Application of GhMPK3 gene or encoded protein thereof in regulation and control of cotton fiber length

Abstract

The invention discloses an application of a GhMPK3 gene or an encoded protein thereof in regulation and control of cotton fiber length, and belongs to the technical field of plant breeding. The length of the cotton fiber is regulated and controlled by regulating and controlling the expression of the GhMPK3 gene or the activity of the coding protein, and the coding protein of the GhMPK3 gene is shown as SEQ ID NO: 3. The method provided by the invention not only provides a new way for regulating and controlling the length of the cotton fiber, but also opens up a new thought for improving the cotton quality. By regulating and controlling the GhMPK3 gene, the length of the fiber can be specially improved under the condition that the characteristics of other fibers are not influenced, which has far-reaching influence on the development of the cotton industry.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant breeding and specifically relates to GhMPK3 Application of the gene or its encoded protein in regulating cotton fiber length. Background Art

[0002] Cotton fiber is an important economic crop, and its fiber quality directly affects the development of the textile industry. As a natural fiber, cotton is the most important raw material for the textile industry and one of the most important economic crops in the world. With the increasing demand for high-quality cotton fiber, increasing yield and improving cotton fiber quality are important goals of cotton breeding. The discovery of key factors and related functional genes that regulate cotton fiber development will not only help understand the mechanism of cotton fiber development, but also provide new ideas for breeding new varieties of high-quality cotton fibers.

[0003] The development of cotton fiber is a complex and orderly biological process, which is divided into four key stages that are clear and overlap with each other. These four stages are: the initiation of fiber differentiation, the rapid fiber elongation, the secondary wall thickening, and the fiber maturity. Specifically, the initiation of fiber differentiation is the first stage of the entire fiber development process, which starts from -3 days after anthesis (DPA) and lasts until 0 DPA. In the initial stage of fiber differentiation, it can be observed that some cells on the surface of the ovule begin to protrude and swell, and these cells have the potential to develop into mature fibers. This process is the basis of cotton fiber development and lays a structural foundation for the subsequent rapid elongation and maturation of fibers. At this stage, the transformation of cell fate and the adjustment of cell division patterns are key events, and these changes provide the necessary conditions for the specialization of fiber cells.

[0004] Virus-induced gene silencing (VIGS) is a technology that uses RNA-mediated antiviral defense mechanisms. When a viral vector carrying a target gene fragment enters the plant, it will be recognized by the specific nuclease Dicer and cut into small RNA molecules. The target gene is then degraded, showing symptoms of functional loss and then showing gene function. Virus-induced gene silencing is an emerging technology that is developing rapidly and has been applied in many research fields.

[0005] As scientific research deepens, more and more evidence shows that mitogen-activated protein kinases (MAPKs) play a vital role in plant growth and development and in responding to environmental stress. GhMPK3 Genes have attracted widespread attention. Studies have found that during the elongation and development stage of cotton fibers, GhMPK3The expression level of the gene increased significantly, suggesting that the gene may have a special function in the development of cotton fiber. GhMPK3 The specific function of the gene and its mechanism of action are still unclear and require further research and exploration. GhMPK3 The exact role of genes in cotton fiber development, in-depth study GhMPK3 The expression regulation of genes, signal transduction pathways and their interactions with other related genes are studied in order to provide a theoretical basis for further improving cotton varieties and regulating cotton fiber length.

[0006] Defects and shortcomings of the existing technology: Existing technologies mainly include transgenic technology. The process of obtaining silent plants through transgenic technology often involves complex molecular biological operations, which takes longer than traditional breeding technology, and the positive rate (that is, the proportion of plants that successfully obtain the desired traits) is not always high.

[0007] First of all, in terms of timeliness, the entire process of transgenic technology, from the screening of target genes, the construction of vectors, gene transformation, to the screening and identification of silent plants, often takes a lot of time. In this process, researchers need to go through complex experimental steps, each of which may take weeks or even months to complete. In addition, due to the limitations of the plant growth cycle, it is a long waiting process from gene transformation to plant maturity. Therefore, compared with traditional breeding methods, transgenic technology is obviously more time-consuming in obtaining silent plants, which to a certain extent limits its application speed in actual production.

[0008] Secondly, the low positive rate is another important disadvantage of using transgenic technology to obtain silent plants. The positive rate refers to the proportion of plants that successfully show the silencing trait of the target gene after gene transformation. In actual operation, due to the influence of various factors, such as transformation efficiency, gene silencing efficiency, genetic stability, and the technical level of experimental operation, the positive rate is often not ideal. This means that among a large number of transformed plants, only a few can achieve the expected silencing effect, which not only increases the difficulty of scientific research, but also increases time and economic costs. Summary of the invention

[0009] The technical problem to be solved by the present invention is how to regulate the length of cotton fibers and provide GhMPK3 A new use for genes.

[0010] The present invention solves the above technical problems through the following technical means: The first aspect of the present invention provides a GhMPK3 Use of a gene or its encoded protein in regulating cotton fiber length, the GhMPK3The protein encoded by the gene is shown in SEQ ID NO: 3; the regulation is to increase or decrease.

[0011] The regulation is specifically embodied in: GhMPK3 When the expression level of the gene and / or the activity of its encoded protein decreases, the cotton fiber length decreases; when GhMPK3 When the expression level of the gene and / or the activity of its encoded protein increases, the length of the cotton fiber increases.

[0012] Preferably, the GhMPK3 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0013] Preferably, the GhMPK3 The cDNA sequence of the gene is shown in SEQ ID NO.2.

[0014] Preferably, amplification GhMPK3 The primer sequences of the genes are shown in SEQ ID NOs. 4~5.

[0015] The second aspect of the present invention proposes the above GhMPK3 One or more uses of the gene or its encoded protein in the following: (1) Use in preparing transgenic cotton plants; (2) Use in the preparation of cotton plants with reduced cotton fiber length.

[0016] The third aspect of the present invention provides a method comprising the above GhMPK3 The use of a VIGS vector containing a gene in cultivating transgenic cotton with reduced fiber length, wherein the VIGS vector is connected to GhMPK3 After the PSK vector of the gene fragment was successfully sequenced, the CLCrV-GhMPK3 fragment and the CLCrVA vector fragment were connected by T4 enzyme.

[0017] A fourth aspect of the present invention provides a breeding method for reducing the length of cotton fibers in cotton plants, the breeding method comprising: reducing the length of cotton fibers in cotton plants; GhMPK3 Gene expression or decrease GhMPK3 Activity of the protein encoded by the gene.

[0018] Preferably, the reduction GhMPK3 Gene expression or decrease GhMPK3 The method is to silence the activity of the protein encoded by the gene in cotton plants. GhMPK3 Genes to achieve.

[0019] Preferably, the silenced cotton plant GhMPK3 The gene method is to introduce into the cotton plant GhMPK3 Gene silencing vector.

[0020] Preferably, the GhMPK3 The gene silencing vector is a VIGS vector.

[0021] The beneficial effects of the present invention are: 1. The method proposed in this invention is significantly innovative and practical. Through a series of rigorous experimental designs and analysis processes, it successfully reveals GhMPK3 The method demonstrates that the gene plays a key role in regulating cotton fiber length. GhMPK3 The gene is a positive regulatory gene. Promoting its expression can effectively increase the length of cotton fibers, while inhibiting its expression can effectively reduce the length of cotton fibers. It is of great significance in improving cotton fiber quality and cotton breeding.

[0022] 2. The present invention uses virus-induced gene silencing (VIGS) technology to silence genes in cotton GhMPK3 Gene, combined with in vitro ovule culture experiment, verified in cotton fiber GhMPK3 Positively regulates cotton fiber elongation development. qRT-PCR results showed GhMPK3 The expression level was significantly downregulated in cotton plants after VIGS silencing; the results of somatic embryo culture experiments showed GhMPK3 Silence affects the elongation growth process of cotton fibers; the mature cotton fibers were measured and analyzed, and the results showed GhMPK3 Silencing significantly shortened the length of mature fibers, indicating GhMPK3 It plays a positive regulatory role in the elongation and development process of cotton fibers.

[0023] 3. In addition, the method of the present invention not only provides a new way to increase cotton fiber yield, but also opens up a new idea for improving cotton quality. GhMPK3 Genes can be used to regulate fiber length without affecting other fiber properties, which has a profound impact on the development of the cotton industry. Therefore, the present invention provides an important theoretical basis for cotton breeders, so that they have clearer goals and more effective means when improving cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 In Example 1 of the present invention GhMPK3 Agarose gel electrophoresis of gene cloning (Note: M.2000 DNAMarker); Figure 2 The virus-induced gene silencing cotton plant in Example 1 of the present invention and GhMPK3Expression analysis diagram; A is the 14th day after inoculation of CLCrV:GhCLA1 silenced plants; B is the 9th day after qRT-PCR detection of wild-type, CLCrV:00, and CLCrV:GhMPK3 silenced plants in cotton fibers GhMPK3 Gene expression diagram. All data are the average of three biological replicates. T-test results (**P<0.01) indicate that there are extremely significant differences among the wild type, CLCrV:00, and CLCrV:GhMPK3.

[0025] Figure 3 The in vitro ovule experiment analysis in Example 1 of the present invention GhMPK3 The effect of gene downregulation on cotton fiber development; A is the phenotypic analysis of cotton fiber after 12 days of in vitro culture; B is the analysis of cotton fiber length after 12 days of in vitro culture. The above are three biological replicates, and the T-test shows that (**P<0.01) represents a very significant difference between CLCrV:00 and CLCrV:GhMPK3.

[0026] Figure 4 In Example 1 of the present invention GhMPK3 Analysis of the effect of gene down-regulation on the length of mature cotton fibers; A is a comparison of mature cotton fibers of CLCrV:00 empty-loaded plants and CLCrV:GhMPK3 transgenic plants; B. Analysis of the length of mature cotton fibers of CLCrV:00 empty-loaded plants and CLCrV:GhMPK3 transgenic plants.

[0027] Figures 2 - 4 In the figure, CK1 and CK2 represent two different CLCrV:00 empty-carrier cotton plants, and L1, L2, and L3 represent three different CLCrV:GhMPK3 transgenic plants. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0030] For those without specific technical or conditions indicated in the examples, they can all be carried out according to the technologies or conditions described in the literature in this field or according to the product instructions. Without special instructions, for the quantitative tests in the following examples, more than three repeated experiments are set, and the results are averaged.

[0031] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with examples, but the content of the present invention is not limited to the following examples only.

[0032] Example 1: GhMPK3 Functional study in regulating cotton fiber length 1. GhMPK3 Cloning of the gene and construction of its vector Select the fibers of experimental cotton ( Gossypium hirsutum , cv. Coker 312) at 9 days after flowering, extract the RNA of cotton fibers at 9 days, and extract the cotton fiber RNA according to the Fruit-mate™ for RNA Purification kit of Novoprotein Scientific Inc.

[0033] Gene cloning: 1) Take 5 μg of the extracted one for reverse transcription to obtain the first strand of cDNA, and the reaction system is as follows: 1 μg of cotton fiber RNA at 9 days, 4 μl of 4 × gDNA wiper Mix, 1 μl of Oligo (dT)23VN (10 μM), 1 μl or / and Random hexamers (50 ng / μl), 1 μl or Gene specific primers (2 μM), add RNase-free ddH2O to 16 μl and gently pipette and mix well. Incubate at 42 °C for 2 min, directly add 4 μl of 5 × HiScript II Select qRT SuperMix II to the reaction system, carry out the reverse transcription reaction, 15 min at 50 °C and then 5 sec at 85 °C; obtain the first strand of cDNA.

[0034] 2) Design primers for PCR amplification, and the primer sequences are as follows: End-to-end F: 5′-ATGGCTGACGTCGCTCCGGG-3′ (SEQ ID NO.4) End-to-end R: 5′-TTAAGCATAAGTTGGATTCAG-3′ (SEQ ID NO.5) PCR amplification conditions: 95℃, 5 min; then 95℃, 30 sec; then 55℃, 30 sec; 72℃; 30 cycles, post-extension at 72℃, 5 min; storage at 4℃. After the PCR reaction is completed, DNA loading buffer is added to the reaction system, and 1.2% agarose gel electrophoresis is used to detect whether the amplified band is the target band, and the gel is cut and recovered.

[0035] 3) Gel recovery: refer to the instructions of the recovery kit TaKaRa Mini BEST Agarose Gel DNA Extraction Kit. 4) Vector ligation: Connect the cloned MAPK3 gene with the PSK cloning vector. The reaction system is as follows: 2 μL PCR product, 0.3 μL Cloning Vector, 0.5 μL T4 DNA ligase, 1 μL Buffer, and 5 μL of ddH2O. Mix by pipetting and centrifugation briefly. Incubate at room temperature for 30 min.

[0036] 5) Transformation: Add the DNA to be transformed (10-100 ng, or 10 μL of ligation product) to 100 μL of general competent cells, place on ice for 30 min, place in a 42℃ water bath for 90 sec, and place on ice for 3-5 min. Mix with 200 μL of liquid LB medium and place in a 37℃ shaker for 45-60 min. Take 50 μL (the ligation product is fully coated after centrifugation) and spread on LB solid medium containing corresponding antibiotics, and incubate inverted in a 37℃ incubator overnight. Pick a single colony for PCR verification. The total system for colony PCR verification is 10 μL: 5 μL of 2X Rapid Taq DNA master Mix, 0.2 μL of upstream and downstream primers, and add sterile water to 10 μL for the single colony picked. Colony PCR reaction program: 95℃, 3 min; 95℃, 15 sec; 55℃, 15 sec; 72℃, 45 sec; cycle number 30, 72℃, 5 min, end at 4℃. Use 1.2% agarose gel electrophoresis to check whether the selected colony is the target colony, and select the single colony with the correct band position to shake the bacteria.

[0037] 6) Extraction of plasmid DNA: Transform into competent E. coli DH5 α And plasmid extraction was performed according to the plasmid mini-extraction kit.

[0038] 2. GhMPK3 Construction of gene VIGS vector Vector construction: After the PSK vector connected with the gene fragment is successfully sequenced, CLCrV- GhMPK3 The fragment and the CLCrVA vector fragment were ligated with T4 enzyme. Enzyme ligation system (10 µL): T4 DNA Ligase 1 µL; 10×T4 DNA LigaseBuffer 1 µL; Insert fragment 50 ng; Vector fragment 50 ng; The remaining ddH2O was added to make up to 10 µL. The reaction conditions were 25℃ for 30 min.

[0039] 3. Transformation of Agrobacterium Competent Cells Mix 20 μL of competent cell Agrobacterium GV3101 with the plasmid, place on ice for 5 min; freeze in liquid nitrogen for 5 min; place in a 37°C water bath for 5 min; place on ice for 5 min, add 500 μL LB liquid culture medium (without antibiotics), and culture at 28°C, 220 g for 2-3 h; apply 20 μL on a plate containing LB solid culture medium (containing Kan and Rif antibiotics), and culture at 28°C for 2 d; screen positive clones by colony PCR.

[0040] 4. GhMPK3 Gene VIGS experiment 1) Streak and culture Agrobacterium GV3101 containing CLCrVA, CLCrVB, CLCrVA-GhMPK3 and CLCrVA-CLA1 vectors for 1-2 days. Select single colonies that are positive by colony PCR and shake culture for 1-2 days.

[0041] 2) The obtained bacterial solution: fresh Rif+Kan LB liquid medium = 1:100, shake culture at 28℃ for 2 days to expand the culture. At the end of the culture, the bacterial solution was transferred to a centrifuge tube, centrifuged at 4℃ 4000 r / min for 10 min to collect the bacteria, and then resuspended the bacteria with resuspension solution. Adjust the concentration of the bacteria to OD600=1.5.

[0042] 3) Mix equal volumes of CLCrVB bacterial solution with CLCrVA, CLCrVA-GhMPK3 and CLCrVA-CLA1 bacterial solutions, and then place the mixed bacterial solutions in a 28°C incubator for 2 h to fully mix the bacterial solutions.

[0043] 4) Inoculate the bacterial solution on cotton plants that have been cultured in the culture room for about 7-8 days and whose two cotyledons are fully expanded but true leaves have not yet grown.

[0044] 5) Use a needle to make a “+” mark on the back of the cotton cotyledon. Use a 1 mL syringe without a needle to draw up the bacterial solution and inject it at the position marked with the “+” mark on the back of the cotyledon so that the entire leaf is injected with the bacterial solution.

[0045] 6) Cultivate the cotton in dark conditions overnight. The next day, transfer to normal light conditions (28°C, light / dark = 16 / 8 h) for cultivation.

[0046] 7) When the VIGS-treated cotton plant with CLCrVA-CLA1 silenced showed whitening, it indicated that the target gene had been silenced. The cotton fibers injected with CLCrVA-GhMPK3 and the empty vector CLCrVA were collected at 9 days old, washed, and then the total RNA of the cotton was extracted.

[0047] 5. Fluorescence quantitative qRT-PCR analysis qRT-PCR analysis was used to detect the GhMPK3 The expression of the gene was determined to identify the cotton fiber length of the control group and the experimental group. Target gene-specific primers were designed for fluorescence quantitative qRT-PCR analysis. The primer sequences are as follows: qRT-PCR-F1: 5′-ATGGCTGACGTCGCTCCGGG-3′ (SEQ ID NO.6) qRT-PCR-R1: 5′-CTTCTCCCAATGGTTGCTGC-3′ (SEQ ID NO.7) Fluorescence quantitative qRT-PCR reaction system: 10 μL TOYOBO SYBR Green fluorescence quantitative PCRMix, 1 μL target gene specific upstream and downstream primers, 3 μL diluted quantitatively consistent cDNA template, 5 μL ddH2O, and the total volume was supplemented to 20 μL. The PCR reaction program was: 94℃, 1 min; 94℃ 20 sec; primer Tm value -5℃ 20sec; 72℃ 30 sec; 81℃ 1 sec; plate read; Go to Step 2 for additional 45 cycles; 72℃ 10 min; Melting cureve from 55℃ to 95℃, plate read every 0.2℃, hold for 2sec; 12℃ forever. ATACTIN2 / GhUBI The gene was used as an internal reference, and the relative value of gene expression was calculated according to the formula Y = 10△Ct / 3.5 × 100%.

[0048] 6. Cotton in vitro ovule culture experiment In vitro ovule culture experiments were performed to collect CLCrVA- GhMPK3 Ten ovules were peeled from cotton plants with CLCrVA, cotton plants with empty vector CLCrVA, and wild-type cotton one day after flowering (1 DPA) in each liquid BT medium containing 0.5 μmol / L gibberellin (GA) and 5 μmol / L indole-3-acetic acid (IAA), and cultured in the dark at 30°C for 9, 12, 15, and 18 days, respectively. The growth of the ovules was observed, and the length of the fibers on the ovules was measured and statistically analyzed by TFU value.

[0049] 7. Measurement of mature cotton fibers After the CLCrVA-GhMPK3 silenced gene and empty vector CLCrVA cotton plants were blasted, cotton fibers from the control group and the experimental group were taken, and the cotton fibers were combed straight to both sides with the cotton seeds as the center. The length of the cotton fibers of the control group and the experimental group was measured with a ruler, and 10 cotton fibers were measured for each group. The data of each group were recorded to compare the difference in fiber length between the two groups.

[0050] The above experimental results show that GhMPK3 Gene plays a positive regulatory role in the elongation and development of cotton fibers from Figure 1 As can be seen, the ORF length of the gene is 1128 bp, encoding 375 amino acids, with a molecular weight of 43.02 kDa; from Figure 2 As can be seen in the figure, virus-induced gene silencing (VIGS) is used to silence genes in cotton fibers. GhMPK3 , with the phytoene desaturase gene GhPDS as a positive control, when white spots appear on the cotton leaves transformed with CLCrV:GhPDS, it indicates that the Agrobacterium-mediated gene transformation is successful, such as Figure 2 As shown in A; Figure 2 As shown in B, after VIGS induction, the fibers in the 9th day after flowering GhMPK3 The expression level of from Figure 3 It can be seen that the CLCrV cultured for 12 days: GhMPK3 The length of ovule fibers was significantly shorter than that of the control; from Figure 4 As can be seen, after VIGS-induced silencing of CLCrV: GhMPK3 The length of cotton fibers also became significantly shorter.

[0051] cotton GhMPK3 Gene gDNA sequence: (SEQ ID NO: 1) ATGGCTGACGTCGCTCCGGGAAACGCCGGCGGTCAATTTGGAGATTTTCCGACGATTCAT60 ACACATGGAGGTCAGTTTATTCAGTATAATATTTTTGGAAATTTGTTCGAGGTGACGTCT120 AAGTATCGGCCTCCGATCATGCCGATCGGTCGTGGAGCCTACGGCATCGTTTGCTCGGTG180 TTGAATTCGGAGACAAACGAGATGGTTGCGGTAAAGAAAATCGCCAACGCTTTTGATAAT240 CACATGGATGCTAAGCGCACGCTTCGTGAGATTAAACTCCTTCGACATTTGGATCACGAA300 AACGTTATTGGAATCAAAGATGTGATTCCTCCGCCTTTAAGGAGGGAATTTACTGATGTT360 TACATTGCGACTGAGCTCATGGATACCGATCTTCACCAAATCATTCGCTCTAATCAGAGT420 TTATCGGAGGAGCATTGCCAGTATTTCTTGTATCAAATTCTTCGAGGACTGAAGTACATA480 CATTCTGCCAATGTCATTCATAGAGATTTGAAACCCAGCAACCTCTTGCTGAATGCTAAT540 TGTGATCTTAAGATTTGCGACTTTGGTCTCGCTCGGCCCTACTGCTGAGAATGAGTTTATG600 ACTGAATATGTTGTCACGAGGTGGTATCGGGCACCGGAGATATTGCTAAACTCTTCAGAC660 TACACCGCTGCCATAGATGTCTGGTCTGTTGGTTGCATCTTCATGGAGCTCATGAATAGG720 AAGCCTCTGTTTCCAGGCAAAGATCATGTACATCAAATGCGTTTATTAACTGAGCTGCTC780 GGCACACCAACTGAATCCGATCTTGGATTTCTCCGGAACGAGGATGCAAGGAGATATATC840 AGGCAGCTCCCAGCACATCCGCGCCAATCACTAGCAGAAGTTTTCCCACATGTTCATCCA900 TTGGCCATTGATCTCATTGACAGAATGTTGACATTTGATCCGACCAGAAGGATTACTGTT960 GAAGAAGCATTGGCACATCCTTACCTCGAAAGATTACACGACATATCTGATGAACCAGTC1020 TGCCCCGAACCGTTTTCTTT CGACTTTGAGCAGCAACCATTGGGAGAAGAACAGATGAAG1080 GACATGATTTACCAAGAGGCCTTGGCTCTG AATCCAACTTATGCTTAA1128 Cotton GhMPK3 cDNA sequence of the gene: (SEQ ID NO:2) ATGGCTGACGTCGCTCCGGGAAACGCCGGCGGTCAATTTGGAGATTTTCCGACGATTCAT60 ACACATGGAGGTCAGTTTATTCAGTATAATATTTTTGGAAATTTGTTCGAGGTGACGTCT120 AAGTATCGGCCTCCGATCATGCCGATCGGTCGTGGAGCCTACGGCATCGTTTGCTCGGTG180 TTGAATTCGGAGACAAACGAGATGGTTGCGGTAAAGAAAATCGCCAACGCTTTTGATAAT240 CACATGGATGCTAAGCGCACGCTTCGTGAGATTAAACTCCTTCGACATTTGGATCACGAA300 AACGTTATTGGAATCAAAGATGTGATTCCTCCGCCTTTAAGGAGGGAATTTACTGATGTTT360 ACATTGCGACTGAGCTCATGGATACCGATCTTCACCAAATCATTCGCTCTAATCAGAGTT420 TATCGGAGGAGCATTGCCAGTATTTCTTGTATCAAATTCTTCGAGGACTGAAGTACATAC480 ATTCTGCCAATGTCATTCATAGAGATTTGAAACCCAGCAACCTCTTGCTGAATGCTAATT540 GTGATCTTAAGATTTGCGACTTTGGTCTCGCTCGGCCTACTGCTGAGAATGAGTTTATGA600 CTGAATATGTTGTCACGAGGTGGTATCGGGCACCGGAGATATTGCTAAACTCTTCAGACT660 ACACCGCTGCCATAGATGTCTGGTCTGTTGGTTGCATCTTCATGGAGCTCATGAATAGGA720 AGCCTCTGTTTCCAGGCAAAGATCATGTACATCAAATGCGTTTATTAACTGAGCTGCTCG780 GCACACCAACTGAATCCGATCTTGGATTTCTCCGGAACGAGGATGCAAGGAGATATATCA840 GGCAGCTCCCAGCACATCCGCGCCAATCACTAGCAGAAGTTTTCCCACATGTTCATCCAT900 TGGCCATTGATCTCATTGACAGAATGTTGACATTTGATCCGACCAGAAGGATTACTGTTG960 AAGAAGCATTGGCACATCCTTACCTCGAAAGATTACACGACATATCTGATGAACCAGTCT1020 GCCCCGAACCGTTTTCTTTCGACTTTGAGCAGCAACCATTGGGAGAAGAACAGATGAAGG1080 ACATGATTTACCAAGAGGCCTTGGCTCTGAATCCAACTTATGCTTAA1137 Cotton GhMPK3Protein encoded by the gene (SEQ ID NO:3) MADVAPGNAGGQFGDFPTIH THGGQFIQYNIFGNLFEVTS KYRPPIMPIGRGAYGIVCSV LNSETNEMVAVKKIANAFDN HMDAKRTLREIKLLRHLDHE NVIGIKDVIPPPLRREFTDV YIATELMDTDLHQIIRSNQS LSEEHCQYFLYQILRGLKYI HSANVIHRDLKPSNLLLNAN CDLKICDFGLARPTAENEFM TEYVVTRWYRAPEILLNSSD YTAAIDVWSVGCIFMELMNR KPLFPGKDHVHQMRLLTELL GTPTESDLGFLRNEDARRYI RQLPAHPRQSLAEVFPHVHP LAIDLIDRMLTFDPTRRITV EEALAHPYLERLHDISDEPV CPEPFSFDFEQQPLGEEQMK DMIYQEALALNPTYA The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A GhMPK3 Use of a gene or its encoded protein in regulating cotton fiber length, characterized in that: Said GhMPK3 The encoded protein of the gene is shown in SEQ ID NO: 3; the regulation is reduction.

2. The use according to claim 1, characterized in that Said GhMPK3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. The use according to claim 1, characterized in that Said GhMPK3 The cDNA sequence of the gene is shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that Amplification GhMPK3 The primer sequences of the genes are shown in SEQ ID NO.4~5.

5. The method according to claim 1 GhMPK3 One or more uses of the gene or its encoded protein in the following: (1) Use in preparing transgenic cotton plants; (2) Use in the preparation of cotton plants with reduced cotton fiber length.

6. A method comprising the method according to claim 1 GhMPK3 The use of a VIGS vector containing a gene in cultivating transgenic cotton with reduced fiber length is characterized in that: The VIGS vector is connected by GhMPK3 After the PSK vector of the gene fragment was successfully sequenced, the CLCrV-GhMPK3 fragment and the CLCrVA vector fragment were connected by T4 enzyme.

7. A breeding method for reducing the length of cotton fibers in cotton plants, characterized in that: The breeding method comprises: in cotton plants, reducing GhMPK3 Gene expression or decrease GhMPK3 Activity of the protein encoded by the gene.

8. The breeding method according to claim 7, characterized in that The reduction GhMPK3 Gene expression or decrease GhMPK3 The method is to silence the activity of the protein encoded by the gene in cotton plants. GhMPK3 Genes to achieve.

9. The breeding method according to claim 8, characterized in that Silence in cotton plants GhMPK3 The gene method is to introduce into the cotton plant GhMPK3 Gene silencing vector.

10. The breeding method according to claim 9, characterized in that: Said GhMPK3 The gene silencing vector is a VIGS vector.

Images