Vector and method for rapidly realizing transient expression in phalaenopsis amabilis
By constructing GUS-1300 vector and directly injecting the infectious solution into the petals and sepals of Phalaenopsis, rapid and efficient protein expression in Phalaenopsis was achieved, and the problems of long reproduction and growth cycles, difficulty in genetic transformation and low transient expression efficiency in the verification of Phalaenopsis genes and molecular breeding were solved. It is suitable for various Phalaenopsis types.
Patent Information
- Application Number
- CN202510107194.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-05-06
AI Technical Summary
The genetic function verification and molecular breeding process of Phalaenopsis are limited by the problems of long reproduction and growth cycles, difficulty in genetic transformation, and long transient expression cycles, difficulty and low efficiency. The existing method receptor materials are limited by a single variety, which limit the process of biotechnology research.
GUS-1300, a transient expression vector containing GUS reporter gene, was constructed, and GUC staining was performed by plasmid extraction, transformation of Agrobacterium, preparation of infection solution, and direct injection of Phalaenopsis petals and sepals to achieve transient expression of proteins. After co-culture, GUC staining analysis was performed.
It achieves rapid and efficient protein expression in Phalaenopsis body, with short cycles and high efficiency, solving the problems of long, difficult and low efficiency of Phalaenopsis transient expression cycles, and is suitable for various types of Phalaenopsis, expanding the applicability of the transient expression system.
Smart Images
Figure CN119932102A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of agricultural biotechnology and relates to a vector and a method for quickly realizing transient expression in Phalaenopsis. Background Art
[0002] Phalaenopsis is a general term for plants of the genus Phalaenopsis in the family Orchidaceae. It is native to subtropical rainforests and is one of the most important ornamental plants in the world. Phalaenopsis is known as the "Queen of Orchids". It has a unique flower shape, rich colors, and a long flowering period. It is a good material for studying flower shape, color, and flowering regulation. Whether in terms of sales volume or sales revenue, Phalaenopsis potted flowers rank first among potted flowers. In addition, peripheral products developed based on Phalaenopsis are also favored by the market, with both research and economic value.
[0003] With the development of biotechnology represented by gene editing, directed breeding through gene modification has become a new direction for future breeding. Therefore, exploring key genes, analyzing their mechanisms of action and applying them to genetic engineering breeding have become the prerequisites for conducting directed breeding. However, Phalaenopsis has a long reproduction and growth cycle, and genetic transformation is difficult, making it difficult to obtain stably transformed plants, which seriously limits the gene function verification and molecular breeding process of Phalaenopsis. At the same time, it has a high probability of failure during genetic transformation. For example, the transformation vector does not work properly and the gene editing effect is poor. If these problems cannot be solved before a stable transformation experiment, a lot of manpower and material resources will be consumed. Therefore, a fast and efficient verification system will greatly improve the efficiency of Phalaenopsis gene function verification and reduce the risk of stable transformation.
[0004] Various transient transformation methods, including Agrobacterium infection of leaves, PEG transformation of protoplasts, fruit injection, vacuum suction, gene gun, etc., have been successfully applied to transient transformation research of many plants due to their rapid and effective characteristics. They have been widely used in subcellular localization, protein interaction, promoter activity analysis, vector availability verification and gene function verification, shortening the cycle of gene function verification. At present, the verification of gene function of Phalaenopsis is usually carried out by heterologous transformation of plants such as tobacco, Arabidopsis, and petunia. This method is heterologous function verification and has great differences compared with the body. The transient expression methods based on Phalaenopsis that have been reported so far mainly use flower buds as receptor materials. The transient expression cycle is long, difficult, and the effect is poor. In addition, the receptor materials of the reported methods are limited to a single variety, which greatly restricts the progress of Phalaenopsis biotechnology research. Therefore, the development of a specific, efficient, and broad-spectrum transient expression vector system and a matching transient expression method in Phalaenopsis has become an urgent problem to be solved. Summary of the invention
[0005] In view of the above problems, the present invention provides a vector and method for quickly realizing transient expression in Phalaenopsis. The present invention first constructs a transient expression vector GUS-1300 containing a GUS reporter gene, extracts plasmids, transforms Agrobacterium, prepares infection solution, and then directly injects Phalaenopsis petals and sepals to transiently express proteins, and performs GUC staining analysis after co-cultivation. The present invention realizes protein expression in Phalaenopsis itself, solves the defect that Phalaenopsis biotechnology research relies on exogenous expression systems; transient expression of proteins, short cycle, 3 days to get results, solves the problems of long cycle, high difficulty and low efficiency of Phalaenopsis transient expression, and achieves the effect of short experimental cycle, simple operation and high efficiency of transient expression; the method is not limited to flower buds, directly infects petals, is more efficient, and has wide applicability. Various types of Phalaenopsis can be used as materials for transient expression, solving the problem of single receptor of Phalaenopsis transient expression system.
[0006] The present invention firstly provides a vector for rapidly realizing transient expression in Phalaenopsis, wherein the vector is a GUS-1300 vector.
[0007] The present invention also provides a method for rapidly achieving transient expression in Phalaenopsis, which is characterized by:
[0008] 1) First, construct a transient expression vector GUS-1300 containing the GUS reporter gene, then extract the plasmid and transform Agrobacterium to obtain positive Agrobacterium containing the target gene;
[0009] 2) Preparation of infection solution
[0010] Prepare a resuspension, and culture the single Agrobacterium colony containing the target gene obtained in step 1) by shaking until the bacterial solution OD 600 The value is between 0.8 and 1.0. Collect the cells by centrifugation and resuspend the cells in resuspension solution to OD 600 The value is between 0.8 and 1.0, and the infection solution is obtained by standing in the dark for 3-5 hours;
[0011] 3) Injection of Phalaenopsis petals and sepals to transiently express proteins
[0012] Select Phalaenopsis flowers that are healthy, free of obvious diseases and insect pests, and fully open for no more than 3 days as the materials to be infected;
[0013] Take a medical sterile syringe, suck up the infecting solution, use the needle to make a cross-shaped incision on the back of the petals or sepals, remove the needle, and use the syringe to inject the infecting solution into the cross-shaped incision. Stop injecting after the entire petal or sepal is completely infected, and the infection is complete;
[0014] Place the infected Phalaenopsis back into the original culture greenhouse and culture it in the dark for 12±2h, then culture it under normal conditions for 48±2h, take samples for staining and analysis or store them for the next step.
[0015] Furthermore, the sampling and staining analysis is as follows: taking the co-cultivated Phalaenopsis petals or sepals, using a hole puncher to punch the Phalaenopsis petals or sepals into original pieces with a diameter of 1 cm for easy staining, and adding them into GUS staining solution for staining analysis.
[0016] Furthermore, the GUS dye solution is as follows: each milliliter of the GUS dye solution contains 5 μl of 0.1 mg / μl X-Gluc solution, 754 μl of 0.1 mol / L phosphate buffer, 10 μl of 5 mmol / L potassium ferrocyanide, 10 μl of 5 mmol / L potassium ferrocyanide, 20 μl of 0.5 mol / L ETA, 200 μl of methanol, and 1 μl of Triton X-100.
[0017] Furthermore, from the top of the flower branch downward, the ability of the petals to withstand exogenous injection gradually decreases, and the efficiency of transient expression gradually decreases. It is best to choose the fully open flowers at the top as the infection material.
[0018] Furthermore, the resuspension solution contains 10 mM MES (pH 5.6), 10 mM MgCl2, and 200 μM AS.
[0019] Further, the obtained Agrobacterium colony containing the target gene was added to LB liquid medium containing 50 mg / L Kan+ and 50 mg / L Rif+ and cultured with shaking until the bacterial liquid OD reached 0. 600 The value is between 0.8-1.0.
[0020] The technical effects of the present invention are:
[0021] 1. Instant protein expression, short cycle, results can be obtained in 3 days; it solves the problems of long cycle, high difficulty and low efficiency of Phalaenopsis transient expression, and achieves the effect of short experimental cycle, simple operation and high efficiency of transient expression;
[0022] 2. It has realized the transient expression of proteins in Phalaenopsis orchids, solving the defect that Phalaenopsis orchid biotechnology research relies on exogenous expression systems;
[0023] 3. Both petals and sepals can be used as platforms for protein expression, not limited to flower buds, and can directly infect petals, which is more efficient; the desired expression site can be directly injected, which has stronger specificity and clearer target sites;
[0024] 4. The vector can be used directly to construct transient expression systems in other species and varieties, or to insert the target gene through homologous recombination, double enzyme digestion, etc., to detect the expression characteristics of the target gene;
[0025] 5. Rapidly verify the gene function in Phalaenopsis orchids, which can be used for the study of Phalaenopsis orchid color, flower fragrance, aging, stress, etc. The method has wide applicability, and all types of Phalaenopsis orchids can be used as materials for transient expression, solving the problem of single receptor in Phalaenopsis transient expression system. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 The present invention is a flowchart of the operation of rapidly achieving transient expression in Phalaenopsis;
[0027] Figure 2 GUS gene PCR amplification band (2 replicates);
[0028] Figure 3 It is divided into different development stages of Phalaenopsis flowers;
[0029] Figure 4 is the effect of different co-culture methods on infection efficiency after infection (2 replicates);
[0030] Figure 5 The GUS protein was successfully expressed in Phalaenopsis sepals for the transient expression system (3 replicates);
[0031] Figure 6 This is an analysis of the staining of GUS protein transiently expressed in 10 Phalaenopsis varieties. DETAILED DESCRIPTION
[0032] The effects are described below with reference to the embodiments and drawings.
[0033] Example 1
[0034] Operation flow chart see Figure 1 , as follows:
[0035] 1. Vector construction: HindIII and KpnI were selected as restriction sites for homologous recombination, and homologous recombination primers targeting the GUS gene (SEQ No. 1) were designed, namely GUS-1300-HindIII-F: GACTCTAGTCTAGAAAGCTTATGGTAGATCTGACTAGTTTACGTC (SEQ No. 2), GUS-1300-KpnI-R: CCCTTGCTCACCATGGTACCCACGTGGTGGTGGTGGTGGTG (SEQ No. 3), and the target GUS gene was amplified using a high-fidelity enzyme.
[0036] 1) The PCR reaction system is shown in Table 1.
[0037] Table 1 PCR reaction system
[0038]
[0039]
[0040] 2) Reaction procedure
[0041] 98℃, 5min; 98℃, 15s; 58℃, 15s; 72℃, 1min; 72℃, 10min, 34 cycles.
[0042] The PCR products were separated by agarose gel electrophoresis and the GUS gene was recovered from the gel. The PCR results were as follows: Figure 2 Then, the target vector pSuper1300 was linearized by double restriction digestion.
[0043] 1) The enzyme digestion reaction system is shown in Table 2.
[0044] Table 2 Double enzyme digestion system
[0045]
[0046] 2) Reaction procedure
[0047] 37℃, 15min; 80℃, 10min.
[0048] The GUS gene was constructed into the pSuper1300 vector using recombinase to form the GUS-1300 vector.
[0049] 1) The reaction system is shown in Table 3, and the molar ratio of the gene fragment to the linearized vector is about 3:1.
[0050] Table 3 Recombination ligation reaction system
[0051]
[0052] 2) Reaction procedure
[0053] 50℃,30min.
[0054] Then the recombinant ligation product was transformed into Escherichia coli DH5α, spread on LB solid medium containing 50 mg / L kan + antibiotics, cultured at 37°C overnight, single clones were picked, PCR was performed, and sequencing was performed to obtain positive strains.
[0055] 2. Plasmid extraction: Use a sterilized toothpick to pick up the positive plaques obtained in step 1, place them in LB liquid culture medium containing 50 mg / L kan + antibiotics, shake and culture at 200 rpm in a 37°C shaker for 8 h, purify the extracted plasmid, and store it in a -80°C refrigerator for use in the next step.
[0056] 3. Transformation of Agrobacterium: Take the plasmid containing the GUS gene obtained in step 2 and mix it with Agrobacterium competent cells (EHA105); place it on ice for 5 minutes, quick-freeze it with liquid nitrogen for 5 minutes, and water bath it at 37°C for 5 minutes; then add 500μl LB liquid culture medium, place it in a 28°C shaker and shake it at 200rpm for 3-5h; centrifuge it at 5000rpm, discard the supernatant, take 100μl LB liquid culture medium to resuspend the bacteria, spread it on LB solid culture medium containing 50mg / L Kan+ and 50mg / L Rif+, and place it in a 28°C incubator in the dark for 2-3d until colonies grow; pick a single clone, perform PCR identification, and obtain positive Agrobacterium containing the target gene.
[0057] 4. Preparation of resuspension: prepare resuspension, which contains 10 mM MES (pH 5.6), 10 mM MgCl2, and 200 μM / 400 μM AS (acetosyringone). Prepare and use immediately.
[0058] 5. Preparation of infection solution: Take the single colony of Agrobacterium containing the target gene obtained in step 3, add it to LB liquid medium containing 50 mg / L Kan+ and 50 mg / L Rif+, and culture it at 28°C in a shaker at 200 rpm for 16 h until the OD value of the bacterial solution reaches 600 The value is between 0.8 and 1.0. Collect the cells by centrifugation at 5000 rpm for 7 min and resuspend the cells in the resuspension solution in step 4 at a ratio of 1:1 to OD 600 The value is between 0.8-1.0, and it is allowed to stand in the dark for 3-5 hours to obtain the infection solution.
[0059] 6. Petal selection: Select Phalaenopsis flowers that are healthy, have no obvious diseases and pests, and are fully open for no more than 3 days as the materials to be infected. Wax flowers, paper flowers, semi-wax flowers, etc. can all be used as objects of infection, and are not limited to organs such as petals and calyx.
[0060] 7. Infect petals: Take a 1ml medical sterile syringe, draw up the infection solution, use the needle to make a cross-shaped incision on the back of the petals (be careful not to puncture it), remove the needle, and use the syringe to inject the infection solution into the cross-shaped incision. Stop injecting after the entire petal is completely infected, and the infection is complete.
[0061] 8. Co-cultivation: Return the infected Phalaenopsis in step 7 to the original cultivation greenhouse, culture in the dark for 12 hours, then culture under normal conditions for 48 hours, take samples for staining and analysis or store for the next step.
[0062] 9. Preparation of GUS dye solution: Each milliliter of GUS dye solution contains 5 μl of 0.1 mg / μl X-Gluc solution, 754 μl of 0.1 mol / L phosphate buffer, 10 μl of 5 mmol / L potassium ferrocyanide, 10 μl of 5 mmol / L potassium ferrocyanide, 20 μl of 0.5 mol / L EDTA, 200 μl of methanol, and 1 μl of Triton X-100.
[0063] 10. GUS staining: Take the Phalaenopsis petals cultured in step 9, use a hole puncher to punch the Phalaenopsis petals into 1 cm diameter original pieces for easy staining, add the GUS staining solution in step 9, and stain at 37°C for 12 hours.
[0064] 11. Decolorization: Take the original petals stained in step 10, remove the GUS dye solution, add 75% ethanol, and place at 37°C for decolorization for 24 hours until the pigment in the petals is completely removed. During this period, replace the 75% ethanol 3-5 times.
[0065] 1. Analysis of infection efficiency of different infection solutions
[0066] In order to explore the effect of different infection solutions on transient expression efficiency, two different infection solutions were designed to obtain an efficient infection solution formula. The composition of infection solution A is: 10mM MES (pH5.6), 10mM MgCl2, 200μM AS; the composition of infection solution B is: 10mM MES (pH5.6), 10mM MgCl2, 400μM AS. Analysis of the GUS staining results showed that infection solution A had better infection effect and higher efficiency. Statistical results showed that the infection efficiency of infection solution A reached 60%, while the infection efficiency of infection solution B was only 20%. In addition, some petals infected with infection solution B showed necrosis. Therefore, infection solution A is more suitable for the transient expression system of Phalaenopsis petals.
[0067] Table 4 Statistics of infection efficiency of different infection solutions
[0068]
[0069] 2. Comparison of transient expression efficiency in Phalaenopsis petals at different developmental stages
[0070] Phalaenopsis has a long flowering period, the whole plant can bloom for 3-6 months, and a single flower can bloom for 1-2 months. During the development of flowers, the secondary metabolites and subcellular structures in the flower organ cells will change at different levels. In order to determine the best infection state of flower organs, plants with 5 or more flowers on the branches were selected as materials, and the flowers within 3 days of full opening at the top were selected as F1. F1, the third flower away from the top F3, and the fifth flower F5 were selected as the flowers to be tested ( Figure 3 ), infection liquid A was used for infection.
[0071] Phalaenopsis flower development stages Figure 3 As shown. The statistics of petal infection efficiency at different developmental stages are shown in Table 5. The results of GUS staining showed that there were large differences in the transient expression efficiency of petals at different developmental stages. At the same time, the tolerance of petals at different developmental stages to exogenous injection was different. After 3 days of co-cultivation, the 10 petals of the top F1 type were the same as before injection, and the transient expression efficiency was the highest, reaching 70%; the transient expression efficiency of the F3 type petals was 60%; and after 3 days of co-cultivation, 2 petals of the F5 type had varying degrees of necrosis, and only 3 of the remaining flowers successfully expressed transiently, but the staining was lighter. The above results mean that from the top of the flower branch downward, the ability of the petals to withstand exogenous injection gradually decreases, and the transient expression efficiency gradually decreases. It is best to choose the topmost fully open flowers as the infection material.
[0072] Table 5 Statistics of infection efficiency of petals at different developmental stages
[0073]
[0074]
[0075] 3. Effects of different co-culture methods on infection efficiency
[0076] Co-cultivation methods can have different effects on transient expression efficiency. Early dark treatment helps to improve expression efficiency. In order to determine whether dark treatment can affect transient expression efficiency during Phalaenopsis transient expression, based on the above-mentioned petal infection efficiency test experiment at different developmental stages, an experimental treatment was designed in which the flowers were placed in the original culture greenhouse (D+N) after being dark treated for 12 hours after injection (F1 flowers were infected with infection solution A). GUS staining results showed that the transient expression efficiency of D+N treatment reached 90% (see Table 5), and the single petal was stained darker, which means that more GUS protein was expressed ( Figure 4 ). Therefore, the co-cultivation method of first darkening and then returning to the original culture greenhouse is more effective for the transient expression of Phalaenopsis orchid organs.
[0077] IV. Application of transient expression system in Phalaenopsis sepals
[0078] The ornamental parts of Phalaenopsis orchids are mainly petals and sepals. Unlike other plants, the sepals of most cultivated Phalaenopsis orchids are similar in texture to the flowers. In order to explore whether this system can be used for transient expression in sepals, sepals within 3 days of full flower expansion were selected for trial. The GUS staining results showed that the GUS protein was successfully expressed in the sepals ( Figure 5 ), sepals can also be used as carriers for transient expression of proteins.
[0079] 5. Application of transient expression system in different species and types of Phalaenopsis orchid organs
[0080] There are many varieties of Phalaenopsis, with more than 30,000 varieties and more than 70 native species recorded worldwide. my country has 8 native species of Phalaenopsis, making it one of the main origins of Phalaenopsis. The rich flower shapes and colors of Phalaenopsis provide convenience for studying biological issues such as evolution and flower organ development. There are huge differences between different varieties of Phalaenopsis. According to the size of the petals, they are divided into three types: small, medium and large. According to the texture of the petals, they are divided into three types: waxy, semi-waxy and fleshy. At the same time, Phalaenopsis has rich colors, and all colors of Phalaenopsis except blue exist. It is unknown whether the transient expression system can be applied to different varieties and types of Phalaenopsis flower organs. Therefore, in order to test whether the system can be used for different varieties and types of Phalaenopsis flower organs, 10 types of Phalaenopsis petals were selected for trial. The 10 types of Phalaenopsis included small flower types (3), medium flower types (4), and large flower types (3); three types of petal textures: waxy (1), semi-waxy (5), and fleshy (4); and three mainstream colors: white (3), yellow (3), and red (4). After transient expression testing, GUS staining results showed that all 10 types of petals could be colored to varying degrees (see Figure 6 ), which means that the system can be applied to transient expression of different types of Phalaenopsis petals.
[0081] In summary, by comparing different infection solutions, materials at different developmental stages, and different co-cultivation methods, we established a transient expression system that can be applied to different floral organs and different types of Phalaenopsis varieties.
Claims
1. A vector for rapid transient expression in Phalaenopsis, characterized in that: The vector is a GUS-1300 vector.
2. A method for rapidly achieving transient expression in Phalaenopsis, characterized in that: 1) First, construct a transient expression vector GUS-1300 containing the GUS reporter gene, then extract the plasmid and transform Agrobacterium to obtain positive Agrobacterium containing the target gene; 2) Preparation of infection solution Prepare a resuspension, and culture the single Agrobacterium colony containing the target gene obtained in step 1) by shaking until the bacterial solution OD 600 The value is between 0.8 and 1.
0. Collect the cells by centrifugation and resuspend the cells in resuspension solution to OD 600 The value is between 0.8 and 1.0, and the infection solution is obtained by standing in the dark for 3-5 hours; 3) Injection of Phalaenopsis petals and sepals to transiently express proteins Select Phalaenopsis flowers that are healthy, free of obvious diseases and insect pests, and fully open for no more than 3 days as the materials to be infected; Take a medical sterile syringe, suck up the infecting solution, use the needle to make a cross-shaped incision on the back of the petals or sepals, remove the needle, and use the syringe to inject the infecting solution into the cross-shaped incision. Stop injecting after the entire petal or sepal is completely infected, and the infection is complete; Place the infected Phalaenopsis back into the original culture greenhouse and culture it in the dark for 12±2h, then culture it under normal conditions for 48±2h, take samples for staining and analysis or store them for the next step.
3. A method for rapidly achieving transient expression in Phalaenopsis as claimed in claim 2, characterized in that: The sampling and staining analysis comprises the following steps: taking the co-cultivated Phalaenopsis petals or sepals, using a hole puncher to punch the Phalaenopsis petals or sepals into original pieces with a diameter of 1 cm for easy staining, and adding the pieces into a GUS stain solution for staining analysis.
4. A method for rapidly achieving transient expression in Phalaenopsis as claimed in claim 3, characterized in that: The GUS dye solution comprises: each milliliter of the GUS dye solution contains 5 μl of 0.1 mg / μl X-Gluc solution, 754 μl of 0.1 mol / L phosphate buffer, 10 μl of 5 mmol / L potassium ferrocyanide, 10 μl of 5 mmol / L potassium ferrocyanide, 20 μl of 0.5 mol / L EDTA, 200 μl of methanol, and 1 μl of Triton X-100.
5. A method for rapidly achieving transient expression in Phalaenopsis as claimed in claim 4, characterized in that: From the top of the flower branch downward, the ability of the petals to withstand exogenous injection gradually decreases, and the efficiency of transient expression gradually decreases. The fully open flowers at the top are selected as the infection material.
6. A method for rapidly achieving transient expression in Phalaenopsis as claimed in claim 2, characterized in that: The resuspension solution contained 10 mM MES, pH 5.6, 10 mM MgCl2, and 200 μM AS.
7. A method for rapidly achieving transient expression in Phalaenopsis as claimed in claim 2, characterized in that: In step 2), the obtained single colony of Agrobacterium containing the target gene was added to LB liquid culture medium containing 50 mg / L Kan+ and 50 mg / L RIf+ and cultured with shaking until the bacterial liquid OD reached 600 The value is between 0.8-1.0.