HMGR, MCT, STR1 and CYP94C1 in the dendrobine synthesis pathway as targets, designs sgRNA (two sgRNAs for each gene), constructs a CRISPRa transcription activation vector, transforms Agrobacterium and introduces it into Dendrobium officinale, and obtains transgenic materials with endogenous key gene expression activation and increased dendrobine production. The method established by the present invention provides an effective way to diversify the biological sources of dendrobine.

[0018] The present invention uses CRISPRa to activate the expression of four endogenous genes at the same time, and systematically evaluates the effect of activating endogenous gene expression on the content of dendrobium in transient systems (protoplasts, two experiments of leaf transient transformation) and stable transgenic plants, and uses LC / MS to do the qualitative and absolute quantitative analysis of dendrobium. The present invention applies CRISPRa to the regulation of endogenous gene expression in Dendrobium officinale, improves the yield of dendrobium, and achieves remarkable results. Dendrobium is difficult to transform, has a long growth period, and is difficult to achieve genetic manipulation. However, the present invention does achieve genetic transformation through gene combination, obtains transgenic plants, and achieves an increase in the content of dendrobium. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0020] Figure 1The results of testing the effectiveness of sgRNA using the protoplast system of Dendrobium officinale mesophyll cells provided by the present invention are shown in Figure 1; wherein, A: a schematic diagram of 8 sgRNA tandem expression cassettes for 4 genes; B: a diagram of the expression results of target genes in protoplasts of Dendrobium officinale mesophyll cells detected by qRT-PCR;

[0021] Figure 2 The results of testing the CRISPRa working efficiency of the transient expression system of Dendrobium officinale mesophyll cells provided by the present invention are shown in Figure 1; wherein, A: the results of qRT-PCR detection of the activation efficiency of endogenous gene expression by CRISPRa; B: the results of the determination of the content of dendrobium alkaloids in leaves transiently expressing CRISPRa;

[0022] Figure 3 The molecular identification result diagram of the CRISPRa transgenic plants provided by the present invention; wherein, A: the identification result diagram of the CRISPRa transgenic positive plants; B: the identification result diagram of the CRISPRa control vector transgenic control positive plants; C: the identification result diagram of the genomic PCR positive plants;

[0023] Figure 4 The present invention provides target gene expression and dendrobium content determination results in the CRISPRa transgenic plants; A: a growth diagram of two-year-old transgenic positive Dendrobium officinale plants; B: a diagram of qRT-PCR expression detection results of target genes in CRISPRa transgenic plants; C: a diagram of qRT-PCR detection results of FPPS expression, a key gene in the dendrobium biosynthesis pathway; D: a diagram of comparative analysis of dendrobium content in CRISPRa (8sgRNA) and CRISPRa (EV) transgenic positive plants without sgRNA. DETAILED DESCRIPTION

[0024] The present invention provides an application of an agent for activating the expression of endogenous genes of Dendrobium officinale or activating the expression of endogenous genes of Dendrobium officinale in improving the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the agent for activating the expression of endogenous genes of Dendrobium officinale includes sgRNA, an expression cassette (containing a CRISPRa transcriptional activation domain (reference Addgene vector number: 158408)), a vector or a host cell. The present invention targets four key genes HMGR (LOC110098248), (LOC110098284), STR1 (LOC110104837) and CYP94C1 (LOC110116548) in the dendrobine synthesis pathway, activates the expression of the target genes, and can achieve the improvement of the content of dendrobine in Dendrobium officinale.

[0025] The present invention also provides an application of an agent for activating the expression of endogenous genes of Dendrobium officinale by CRISPRa or activating the expression of endogenous genes of Dendrobium officinale by CRISPRa in improving the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the agent for activating the expression of endogenous genes of Dendrobium officinale by CRISPRa includes sgRNA, expression cassette, vector or host cell. In a specific embodiment, Dendrobium officinale is used as a material, and four key genes HMGR, MCT, STR1 and CYP94C1 in the dendrobine synthesis pathway are used as targets, sgRNA is designed (two sgRNAs for each gene), and a CRISPRa transcription activation vector is constructed, transformed with Agrobacterium and introduced into Dendrobium officinale, so as to produce a transgenic material that can activate the expression of endogenous key genes and increase the yield of dendrobine.

[0026] The present invention also provides sgRNA for activating the expression of endogenous genes in Dendrobium officinale, wherein the sgRNA includes sgRNA for MCT: MCTsgRNA1 and MCTsgRNA2, sgRNA for HMGR: HMGRsgRNA1 and HMGRsgRNA2, sgRNA for STR1: STR1sgRNA1 and STR1sgRNA2, and sgRNA for CYP94C1: CYP94C1sgRNA1 and CYP94C1sgRNA2; the nucleotide sequence of the MCTsgRNA1 is as shown in SEQ ID NO.1: 5'-GATGCAAGAAAGAAAACCTA-3'; the nucleotide sequence of the MCTsgRNA2 is as shown in SEQ ID NO.2: 5'-TCTACGCGGGATCCGGCCTT-3'; the nucleotide sequence of the HMGRsgRNA1 is as shown in SEQ ID NO.3: 5'-ACCGCGGAGCAAGAGAAAAG-3'; the nucleotide sequence of the HMGRsgRNA2 is shown in SEQ ID NO.4: 5'-ATCAGGAGGCGGGTGTGTAG-3'; the nucleotide sequence of the STR1sgRNA1 is shown in SEQ ID NO.5: 5'-GCTTTTCCCGCGAATACCTT-3'; the nucleotide sequence of the STR1sgRNA2 is shown in SEQ ID NO.6: 5'-AAAGCCGCCAAAGGTATTCG-3'; the nucleotide sequence of the CYP94C1sgRNA1 is shown in SEQ ID NO.7: 5'-GGGCGGCTCTGGGCAATGAT-3'; the nucleotide sequence of the CYP94C1sgRNA2 is shown in SEQ ID NO.8: 5'-CGGCTCTGGGCAATGATGGG-3'. The present invention does not specifically limit the source of sgRNA, and it can be synthesized by entrusting a company, such as entrusting BGI Guangzhou Branch to synthesize.

[0027] The present invention also provides an expression cassette for activating the expression of endogenous genes in Dendrobium officinale, the expression cassette comprising sgRNA for MCT, sgRNA for HMGR, sgRNA for STR1 and sgRNA for CYP94C1 in the sgRNA described in the above technical solution. In a specific embodiment, the expression cassette further comprises a CRISPRa transcriptional activation domain.

[0028] The present invention also provides a vector for activating the expression of endogenous genes in Dendrobium officinale, wherein the vector comprises the expression cassette described in the above technical solution. In a specific embodiment, the vector is a plant expression vector containing a dCas9 transcriptional activation element. In a specific embodiment, the plant expression vector comprises pYPQ-dpcocas9-Act3.0 (Addgene No.: 158408). The present invention does not specifically limit the method for constructing the vector, and a conventional vector construction method can be used, such as the article CRISPR-Act3.0 for highly efficient multiplexed gene activation in plants disclosed by Changtian Pan et al. In a specific embodiment, the present invention connects 8 sgRNAs to the entry vector pYPQ146-ZmUbi-tRNA (Addgene No.: 158404) by a one-step Goldengate reaction (Golden Gate Assembly Kit, NEB, E1601S), and then uses a multiple LR reaction (LR CLONASE II ENZYME MIX, Invitrogen, 11791020) to further connect the expression cassette containing 8 sgRNAs to the plant expression vector pYPQ-dpcocas9-Act3.0 containing the dCas9 transcription activation element to obtain a plasmid containing 8 sgRNAs, referred to as 8 sgRNA.

[0029] The present invention also provides a host cell for activating the expression of endogenous genes of Dendrobium officinale, wherein the host cell comprises the vector described in the above technical solution. In a specific embodiment, the vector of the present invention can be transferred into the host cell by Agrobacterium-mediated method.

[0030] The present invention also provides a method for activating endogenous gene expression of Dendrobium officinale by using CRISPRa to increase the content of dendrobine in Dendrobium officinale, comprising the following steps: constructing a vector containing the sgRNA described in the above technical solution; and transforming the vector into Dendrobium officinale. In a specific embodiment, the transformation includes transforming the seedling stem nodes and stem base of Dendrobium officinale, or transforming the protoplasts or mesophyll cells of Dendrobium officinale.

[0031] To further illustrate the present invention, the following is a detailed description of the application and method of the reagent for activating the expression of endogenous genes in Dendrobium officinale or activating the expression of endogenous genes in Dendrobium officinale provided by the present invention in improving the content of dendrobine in Dendrobium officinale in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1

[0033] 1. Plant materials:

[0034] One-year-old seedlings of Dendrobium catenatum were artificially propagated by the Shenzhen Orchid Plant Protection Research Center, planted in plastic cups with bark matrix, and cultured under natural light, 25°C during the day / 18°C at night, and 60% humidity. Protoplasts were prepared from young leaves, and the plasmid containing 8sgRNA was transformed into the protoplasts. Agrobacterium containing the plasmid containing 8sgRNA was injected into young leaves for transient expression. For stable genetic transformation, stem segment injection method was used for in vivo genetic transformation.

[0035] 2. Construction of vector (plasmid containing 8sgRNA, referred to as 8sgRNA):

[0036] We commissioned BGI Guangzhou Branch to synthesize sgRNA (4 target genes, 2 sgRNAs for each gene, sequences shown in Table 1) and gR2.0 backbone, and connected 8 sgRNAs to entry vector pYPQ146-ZmUbi-tRNA (Addgene No.: 158404) by one-step Goldengate reaction (Golden Gate Assembly Kit, NEB, E1601S), and then further connected the expression cassette containing 8 sgRNAs to the plant expression vector pYPQ-dpcocas9-Act3.0 (Addgene No.: 158408) containing dCas9 transcriptional activation element by multiple LR reaction (LR CLONASE II ENZYME MIX, Invitrogen, 11791020) to obtain 8 sgRNA vector. Empty vector EV was used as control.

[0037] The vector backbone and construction method are conventional methods, and the reference is the article CRISPR-Act3.0 for highly efficient multiplexed gene activation inplants published by Changtian Pan et al.

[0038] The nucleotide sequence of the gR2.0 backbone is shown in SEQ ID NO.9:

[0039] 5'-GTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCC TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGAT CACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTT-3'.

[0040] Table 1 Sequence information

[0041]

[0042] 3. Preparation and transformation of protoplasts of Dendrobium officinale mesophyll cells:

[0043] Take 10 to 20 young leaves of Dendrobium candidum and cut them into pieces with a scalpel. Place the material in a culture dish containing cellulase and pectinase enzymatic hydrolysis solution, protect from light, and slowly shake on a low-speed shaker for 5.5 hours. Add an equal volume of W5 solution (containing 5mM glucose, 2mM MES, 154mM NaCl, 125mM CaCl 2 After terminating the enzymatic reaction, the cells were filtered into a 50 mL centrifuge tube using a 40-70 μm filter membrane and centrifuged at 100 g for 4 min. The cells were washed three times with W5 solution, 30 mL of W5 solution was added, and the cells were placed on ice for 20 min. MMG solution (containing 4 mM MES, 0.5 M mannitol, and 15 mM MgCl) was used to remove the cells. 2 ) replace the W5 solution to prepare protoplasts. Take 100 μl of the prepared protoplasts, add 10 μg of the plasmid containing 8sgRNA (8sgRNA vector) prepared in step 2, 110 μl of PEG solution, invert and mix well, and let stand at room temperature for 5 minutes. Add 800 μl of W5 solution to suspend the cells, 100g, and centrifuge at a constant speed for 1 minute. Add 1 mL of W5 solution, suspend the cells and transfer to a 2 mL centrifuge tube, and culture in a 25°C incubator for 24 hours.

[0044] 4. Gene expression detection and analysis methods:

[0045] Total RNA from leaves or mesophyll protoplasts was extracted using a plant total RNA extraction kit (0416-50gk, Huayueyang Company). 0.5 μg RNA was used for reverse transcription (PrimeScript TM RT reagent kit, RR047B, Takara). Real time fluorescence quantitative PCR (Thermo Fisher Scientific) and Green qPCR MasterMix reagent (MT521-03, Beijing Bomade) were used to detect the expression of the target gene. The detection primers are shown in Table 2. Using D. candidum DcActin7 (LOC110111141) as the internal reference gene, the detection of FPPS, a marker gene of the dendrobium biosynthesis pathway, was used to determine whether the dendrobium biosynthesis pathway was in an activated state. According to 2 -ΔΔCt The relative expression level was calculated.

[0046] Table 2 Real time fluorescence quantitative PCR primers

[0047]

[0048] 5. Determination of Dendrobium alkaloid content:

[0049] Dendrobium alkaloid standard (CAS, 2115-91-5) was purchased from China Food and Drug Inspection Institute. The detection instrument was Agilent 1260 high performance liquid chromatograph connected to 6420A mass spectrometer (1260-6420A). The leaf samples were sterilized at 100°C and dried in an oven at 80°C. Weigh 0.25g of the sample into a centrifuge tube, add 10mL of methanol solution containing 0.05% formic acid into the centrifuge tube, and extract ultrasonically at room temperature for 30min. Centrifuge at 5000rpm and take the supernatant for testing. The residue was extracted twice with 10mL and 5mL of methanol solution containing 0.05% formic acid, respectively, and the extracts were combined for testing. Chromatographic conditions were as follows: GL Science InertSustain C18 column (3 μm, 2.1×150 mm); column temperature 35°C; injection volume 2 μL; flow rate 0.3 mL / min; detection wavelength 250 nm; detection wavelength 250 nm; mobile phase was formic acid solution or acetonitrile. Mass spectrometry parameters were as follows: Gas Temperature 350°C; Gas Flow 10 L / min; Nebulizer 45 psi; Capillary 4000 V.

[0050] 6. Genomic PCR analysis:

[0051] Take the leaves of plants (Dendrobium officinale) transformed with 8sgRNA and control EV as samples, and extract genomic DNA. The plant hygromycin resistance gene HPTII was used as a molecular marker to indicate that the plant was transgenic positive; the wild-type leaf DNA template was used as a negative control; and the plasmid containing 8sgRNA was used as a positive control. In order to exclude Agrobacterium contamination, PCR amplified the Agrobacterium resistance gene NPTII. Take about 100 mg of transformed plant leaves as samples and grind them in liquid nitrogen. Use the plant genome purification kit (Tiangen Bio, DP350-03) to extract DNA. Use genomic PCR to amplify the 400bp target fragment HPTII, and the primers are shown in Table 3. Amplify the 200bp NPTII kanamycin resistance gene to exclude Agrobacterium contamination. Amplify the 200bp ACTIN-7 fragment, and its brightness indicates the amount of sample loaded. The enzyme used for PCR amplification is PCR SuperMix (Tiangen Biotechnology, AS111-12). PCR products were separated and visualized using 1.5% agarose gel electrophoresis.

[0052] Table 3 Genomic PCR primers

[0053]

[0054] 7. Data analysis methods:

[0055] All data were organized into tables using GraphPadPrism8 software, and statistical analysis and graphing were performed using the software. All data are expressed as mean ± standard deviation. Student's t-test was used to analyze the significance of the differences between each treatment group and the control group, and p < 0.05 was considered significant.

[0056] result

[0057] 1. Using the Dendrobium officinale mesophyll cell protoplast system to prove that CRISPRa effectively activates endogenous gene expression:

[0058] The key genes MCT, HMGR, STR1, and CYP94C1 in the dendrobium biosynthesis pathway were selected as target genes, and sgRNA primers were designed using CRISPOR software (http: / / crispor.gi.ucsc.edu / ). Two sgRNAs were designed for each target gene, for a total of 8 sgRNAs, which were then constructed into the same plant expression vector with the transcriptional activation element CRISPRa and named 8sgRNA (e.g. Figure 1 Each sgRNA contains a tRNA cleavage site, which can undergo self-cleavage in vivo to generate multiple sgRNAs that can function independently.

[0059] tRNA sequence:

[0060] AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA, SEQ ID NO. 28.

[0061] In order to verify the working efficiency of sgRNA, the present invention first constructed a protoplast system of Dendrobium officinale leaf flesh cells, and tested the working efficiency of sgRNA by transforming 8sgRNA expression plasmids. The results showed that compared with cells transformed with the control plasmid (EV) without sgRNA, the relative expression of the target genes in the 8sgRNA transformation group was upregulated to varying degrees at the four target sites, among which the MCT gene had the highest upregulated expression level ( Figure 1 These results indicate that 8sgRNA can exert transcriptional activation function in vivo and can be further used for plant genetic transformation.

[0062] Figure 1This is a diagram showing the results of testing the effectiveness of sgRNA using the mesophyll cell protoplast system of Dendrobium officinale; A: a schematic diagram of 8 sgRNA tandem expression cassettes targeting 4 genes, in which sgRNAs are expressed under the drive of the same ZmUbiquitin promoter, and then multiple sgRNAs are generated in vivo through tRNA self-cleavage; B: qRT-PCR detection of target gene expression in mesophyll cell protoplasts of Dendrobium officinale to test the effectiveness of sgRNA.

[0063] 2. Using the transient expression system of Dendrobium officinale mesophyll cells to prove that CRISPRa effectively activates gene expression and increases dendrobine production:

[0064] After using the mesophyll cell protoplast system to prove that the designed 8sgRNA can effectively activate the expression of the target gene, the mesophyll cell transient expression system was further used to prove the transcriptional regulation of the target gene by CRISPRa and the effect on the increase of dendrobium content. Samples were taken 24 hours after the leaves were injected with Agrobacterium, and the total RNA was extracted and reverse transcribed into cDNA. The gene expression level was detected by qRT-PCR. The results showed that the four target genes were all up-regulated to varying degrees, indicating that CRISPRa can effectively activate the expression of the target genes ( Figure 2 A in the figure). Five days after transformation, the leaves of the transformed plants were collected as samples, dried, ground, and extracted, and then the content of dendrobium was determined by LC / MS. The results showed that compared with the control without sgRNA, the content of dendrobium in the 8sgRNA transformed group was significantly increased ( Figure 2 The above results indicate that CRISPRa can be effectively expressed in mesophyll cells of Dendrobium officinale, transcriptionally activate target genes, increase expression levels, and thus further increase the content of dendrobium alkaloid end products.

[0065] Figure 2 The results of testing the CRISPRa working efficiency of the transient expression system in Dendrobium officinale mesophyll cells; A: qRT-PCR detection of the activation efficiency of CRISPRa on endogenous gene expression (samples 1 day after transformation); B: Determination of dendrobium alkaloid content in leaves transiently expressing CRISPRa (LC / MS determination, samples 5 days after transformation).

[0066] 3. CRISPRa stable transformation of Dendrobium officinale materials creation:

[0067] Agrobacterium-mediated in planta transformation was used to inject Agrobacterium containing CRISPRa (8sgRNA) and control plasmids without sgRNA into the stem nodes and bases of seedlings to obtain regenerated buds. Before injection, all visible buds and stem tips on the plants were removed, and Agrobacterium containing 8sgRNA or control plasmids were injected into the stem nodes and stem bases using a 1mL syringe. After the injection, the stem segments were transplanted back into the bark matrix and covered with plastic film for 2 days to keep them moist, which was conducive to the genetic transformation of Agrobacterium into the stem stem cells of the nodes.

[0068] The molecular identification of the one-year-old regenerated buds was performed, and three 8sgRNA transformants were obtained ( Figure 3 A), control EV transformed strain 2 ( Figure 3 B in the figure). The results of genomic PCR molecular identification showed that the positive plants identified did not contain Agrobacterium contamination, and the Agrobacterium resistance gene NPTII could not be effectively amplified ( Figure 3 C) Through in vivo genetic transformation, the present invention quickly obtains candidate transgenic positive plants for further molecular identification and tracking.

[0069] Figure 3 The figure shows the results of molecular identification of CRISPRa transgenic plants; A: identification of CRISPRa transgenic positive plants (small arrows indicate CRISPRa-transformed positive plants); B: identification of CRISPRa control vector (without sgRNA) transgenic positive plants (small arrows indicate empty vector-transformed positive plants); C: genomic PCR identification of positive plants; the hygromycin resistance screening gene hptII expressed on the same vector as CRISPRa was used as a molecular identification marker; the wild-type Dendrobium officinale genome was used as a negative control (-); the CRISPRa plasmid was used as a positive control (+). In order to exclude Agrobacterium contamination, the kanamycin resistance gene nptII expressed in Agrobacterium was also detected, and no bands were amplified, indicating that there was no Agrobacterium contamination.

[0070] 4. CRISPRa activates target gene expression and increases dendrobium production in stable transgenic plants:

[0071] The positive plants obtained by molecular identification were cultured together, which was beneficial to the growth of transgenic plants and could effectively avoid the interference of wild-type plants. There was no obvious difference in phenotype between the two-year-old 8sgRNA-transformed plants and the EV control transgenic plants ( Figure 4 A in the figure). Young leaves of plants were taken as samples, total RNA was extracted and reverse transcribed to obtain cDNA, and qRT-PCR was used to detect the expression of endogenous target genes. The results showed that the expression level of STR1 gene was significantly upregulated, while the expression levels of other genes did not change significantly or were downregulated ( Figure 4 B in the figure). Further detection of the expression of FPPS, a marker gene of the dendrobium biosynthesis pathway, revealed that its expression was upregulated, indicating that the dendrobium biosynthesis pathway was in an activated state ( Figure 4 C in the figure). Furthermore, the leaves of the 8sgRNA and EV control transformed plants were taken as samples, and the dendrobium content was extracted and determined by LC / MS. The results showed that the content of dendrobium in the 8sgRNA transgenic plants was significantly higher than that in the control ( Figure 4 In summary, the present invention designs multiple tandemly expressed sgRNAs for endogenous genes of Dendrobium officinale, and demonstrates the effectiveness of CRISPRa transcriptional activation of gene expression in transient systems and stable transgenic plants, thereby significantly improving the efficiency of dendrobine biosynthesis.

[0072] Figure 4 The following are the results of target gene expression and dendrobium content determination in CRISPRa transgenic plants; A: Growth of two-year-old transgenic positive plants of Dendrobium officinale; B: qRT-PCR expression detection of target genes in CRISPRa transgenic plants, with the vector without sgRNA as the control (EV); C: qRT-PCR detection of FPPS expression, a key gene in the dendrobium biosynthesis pathway; D: Comparative analysis of dendrobium content in CRISPRa (8sgRNA) and CRISPRa (EV) transgenic positive plants without sgRNA (LC / MS determination).

[0073] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of an agent for activating the expression of endogenous genes in Dendrobium officinale or activating the expression of endogenous genes in Dendrobium officinale in increasing the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the agent for activating the expression of endogenous genes in Dendrobium officinale includes sgRNA, an expression cassette, a vector or a host cell.

2. An application of an agent for activating the expression of endogenous genes of Dendrobium officinale using CRISPRa or activating the expression of endogenous genes of Dendrobium officinale using CRISPRa in improving the content of dendrobine in Dendrobium officinale; the endogenous genes include HMGR, MCT, STR1 and CYP94C1; the agent for activating the expression of endogenous genes of Dendrobium officinale using CRISPRa includes sgRNA, expression cassette, vector or host cell.

3. sgRNAs for activating the expression of endogenous genes in Dendrobium officinale, the sgRNAs including sgRNAs for MCT: MCTsgRNA1 and MCTsgRNA2, sgRNAs for HMGR: HMGRsgRNA1 and HMGRsgRNA2, sgRNAs for STR1: STR1sgRNA1 and STR1sgRNA2, and sgRNAs for CYP94C1: CYP94C1sgRNA1 and CYP94C1sgRNA2; The nucleotide sequence of the MCTsgRNA1 is shown in SEQ ID NO.1; the nucleotide sequence of the MCTsgRNA2 is shown in SEQ ID NO.2; the nucleotide sequence of the HMGRsgRNA1 is shown in SEQ ID NO.3; the nucleotide sequence of the HMGRsgRNA2 is shown in SEQ ID NO.4; the nucleotide sequence of the STR1sgRNA1 is shown in SEQ ID NO.5; the nucleotide sequence of the STR1sgRNA2 is shown in SEQ ID NO.6; the nucleotide sequence of the CYP94C1sgRNA1 is shown in SEQ ID NO.7; the nucleotide sequence of the CYP94C1sgRNA2 is shown in SEQ ID NO.

8.

4. An expression cassette for activating endogenous gene expression in Dendrobium officinale, characterized in that: The expression cassette includes the sgRNA targeting MCT, the sgRNA targeting HMGR, the sgRNA targeting STR1, and the sgRNA targeting CYP94C1 among the sgRNAs described in claim 3.

5. The expression cassette according to claim 4, characterized in that The expression cassette also includes a CRISPRa transcriptional activation domain.

6. A vector for activating the expression of endogenous genes in Dendrobium officinale, characterized in that: The vector comprises the expression cassette of claim 4 or 5.

7. The carrier according to claim 6, characterized in that The vector is a plant expression vector containing a dCas9 transcription activation element.

8. A host cell for activating the expression of endogenous genes of Dendrobium officinale, characterized in that: The host cell comprises the vector according to claim 6 or 7.

9. A method for increasing the content of dendrobium alkaloids in Dendrobium officinale by activating endogenous gene expression in Dendrobium officinale using CRISPRa, characterized in that: The following steps are involved: Constructing a vector containing the sgRNA according to claim 3; and transforming Dendrobium officinale with the vector.

10. The method according to claim 9, characterized in that The transformation includes transforming the stem nodes and stem base of the seedlings of Dendrobium officinale, or transforming the protoplasts or mesophyll cells of Dendrobium officinale.

Images