Application of OsCNGC10 gene in regulating and controlling salt tolerance of rice

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cyclic nucleotide gated ion channel OsCNGC10 gene for regulating and controlling the salt tolerance of rice and an application of the cyclic nucleotide gated ion channel OsCNGC10 gene. The invention discloses an application of an OsCNGC10 gene in salt stress resistance of rice. A nucleotide sequence of the OsCNGC10 gene is shown as SEQ ID NO.1, and the OsCNGC10 gene negatively regulates the salt tolerance of the rice. Specifically, the rice over-expressed with the OsCNGC10 gene is more sensitive to salt stress, and the tolerance of the rice to the salt stress is improved by knocking out the OsCNGC10 gene. The rice cyclic nucleotide gated ion channel protein OsCNGC10 enriches the functions of the rice cyclic nucleotide gated ion channel protein OsCNGC10 in rice adversity stress, and provides a new gene resource for salt-resistant rice cultivation.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of OsCNGC10 gene in regulating the salt tolerance of rice. Technical Background

[0002] Rice (Oryza sativa L.) is one of the three major staple crops in the world. More than 65% of the population in my country relies on rice as their staple food. With the increase in population and the reduction in available land, the contradiction between food supply and demand is becoming increasingly prominent. In the process of rice production, salt stress is one of the most serious adversities affecting its yield. Due to the high concentration of soluble salts in the soil, crop growth and development are poor, and dry matter accumulation is reduced, resulting in a decrease in crop yield. According to statistics, the global area of ​​saline-alkali land exceeds 800 million hectares, of which more than 100 million hectares of agricultural land in China are affected by salinization to varying degrees, seriously endangering food security. Salt tolerance in rice is a quantitative trait controlled by multiple genes and involves many complex physiological processes (Hamam, AM, Coskun, D., Britto, DT, Plett, D. and Kronzucker, HJ (2019) Plasma-membrane electrical responses to salt and osmotic gradients contradict radiotracer kinetics, and reveal Na+-transport dynamics in rice (Oryza sativa L.). Planta 249, 1037-1051.). At present, the main problem in the identification and gene utilization of rice salt-tolerant germplasm resources is the limited number of major salt-tolerant genes. How to accurately discover new salt-tolerant genes is an important issue facing current rice germplasm resource research. Therefore, the use of molecular breeding technology to cultivate salt-tolerant rice varieties is of great significance to improving the utilization rate of salinized soil, expanding the rice planting area, and ensuring food security.

[0003] OsCNGC10 belongs to the cyclic nucleotide-gated channel (CNGC) gene family. Cyclic nucleotide-gated ion channels are ligand-gated cation channels that are mainly distributed on the plasma membrane (Chin, Kimberley, Moeder, et al. Biological roles of cyclic-nucleotide-gatedion channels in plants: What we know and don't know about this 20 member ion channel family. [J]. Botany, 2009., 77. Ma W, Qi Z, Smigel A, et al. Ca2+, cAMP, and transduction of non-self perception during plant immune responses [J]. PNAS, 2009, 106 (49): 20995-21000). They exist in animals and plants and are an important component of the signal cascade reaction of eukaryotic organisms. The discovery of cyclic adenosine monophosphate (cAMP) originated from the study of the effects of epinephrine and glucagon on the activity of glycogen phosphorylase in dog liver (Rall TW, Sutherland EW, Berthet J. THE RELATIONSHIP OF EPINEPHRINE AND GLUCAGON TO LIVER PHOSPHORYLASE [J]. Journal of Biological Chemistry, 1957, 224 (1): 463-475). CNGCs are a group of ion transport proteins that exist in many plants, including Arabidopsis, barley, rice and tobacco. They are only active when bound to cyclic nucleotides, which makes them potential targets for second messenger cyclic nucleotides.

[0004] In recent years, researchers have verified the functions of CNGCs by overexpression or mutation in plants. Kaplan et al. identified and analyzed the CNGC family of the model plant Arabidopsis thaliana and found that there are 20 members in the CNGCs family of Arabidopsis thaliana, which are distributed in various tissues and organs of Arabidopsis thaliana, participate in the growth and development of Arabidopsis thaliana, and perform certain functions in response to external environmental stimuli (Arazi T, Kaplan B, Fromm HA high-affinity calmodulin-binding site in a tobacco plasma-membrane channel protein coincides with a characteristic element of cyclic nucleotide-binding domains [J]. Plant Molecular Biology, 2000, 42 (4): 591-601, Arazi T, Sunkar R, Kaplan B, et al. A tobacco plasma membrane calmodulin-binding transporter confers Ni2+ tolerance and Pb2+ hypersensitivity in transgenic plants [J]. The Plant Journal, 1999, 20 (2): 171-182). Finka et al. found that mutations in GNGCb, which is homologous to the Arabidopsis gene AtCNGC2, in Physcomitrella patens showed a phenotype similar to that of the AtCNGC2 deletion mutant; the functional loss of GNGCb led to a significant enhancement of Ca2+ influx under high temperature stress, an increase in intracellular calcium ion concentration, and thus a hyperthermogenic response (Finka A, Cuendet AFH, Maathuis FJM, et al. Plasma membrane cyclic nucleotide gated calcium channels control land plant thermal sensing and acquired thermotolerance [J]. The Plant Cell, 2012, 24 (8): 3333-3348).Zhou et al. believed that apple MdCNGC2 is a negative regulator of powdery mildew resistance in apple callus (Zhou H, Bai S, Wang N, et al. CRISPR / Cas9-mediated mutagenesis of MdCNGC2 in apple callus and VIGS-mediated silencing of MdCNGC2 in fruits improve resistance to Botryosphaeria dothidea [J]. Frontiers in plant science, 2020: 11). Wang et al. found that OsCNGC9 mediated PAMP-induced Ca. 2+ Influx of Ca2+ in pollen tubes plays a key role in PAMP-triggered ROS burst and induction of PTI-related defense gene expression (Gao QF, Gu LL, Wang HQ, et al. Cyclic nucleotide-gated channel 18 is an essential Ca2+ channel in pollen tube tips for pollen tube guidance to ovules in Arabidopsis [J]. Proc Natl Acad Sci USA, 2016, 113 (11): 3096-3101).

[0005] In summary, the CNGCs gene family plays a variety of roles in plant responses to biotic and abiotic stresses. However, the function of the CNGCs family in regulating rice salt tolerance remains unclear. Studying its function is of great significance for increasing rice yield, expanding the scope of rice cultivation, and ensuring grain production in saline-alkali rice-producing areas. Summary of the invention

[0006] The purpose of the present invention is to provide a cyclic nucleotide gated ion channel protein OsCNGC10 gene for regulating rice salt tolerance. The application is to enhance rice tolerance to salt stress by knocking out the OsCNGC10 gene, providing new genetic resources for rice salt tolerance breeding.

[0007] In order to achieve the above technical objectives, this application adopts the following technical solutions:

[0008] (1) Cloning of OsCNGC10 gene

[0009] Leaf RNA was extracted from the japonica rice variety Nipponbare and reverse transcribed into cDNA using reverse transcriptase SuperscriptⅢ (purchased from Invitrogen, USA). Reaction conditions: 65℃5min, 50℃60min, 70℃10min. Using rice genome information, amplification primers forward primer OsCNGC10-full-F (5'ATGTTTGGGGCGGGGAAG 3') and reverse primer OsCNGC10-full-R (5'TTACTCACAGGGTTCAGC 3') were synthesized to amplify the full-length cDNA of OsCNGC10 gene (2079bp). PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 58℃30sec, 72℃2min 30sec, 32 cycles; 72℃ extension for 10min. The amplified PCR product was connected to the pGEM-T vector (purchased from Promega, USA), and positive clones were screened and sequenced to obtain the desired gene ORF, whose sequence was the nucleotide sequence shown in SEQ ID NO: 1, encoding a 692 amino acid sequence (the sequence shown in SEQ ID NO: 2).

[0010] (2) Construction of OsCNGC10 gene overexpression and CRISPR / Cas9 knockout strains

[0011] The present invention respectively constructed the overexpression vector pU1301-OsCNGC10-Flag (see Figure 1 A) and CRISPR / Cas9-OsCNGC10 gene knockout vector ( Figure 1 B), the applicant used the Agrobacterium transformation method to transform the two vectors into the japonica rice variety Nipponbare, and obtained the overexpression positive strain and CRISPR / Cas9 positive strain of the gene, and selected two homozygous T2 generation overexpression strains (numbered OE-OsCNGC10-11, OE-OsCNGC10-25) and two CRISPR / Cas9 transformation strains (numbered ko-oscngc10-5, ko-oscngc-10-16). Design detection primers upstream and downstream of the target site, amplify the corresponding fragments and sequence them, and screen the target site for gene editing, resulting in large fragment deletion or premature translation termination of the material for subsequent experiments.

[0012] (3) Functional identification of OsCNGC10 gene under salt stress

[0013] The present invention conducted 250 mM NaCl salt stress identification on OsCNGC10 transgenic materials (overexpression strains and CRISPR / Cas9 mutant strains), and found that compared with the control materials, the OsCNGC10 overexpression materials were more sensitive to salt stress on the 12th day, and the salt tolerance of the OsCNGC10 mutant was enhanced ( Figure 2 ). The results of the salt stress experiment at the seedling stage showed that under 250mM NaCl stress, the accumulation rate of Pro content in OsCNGC10 gene-deficient plants was accelerated, and the Pro accumulation in the overexpression strain was significantly reduced ( Figure 3 ). The MDA content of the wild-type material was 62.90 nmol / g, and the MDA contents of the two overexpression strains were 92.56 and 87.31 nmol / g, respectively. Among them, the MDA content of OE-OsCNGC10-10-11 was significantly increased compared with the wild-type ( Figure 4 ). The detection of photosynthetic pigment content in rice leaves under salt stress found that there was no significant difference in chlorophyll a and chlorophyll b content among different materials, but the total chlorophyll content of the overexpression material was significantly lower than that of the wild-type material. The total chlorophyll content of the two overexpression lines was 0.61 and 0.81 mg / g lower than that of the wild-type material, respectively. The total chlorophyll content of the knockout line ko-oscngc10-5 was significantly higher than that of the wild-type material ( Figure 5 ). This preliminarily indicates that OsCNGC10 negatively regulates salt tolerance in rice seedlings.

[0014] The results of this study indicate that rice OsCNGC10 may have potential functions in rice salt tolerance, providing a theoretical basis and new germplasm resources for breeding new salt-tolerant rice varieties.

[0015] Advantages of the present invention

[0016] The present invention uses CRISPR / Cas9 technology to design specific sgRNA for the OsCNGC10 gene, and constructs a CRISPR / Cas9 gene-edited mutant of the rice OsCNGC10 gene. The genome of the stress response factor OsCN GC10 is edited to obtain a new rice germplasm with stronger stress resistance. The present invention obtains an OsCNGC10 knockout mutant material with stronger salt tolerance. It can be directly applied to agricultural production. Therefore, the present invention has a relatively good prospect for the promotion of results both in theory and in the creation of new germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 A is the plasmid map of the constructed OsCNGC10 overexpression vector, and B is the plasmid map of the constructed OsCNGC10 gene knockout vector.

[0018] Figure 2The figure is a schematic diagram of the phenotype of plants under 250 mM NaCl stress on the 12th day. The overexpression strain wilted significantly, and the gene knockout strain showed stronger tolerance to salt stress.

[0019] Figure 3 This is the proline content of wild-type materials, overexpression materials and gene knockout materials under salt stress.

[0020] Figure 4 This is the malondialdehyde content of wild-type materials, overexpression materials and gene knockout materials under salt stress.

[0021] Figure 5 Chlorophyll contents of wild-type materials, overexpression materials and gene knockout materials under salt stress. DETAILED DESCRIPTION

[0022] Description of the sequence listing

[0023] SEQ ID NO: 1 is the nucleotide sequence of the OsCNGC10 gene cloned in the present invention.

[0024] SEQ ID NO: 2 is the protein sequence encoded by the OsCNGC10 gene.

[0025] The following examples define the present invention and describe the methods of isolating and cloning a cDNA segment containing the complete coding region of the OsCNGC10 gene and verifying the function of the OsCNGC10 gene. Based on the following description and these examples, those skilled in the art can determine the essential features of the present invention and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to adapt it to different uses and conditions.

[0026] Example 1: Isolation and cloning of OsCNGC10 gene

[0027] (1) Rice RNA extraction and reverse transcription

[0028] Total RNA was extracted from fresh leaves of wild-type japonica rice variety Nipponbare using a plant RNA extraction kit (Minibest Plant RNA Extraction Kit), and the method of use was referred to the TaKaRa PrimeScriptTMRTreagent Kit with gDNA Eraser instructions. The RNA sample was first subjected to a genomic DNA elimination reaction, and the DNA removal reaction solution system was: 2.0μL 5×gDNA Eraser Buffer, 1.0μL gDNAEraser, 1.0μg RNA, 6.0μL RNase free ddH2O, mixed well, and reacted in a 42℃ dry bath for 2min; the digested mixture was taken out for reverse transcription reaction. Reaction system: 1.0μL Prime Script RT EnzymeMix I, 4.0μL RT Primer Mix, 4.0μL5×Prime Script Buffer 2, 1.0μL RNase-FreeddH2O, 10.0μL digested mixture. Reverse transcription reaction conditions: 37°C, 15 min; 85°C, 5 sec, stored at 4°C.

[0029] (2) Obtaining the OsCNGC10 gene sequence

[0030] The full-length sequence of OsCNGC10 was cloned using the forward primer CNGC10-Full-F: (5'ATGTTTGGGGCGGGGAAGGTGGACG 3') and the reverse primer CNGC10-Full-R: (5'TTACTCACAGGGTTCAGCTGAAAAAT 3') using the cDNA of japonica rice "Nipponbare" as a template. PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 59℃30sec, 72℃50sec, 28 cycles; 72℃ extension for 7min. The amplified PCR product was connected to the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and the positive strains were stored at -80℃. The desired open reading frame (ORF) of the OsCNGC10 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 692 amino acids corresponding to the open reading frame (ORF) of the OsCNGC10 gene were determined by Blast X (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the OsCNGC10 gene was inferred to be as shown in SEQ ID NO: 2 in the sequence listing.

[0031] Example 2: Construction of OsCNGC10 gene overexpression and dual-target knockout vector

[0032] (1) Construction of OsCNGC10 gene overexpression vector

[0033] The relevant sequence of OsCNGC10 gene was downloaded from the rice genome database RGAP, and the forward and reverse primers required for PCR amplification (OsCNGC10-R: 5'ATGTTTGGGGCGGGGAAGGTGGACG 3' / OsCNGC10-F: 5'TTACTCACAGGGTTCAGCTGAAAAAT 3') were designed using Primer Premier 5 software for PCR amplification. The amplified product with the correct fragment size was connected to the PGEM-Teasy vector; the ligation product was transformed into Escherichia coli DH5α, the positive clone was selected, the plasmid was extracted and sequenced; the forward and reverse primers of the OsCNGC10 gene with the terminal vector adapter were designed using Primer Premier 5 software (OsCNGC10-Flag-R: 5'GAACGATAGCCGGTACCATGTTTGGGGCGGGGAAGG T 3' / OsCNGC10-Flag-F: 5'CTTTGTAATCGGATCCCTCACAGGGTTCAGCTGAAA3'), use the plasmid obtained in the previous step as a template, perform PCR amplification, and obtain the OsCNGC10 gene with the final vector linker. Use restriction endonucleases (KpnI, BamHI) to double-digest the pU1301-3×Flag vector, and use homologous recombinases for In-fusion connection to obtain the recombinant final vector pU1301-CNGC10-Flag. Transform the concatenated product into Escherichia coli, pick a single clone and shake the bacteria. After the correct band is detected by agarose gel electrophoresis, send the bacterial solution for sequencing. Transform the company-returned plasmid with the correct sequencing result into Agrobacterium, pick a single clone and shake the bacteria, and perform colony PCR. Select the bacterial solution with the correct band size in the colony PCR result and store it at -80℃.

[0034] (2) Construction of OsCNGC10 gene knockout vector

[0035] The target knockout vector used in the present invention is constructed based on the tRNA tandem method pioneered by Professor Xie Kabin's research team at Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR / ). According to the DNA sequence and gene structure of OsCNGC10, two gRNA synthesis adapter primers (CNGC10-gRNA1-U3F, CNGC10-gRNA1-U3R, CNGC10-gRNA2-U3F, CNGC10-gRNA2-U3R and the adapter primers S5AD5-F, S5AD5-R and L5AD5-F, L5AD5-R required for gRNA to be linked into the expression vector pRGEB32 were designed. Using the pGTR plasmid as a template, L5AD5-F / CNGC10-gRNA1-U3R, CNGC10-gRNA1-U3F / CNGC10-gRNA2-U3R, CNGC10-gRNA 2-U3F / L5AD5-R, gRNA2-U3F / L5AD5-R three pairs of primers for PCR amplification. The three RCR products obtained were diluted 20-50 times and mixed in equal volumes. Take 1μL of the above mixture as a template and amplify it with the S5AD5-F / S5AD5-R primer pair. The obtained product was purified and recovered, and the concentration was determined; the CRISPR / Cas9 expression vector pRGEB32 was digested with (KpnI, BamHI), and the digestion product was purified and recovered to obtain a linearized pRGEB32 vector. Using the inf usion recombination method, the purified PCR product was connected to the linearized pRGEB32 vector. The above reaction products were heat-shocked and transformed into Escherichia coli DH5α, single clones were selected for positive detection and sequencing, positive strains and plasmids were saved, and the positive plasmids were transformed into Agrobacterium tumefaciens EHA105 competent cells.

[0036] Example 3: Genetic transformation of rice

[0037] (1) Inducing callus: Select wild-type Nipponbare seeds with full grains and consistent morphology, and peel off the husks by hand to ensure the integrity of the grains. Place the seeds in a sterilized small conical bottle, soak the rice seeds in 75% ethanol for 1 minute, pour out the ethanol, and then soak them in 0.15% HgCl2 solution for 15-20 minutes. Pour the HgCl2 solution into a mercuric chloride recovery bottle, and finally wash the seeds with sterilized ddH2O 7-8 times. After absorbing the moisture on filter paper, the seeds are evenly inoculated on the surface of the sterilized induction culture medium that has been placed for 3 days, and placed in a dark incubator at 28°C for 45-50 days.

[0038] (2) Subculture: Prepare the subculture medium 2-3 days in advance. Use fresh callus induction medium. Sterilize the medium according to the conventional method and make it moderately dry (a medium with too much humidity is not conducive to the growth of callus). Select the callus with light yellow appearance, granular, dry and strong vitality from the induced callus and transfer it to the subculture medium. Culture it in the dark at 28℃ for 20 days.

[0039] (3) Preculture: Sterile preculture medium was dispensed into 500 mL Erlenmeyer flasks in advance. Before the test, 300 μL of 100 Mm acetosyringone and 5 mL of 40% glucose were added to each 250 mL of medium. After mixing, 8-10 dishes of medium were placed in each bottle. From the subcultured callus, callus tissues with a light yellow appearance, granular shape, dryness, and strong vitality were selected and transferred to culture dishes of preculture medium. About 60-80 pieces of mung bean-sized callus tissues were inoculated into each dish. Larger callus tissues could be crushed with sterile tweezers and cultured in the dark at 8°C for 3 days.

[0040] (4) Infection and co-cultivation: 2 days before the experiment, the Agrobacterium strain containing the target gene (such as OsCNGC10) was streaked on a plate containing antibiotics (30 mg / L rifampicin and 50 mg / L kanamycin) to activate it. Prepare suspension culture medium (100 mL / strain), co-culture medium (250 mL / strain), large plate, small plate (with absorbent paper and filter paper inside, sterilized and dried before use), and several 250 mL sterile triangular flasks. Scrape the streaked cultured Agrobacterium into 1 / 2 N6 suspension culture medium (N6 culture medium is a commonly used culture medium for plant tissue culture, add 100 μL AS + 2 mL 50% glucose), and culture at 28°C, 200 rpm for 30 minutes. Shake the culture and collect the pre-cultured callus into a 250 mL sterile triangular flask. Pour the Agrobacterium bacterial solution into the callus and soak it for 30 minutes. Pour off the bacterial solution, first invert the triangular bottle containing the callus tissue on a sterile small dish, absorb the bacterial solution, then spread the callus tissue on the filter paper of the sterile large dish, cover it with a piece of filter paper, press the callus tissue lightly with sterile tweezers, absorb the surface bacterial solution, and dry it naturally for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue on the co-culture medium (it is best not to move it after spreading it to reduce the contact between the culture medium and the surface of the callus tissue and prevent excessive growth of Agrobacterium), and culture it in the dark at 19℃ for 3 days.

[0041] (5) Water washing and first screening (referred to as S1): Prepare sterile water, large dishes, small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and prepare screening culture medium; transfer the co-cultivated callus tissue to a water washing cup, pour in sterile distilled water until the callus tissue is completely immersed, cover the lid and shake for 20-30 seconds, and pour out the sterile distilled water. Repeat this 2-3 times. Add sterile distilled water until the callus tissue is completely immersed, cover the lid and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, and pour out the sterile distilled water. Add sterile distilled water until the callus tissue is completely immersed, cover the lid and shake to mix, shake for 20-30 seconds, and let stand for 10 minutes. Finally, pour out the sterile distilled water, add sterile distilled water containing 500 mg / L carbenicillin, and shake at 200rpm for 30 minutes. Pour out the distilled water and dry the callus naturally. The treated callus was transferred to the screening medium and cultured in the dark at 28°C for 20 days;

[0042] (6) Second screening (abbreviated as S2): Prepare screening medium, add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to every 250 mL of medium. After inverting the plate, open the cover and blow with sterile air for 1.5-2 h on the clean bench. The surface of the screening medium should not be too wet, otherwise it will be detrimental to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry calli without Agrobacterium contamination from the S1 screening medium, place them on the S2 medium (inoculate 25 to 30 calli per plate), and culture them in the dark at 28°C for 20 days.

[0043] (7) Callus differentiation: Prepare differentiation medium 3-4 days in advance. Select small pieces of light yellow, dense, dry resistant callus tissue, inoculate them into differentiation medium, and culture them at 28℃ (light intensity 3000Lux) for 40 days. Seedlings will differentiate in the later stage of culture.

[0044] (8) Rooting culture: Prepare the rooting medium 2-3 days in advance. Prepare 4-5 sterilized empty dishes; pull out the differentiated seedlings from the differentiation medium, take only one seedling from a piece of callus, cut off the overlong leaves and roots with scissors, and insert them into the rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000Lux) for 15-20 days, wait for the roots to grow fully, harden the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0045] Mother solution formula:

[0046] 1.MSmax stock solution (10X)

[0047]

[0048]

[0049] Dissolve gradually, then add distilled water to make up to 1000mL.

[0050] 2.MSmin stock solution (100X)

[0051]

[0052] Note: Na2MoO4 must be dissolved separately, then mixed with other components, made up to 1000mL with distilled water, and stored at room temperature.

[0053] 3.N6max stock solution (10X)

[0054]

[0055] Dissolve gradually, then add distilled water to make up to 1000mL.

[0056] 4.N6min stock solution (100X)

[0057]

[0058] Make up to 1000 mL with distilled water and store at room temperature.

[0059] 5.Fe2+-EDTA stock solution (100X)

[0060] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0061] Add 300 mL of distilled water to another reagent bottle and heat to 70°C, then add 3.73 g of Na2EDTA·2H2O. After dissolution, mix the solutions in the two reagent bottles, keep warm at 70°C for 2 hours, then add distilled water to make up to 1000 mL, and store at 4°C away from light.

[0062] 6. Vitamin stock solution (100X)

[0063]

[0064] Add distilled water to make up to 1000 mL and store at 4°C.

[0065] 7.AAmax stock solution (10X)

[0066]

[0067] Add distilled water to make up to 1000 mL and store at room temperature away from light.

[0068] 8.AAmin stock solution (100X)

[0069]

[0070] Na2MoO4 was dissolved separately, then mixed with other components and made up to 1000 mL with distilled water and stored at room temperature away from light.

[0071] 9.6-BA stock solution (1 mg / mL)

[0072] 6-BA 100 mg, add 1.0 mL 1 M KOH and shake until 6-BA is dissolved, then add distilled water to make up to 100 mL and store at room temperature.

[0073] 10. KT stock solution (1 mg / mL)

[0074] KT 100 mg; add 1.0 ml 1M KOH and shake until KT is dissolved, then add distilled water to make up to 100 ml and store at room temperature.

[0075] 11.2,4-D stock solution (1 mg / mL)

[0076] To 100 mg of 2,4-D, add 1.0 ml of 1 M KOH and shake for 5 min. Then add 10 ml of distilled water and shake until the 2,4-D is dissolved. Add distilled water to make up to 100 ml and store at room temperature.

[0077] 12.100 μM AS stock solution

[0078] AS 0.196g;

[0079] DMSO 10mL;

[0080] Aliquot into 1.5 mL centrifuge tubes and store at 4°C.

[0081] 13.IAA stock solution (1 mg / mL)

[0082] Add 1.0 ml 1N KOH to 100 mg of IAA and shake until IAA dissolves. Then add dH2O to make up to 100 ml and store at room temperature away from light.

[0083] 14. NAA stock solution (1 mg / mL)

[0084] NAA 100mg, add 1.0mL 1M KOH and shake until NAA is dissolved, then dilute to 100mL with distilled water and store at room temperature away from light.

[0085] Culture medium formula:

[0086] 1. Induction medium

[0087]

[0088] Add distilled water to make up to 1000 mL.

[0089] 2. Subculture medium

[0090]

[0091]

[0092] Add distilled water to make up to 1000 mL.

[0093] 3. Pre-culture medium

[0094] Add distilled water to make up to 250 mL.

[0095] 4. Co-culture medium

[0096] Add distilled water to make up to 250 mL.

[0097] 5. Suspension culture medium

[0098] Add distilled water to make up to 100 mL.

[0099] 6. Screening medium

[0100] Add distilled water to make up to 250mL.7. Differentiation medium

[0101]

[0102] Add distilled water to make up to 1000 mL.

[0103] 8. Rooting medium

[0104]

[0105] Add distilled water to make up to 1000 mL.

[0106] Example 4: Identification of salt tolerance of transgenic materials

[0107] The transgenic materials obtained in Example 3 were cultured to the homozygous T2 generation, and two T2 generation overexpression strains (numbered OE-OsCNGC10-11 and OE-OsCNGC10-25) and two CRISPR / Cas9 transformed strains (numbered ko-oscngc10-5 and ko-oscngc-10-16) with the same growth potential were selected, as well as ten strains of the wild-type strain for salt stress experiments. 250 mM NaCl salt stress was used for identification, and the phenotypic differences among the overexpression strains, knockout strains, and wild-type strains were observed after 12 days of treatment ( Figure 2 ).

[0108] Solarbio's proline (Pro) and malondialdehyde (MDA) content detection kit (Cat. No. BC0290, BC0020) was used to detect Pro and MDA content according to the instructions ( Figure 3 , Figure 4 ).

[0109] Take the leaves at the same position, remove the main vein, cut 0.1000g of the sample with scissors, soak it in 10mL of acetone anhydrous ethanol, and culture it in the dark at 26℃ for 24 hours. Use a spectrophotometer to measure the absorbance of chlorophyll A (maximum absorption peak 665nm) and chlorophyll B (maximum absorption peak 649nm), respectively, and refer to the method of Arnon (1949) to calculate the chlorophyll content in each rice. Each treatment is repeated three times. At the same time, the plant height, root length and fresh weight of each rice are measured. The results are as follows: Figure 5 shown.

[0110] The results showed that after 12 days of salt treatment, the degree of leaf wilting, curling and yellowing of the two OsCNGC10 overexpression lines was significantly higher than that of the wild-type rice Nipponbare, and the gene knockout lines showed stronger tolerance to salt stress, indicating that the OsCNGC10 gene-edited mutant rice is more salt-tolerant.

[0111] In summary, knocking out the OsCNGC10 gene in rice increases the rice's salt tolerance to salt stress.

Claims

1. Application of OsCNGC10 gene in rice salt stress tolerance, characterized in that: The nucleotide sequence of the OsCNGC10 gene is shown in SEQ ID NO.

1. The OsCNGC10 gene negatively regulates the salt tolerance of rice.

Images