HIV-1 nucleic acid detection quality control product prepared based on lentiviral vector system

Abstract

The invention relates to the technical field of pseudovirus preparation and nucleic acid detection, and particularly provides an HIV-1 pseudovirus based on lentiviral vector system packaging and a prepared HIV-1 nucleic acid detection quality control product. On the basis of pLL3.7 plasmid of an existing lentiviral vector system, a modified vector system is obtained by deleting a U6 promoter, the HIV-1 pseudovirus is successfully prepared, and an HIV-1 nucleic acid detection quality control product is further developed. The HIV-1 nucleic acid detection quality control product provided by the invention has the following advantages: the biological safety is high, and the transportation and the storage are easy; the characteristics of natural viruses can be simulated, and the quality control of the whole nucleic acid detection process is realized; the preparation method is low in cost and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of pseudovirus preparation and nucleic acid detection thereof, and in particular to a HIV-1 nucleic acid detection quality control product prepared based on a lentiviral vector system. Background Art

[0002] The diagnosis of human immunodeficiency virus type 1 (HIV-1) mainly relies on HIV laboratory testing, including serological testing and nucleic acid testing. Compared with serological testing, HIV-1 nucleic acid testing has advantages such as higher sensitivity and specificity. More importantly, the window period of nucleic acid testing is short, which can effectively reduce the missed detection of early acute HIV-1 infection, which is of great significance for controlling the spread of HIV-1 infection. Nucleic acid testing is also increasingly widely used in disease diagnosis and monitoring testing. Therefore, quality control of HIV-1 nucleic acid testing is crucial.

[0003] At present, HIV-1 nucleic acid test quality control products are mainly prepared using clinical samples from HIV-1 infected persons, inactivated HIV-1 strains or MS2-armored RNA. However, with the growing demand for quality control, the limitations of these materials are becoming more and more significant. Clinical samples from HIV-1 infected persons are the best and ideal materials, but it is difficult to obtain them in large quantities and continuously, and it is difficult to meet the current actual needs; the isolation, culture and inactivation process of HIV-1 strains need to be carried out in a high biosafety level laboratory, which not only has high requirements for operating technology, but also has high costs, which limits its use in the preparation of HIV-1 nucleic acid test quality control products. Although MS2 has high safety and stability as a quality control product for HIV-1 nucleic acid testing, it does not have the virological structure and characteristics of natural viruses, and cannot fully simulate the complex process of extraction and detection of real virus particles.

[0004] Based on the above background, the present invention uses a modified four-plasmid lentiviral vector (LV) system to package HIV-1 pseudovirus, and further develops a new HIV-1 nucleic acid detection quality control product. The HIV-1 nucleic acid detection quality control product provided by the present invention has the following advantages: high biosafety, easy transportation and storage; can be prepared in large quantities at low cost; can simulate the characteristics of natural viruses, and realizes quality control of the entire nucleic acid detection process. Summary of the invention

[0005] The purpose of the present invention is to prepare HIV-1 pseudovirus using a lentiviral vector system, and to apply it to the preparation of HIV-1 nucleic acid detection quality control products. In order to improve the biosafety of the lentiviral vector system, the inventors first modified the existing four-plasmid lentiviral vector system, and successfully prepared HIV-1 pseudovirus using the improved four-plasmid lentiviral vector system. Subsequently, a new HIV-1 nucleic acid detection quality control product was prepared based on the HIV-1 pseudovirus.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a vector expression plasmid pLL3.7-U6-del in a lentiviral vector system. The nucleotide sequence of the vector expression plasmid is shown in SEQ ID NO.1.

[0008]

[0009] The present invention also provides a method for constructing the vector expression plasmid. The vector expression plasmid is based on the vector plasmid pLL3.7 and is obtained by deleting the U6 promoter carried by pLL3.7.

[0010] The present invention also provides a lentiviral vector packaging system, comprising the vector expression plasmid pLL3.7-U6-del, backbone plasmids pRSV-Rev and pMDLgag-poLRRE, and envelope plasmid pMD2.G.

[0011] The present invention also provides a recombinant vector expression plasmid pLL3.7-gag-pol constructed by the vector expression plasmid, the nucleotide sequence of the recombinant vector expression plasmid pLL3.7-gag-pol is shown in SEQ ID NO.2, and the HIV-1 conserved region sequence includes pol region 2328-4562nt, pol region 4956-5130nt and gag region 1280-1850nt.

[0012]

[0013] The present invention also provides a method for constructing the recombinant vector expression plasmid pLL3.7-gag-pol, comprising the following steps:

[0014] (1) The HIV-1 conserved sequences of 2328-4562 nt in the pol region, 4956-5130 nt in the pol region, and 1280-1850 nt in the gag region were selected as target sequences;

[0015] (2) inserting the target sequence into the vector expression plasmid pLL3.7-U6-del, and inserting a BamHI restriction site at a specific position to obtain a recombinant vector expression plasmid pLL3.7-gag-pol;

[0016] The nucleotide sequence of 2328-4562 nt of the pol region in step (1) is shown in SEQ ID NO.3;

[0017]

[0018] The nucleotide sequence of the pol region at 4956 - 5130 nt is shown as SEQ ID NO.4;

[0019] SEQ ID NO.4: tggaaaggtgaaggggcagtagtaatacaagataatagtgacataaaagtagtgccaagaagaaaag caaagatcattagggattatggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgaggattagaacatggaaaagttta gtaaaacaccatatgtat。

[0020] The nucleotide sequence of the gag region at 1280 - 1850 nt is shown as SEQ ID NO.5;

[0021] SEQ ID NO.5: tcagcccagaagtgatacccatgttttcagcattatcagaaggagccaccccacaagatttaaacaccat gctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagagaccatcaatgaggaagctgcagaatgggatagagtgcatccagtgcatgcagggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactactagtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaaatttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctaccagcattctggacataagacaaggaccaaaggaaccctttagagactatgtagaccggttctataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaaccttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcggctacactagaagaaatgatgacagcatgtcagggagtagg。

[0022] In step (2), the upstream primer of pol region 2328-4562 nt and the downstream primer of gag region 1280-1850 nt are used for cloning;

[0023] The nucleotide sequence of the upstream primer of pol region 2328-4562 nt is shown in SEQ ID NO.6;

[0024] The nucleotide sequence of the downstream primer of 1280-1850 nt of the gag region is shown in SEQ ID NO.7.

[0025] The present invention also provides a lentiviral vector system for packaging HIV-1 pseudovirus, comprising the recombinant vector expression plasmid pLL3.7-gag-pol, backbone plasmids pRSV-Rev and pMDLgag-poL RRE, envelope plasmid pMD2.G

[0026] The present invention also provides a method for preparing HIV-1 pseudovirus nucleic acid detection quality control product using the lentiviral vector packaging system, comprising the following steps:

[0027] (1) using the lentiviral vector packaging system, the plasmid and the transfection reagent are mixed and allowed to stand, then slowly added to the culture medium to transfect HEK293T cells;

[0028] (2) After transfection, culture for 44 to 52 h and collect the culture supernatant;

[0029] (3) centrifuging and filtering the culture supernatant to obtain the HIV-1 pseudovirus supernatant;

[0030] The transfection system used in step (1) is: 7-9 μg pLL3.7-gag-pol, 3-5 μg pRSV-Rev, 3-5 μg pMDLgag-pol RRE and 3-5 μg pMD2.G, 46-50 μL Lipofectamine 2000 is added to 240-260 μL Optimem (Gibco) and mixed, and 0.8-1.2×10 7 cells / T75 HEK293T cells;

[0031] The standing time in step (1) is 10 to 15 minutes, and the culture medium is DMEM culture medium containing 8 to 12% FBS;

[0032] The culture conditions in step (2) are 35-39° C. and 4.8-5.2% CO 2 ;

[0033] The culture medium is replaced once after 3 to 5 hours of culture in step (2), and the culture supernatant is collected 44 to 52 hours after the culture medium is replaced;

[0034] The centrifugation conditions in step (3) are 1800-2200 rpm, 3-5° C., and 8-12 min, and a 0.45 μm microporous filter is used for filtration.

[0035] The invention also provides HIV-1 pseudovirus prepared by the method.

[0036] The present invention also provides a quality control product for HIV-1 nucleic acid detection prepared by using the HIV-1 pseudovirus.

[0037] The present invention also provides a primer probe group for quantitatively detecting the HIV-1 pseudovirus nucleic acid detection quality control product, comprising an upstream primer, a downstream primer and a probe, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.10, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11, and the nucleotide sequence of the probe is shown in SEQ ID NO.12.

[0038] The beneficial effects of the above technical solution of the present invention are as follows:

[0039] (1) High biosafety

[0040] The present invention blocks the expression of the inserted gene protein by removing the U6 promoter, improves the existing four-plasmid lentiviral vector system, effectively prevents the "infectious recurrence" of pseudoviruses caused by carrying HIV-1 RNA fragments, has higher biosafety, and overcomes the biosafety risks of clinical samples and inactivated viruses. The data of the embodiment show that the HIV-1 pseudovirus used in the preparation of HIV-1 nucleic acid detection quality control products of the present invention has only a single round of infection ability and has a high degree of biosafety. Therefore, the acquisition of HIV-1 pseudoviruses and the preparation of HIV-1 nucleic acid detection quality control products can be carried out in a Class 2 biosafety laboratory, which reduces the biosafety level requirements for the operating environment and subsequent transportation conditions and storage environment, and is convenient for operation, transportation and storage.

[0041] (2) More closely simulate the biological characteristics of real viruses and achieve full-process quality control of nucleic acid testing

[0042] The HIV-1 pseudovirus particles used in the preparation of HIV-1 nucleic acid detection quality control products of the present invention have a membrane structure observed under an electron microscope, and can truly simulate the structure and characteristics of natural viruses. This characteristic enables it to simulate the entire detection process of clinical samples, including each stage of nucleic acid extraction and nucleic acid amplification detection, thereby achieving full-process quality control of the detection process and effectively meeting the actual detection work needs. In addition, the present invention can also quickly prepare pseudoviruses and nucleic acid detection quality control products of different years, different regions and different HIV-1 subtypes by inserting different target fragments based on the improved lentiviral vector system, overcoming the limitations of a single type of clinical samples and inactivated viruses.

[0043] (3) Easy to prepare in large quantities

[0044] The pseudovirus packaging process of the lentiviral vector system provided by the present invention is simple, and the vector expression plasmid pLL3.7-U6-del contains the cPPT / CTS sequence of the HIV-1pol gene that assists the intranuclear transport of viral DNA, and has high transfection efficiency and high packaging product titer. The data of the embodiment of the present invention show that the concentration of up to 10 can be harvested two days after transfection. 9 The HIV-1 pseudovirus with a capacity of 10 copies / mL overcomes the limitations of limited sources and low concentrations of clinical samples and inactivated viruses, can meet the material needs of subsequent industrial preparation of HIV nucleic acid testing quality control products, reduce costs, and show broad application prospects.

[0045] (4) Have good quality control performance

[0046] The present invention conducts a comprehensive evaluation of the homogeneity, stability, matrix effect, applicability and inter-laboratory quality assessment (EQA) availability of the prepared quality control products. The data of the embodiments of the present invention show that the HIV-1 nucleic acid detection quality control products prepared by the present invention using HIV-1 negative plasma as a matrix have good homogeneity and are consistent with clinical samples without matrix effect; good stability, short-term stability is better than inactivated HIV-1 quality control products, and freeze-thaw stability is better than MS2-armored RNA quality control products; wide range of application, 12 commercial kits can successfully detect HIV-1 pseudovirus quality control products; EQA application results of HIV-1 nucleic acid detection quality control products also show good stability. Therefore, the HIV-1 nucleic acid detection quality control products provided by the present invention have good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1The figure shows the construction and identification results of the recombinant vector expression plasmid pLL3.7-gag-pol, wherein A is a schematic diagram of the construction process of pLL3.7-gag-pol and the lentiviral vector system used to package HIV-1 pseudovirus; B and C are electrophoretic diagrams of the products of double restriction enzyme digestion of plasmids pLL3.7 and pLL3.7-U6-del, and plasmid pLL3.7-gag-pol.

[0048] Figure 2 Representative fluorescence microscopy images of HEK-293T cells 48 hours after plasmid transfection.

[0049] Figure 3 The results of pseudovirus identification; A is a representative image of pseudovirus particles obtained by transmission electron microscopy, where the red arrow points to; B is the p24Ag concentration in the culture supernatant after transfection for 1-5 days; C is the electrophoresis of the amplified products of pseudovirus RNA and HEK 293T cell DNA amplified by RT-PCR and PCR.

[0050] Figure 4 This is the safety evaluation result of the pseudovirus.

[0051] Figure 5 Results of quantification and linearity analysis of serial dilutions of HIV-1 pseudovirus supernatant by RT-dPCR.

[0052] Figure 6 These are the short-term stability analysis results of the three material quality controls (ns indicates no statistically significant difference).

[0053] Figure 7 Results of freeze-thaw stability analysis of quality control samples of the three materials (ns indicates no statistically significant difference).

[0054] Figure 8 These are the results of matrix effect evaluation of HIV-1 pseudovirus quality control products; A is HIV-1 nucleic acid detection quality control product prepared with HIV-1 negative plasma as the matrix; B is HIV-1 nucleic acid detection quality control product prepared with 10% DMEM as the matrix (the solid line is the regression curve of HIV-1 positive patient plasma and HIV-1 pseudovirus quality control product measured by two methods, and the dotted line is the 95% confidence interval of its predicted value y; the black circle represents HIV-1 positive patient plasma, the red circle represents negative plasma as the matrix, and the green circle represents 10% DMEM as the matrix). DETAILED DESCRIPTION

[0055] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1 Modification of Lentiviral Vector Packaging System

[0057] 1. Construction and identification of vector expression plasmid pLL3.7-U6-del

[0058] In order to prevent the protein expression of the inserted gene and improve the biological safety of HIV-1 RNA, the present invention transforms the vector plasmid pLL3.7 in the four-plasmid packaging system, deletes the U6 promoter (314bp) carried between the restriction endonuclease sites XbaI and XhoI on pLL3.7, and the four-plasmid packaging system vector plasmid pLL3.7, backbone plasmids pRSV-Rev and pMDLgag-pol RRE, and envelope plasmid pMD2.G are purchased from Bomade Co., Ltd. (Beijing, China).

[0059] The specific construction steps of the vector expression plasmid pLL3.7-U6-del are as follows:

[0060] (1) Linearized vector plasmid pLL3.7

[0061] The vector plasmid pLL3.7 was double-digested with restriction endonucleases XbaI and XhoI at 37°C for 1 hour, and then heat-treated at 65°C for 20 minutes. The linearized vector product pLL3.7 was recovered and purified by running on a gel. The double-digestion reaction system is shown in Table 1.

[0062] Table 1 Double enzyme digestion reaction system

[0063]

[0064] (2) Obtaining a double-stranded DNA fragment without the U6 promoter

[0065] Self-PCR amplification was performed using a primer pair with homology arm sequences (XbaI upstream and XhoI downstream) to obtain a double-stranded DNA fragment without the U6 promoter;

[0066] The primer sequences are as follows. The underlined sequences in the upstream primer and the downstream primer represent the sequences of the restriction endonuclease sites XbaI and XhoI, respectively:

[0067] F:5'-ttggttagtaccgggcccgc tctaga aacgcgcggtgaccctcgaggtcg-3'(SEQ IDNO.8),

[0068] R:5'-agcttatcgataccgtcgac ctcgag ggtcaccgcgcgtttctagagcgggccc-3' (SEQ ID NO. 9).

[0069] (3) Obtaining the ligation product pLL3.7-U6-del

[0070] The double-stranded DNA fragment obtained in step (2) was subjected to Gibson seamless cloning with the linearized vector pLL3.7, and the ligation reaction conditions were 50°C for 30 min to obtain the ligation product pLL3.7-U6-del. The Gibson seamless cloning system is shown in Table 2, and the seamless cloning homologous recombinase (2×Seamless Cloning Mix) was purchased from Biomed.

[0071] Table 2 Gibson seamless cloning system

[0072]

[0073] (4) Transformation of ligation product pLL3.7-U6-del

[0074] The ligation product in step (3) is transformed into stble 3 competent cells, and the specific steps are as follows:

[0075] Take 10 μL of the ligation product and add it to 100 μL of stble 3 competent cells, place it in an ice bath for 30 minutes, place it in a 42°C water bath for 90 seconds, and then place it in an ice bath for 2 minutes. Add 500 μL of SOB culture medium for recovery (37°C, shaker 200 rpm for 1 hour). Take 200 μL of the mixed culture medium and spread it on an Amp-resistant LB plate, and culture it in a 37°C incubator overnight (15 hours).

[0076] (5) Obtaining the vector expression plasmid pLL3.7-U6-del

[0077] Single clones were selected for plasmid extraction and sent for sequencing. The clones with correct sequencing were selected for plasmid extraction to obtain the vector expression plasmid pLL3.7-U6-del.

[0078] The gel electrophoresis confirmed that the electrophoresis band positions of the vector plasmid pLL3.7 (7650 bp) and the modified vector expression plasmid pLL3.7-U6-del (7336 bp) were consistent with the theoretical positions ( Figure 1 B). The sequence of the constructed vector expression plasmid pLL3.7-U6-del was verified by Sanger sequencing.

[0079] The above experimental results all prove that the vector expression plasmid pLL3.7-U6-del was successfully constructed.

[0080] 2. Fake virus packaging

[0081] (1) The transfection system for packaging pseudovirus is as follows:

[0082] 8 μL (1 μg / μL) pLL3.7 or pLL3.7-U6-del, 4 μL (1 μg / μL) pRSV-Rev, 4 μL (1 μg / μL) pMDLgag-pol RRE, 4 μL (1 μg / μL) pMD2.G and 50 μL transfection reagent Lipofectamine 2000 were added to 250 μL Eptimem (Gibco) and mixed. After standing at room temperature for 20 min, the mixture was added to a T75 culture flask of HEK293T cells (1×10 7 HEK293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences (No. SCSP-502).

[0083] (2) 4 hours after transfection, fresh 10% DMEM was replaced. 48 hours after transfection, the culture supernatant containing pseudovirus particles was collected and centrifuged at 2000 rpm and 4°C for 10 min to remove cell debris. The supernatant was filtered using a 0.45 μm microporous filter and its FBS concentration was adjusted to 20%. The pseudovirus supernatant was harvested, aliquoted into 1 mL / tube, and stored at -80°C.

[0084] 3. Evaluation of the packaging effect of lentiviral packaging systems pLL3.7 and pLL3.7-U6-del

[0085] According to the above experimental steps, the pseudovirus pLL3.7 and pLL3.7-U6-del were packaged respectively according to the same transfection system and conditions. After 48 hours of transfection, the culture supernatant, i.e., the pseudovirus supernatant, was harvested and then DAPI nucleus staining was performed. The GFP fluorescence expression intensity of the transfection system was observed using a fluorescence microscope to compare the transfection efficiency of the two packaging systems.

[0086] Figure 2 As shown, 48 hours after transfection, the GFP fluorescence intensity of the pLL3.7-U6-del transfection system was stronger than that of the pLL3.7 transfection system, and no fluorescence was observed in the cell control.

[0087] The two pseudovirus supernatants were diluted 10 4 After doubling, take 3 tubes of each pseudovirus solution dilution and use RNA was extracted using Viral RNA Mini Kit (purchased from QIAGEN), and quantitative detection was performed using reverse transcription digital PCR (RT-dPCR) to compare the viral load of pseudovirus supernatants from different packaging systems. The experimental operation was carried out strictly in accordance with the instructions.

[0088] The reagents used in RT-dPCR are dPCR OneStep Advanced Probe Kit (purchased from Qiagen), the process of RT-dPCR detection is as follows:

[0089] The preparation of RT-dPCR amplification reaction system is shown in Table 3.

[0090] Table 3 RT-dPCR amplification system preparation

[0091]

[0092] After the sample was added, it was placed in a QIAcuity one 5-plex real-time fluorescence quantitative PCR instrument (purchased from QIAGEN), the Fam fluorescence signal acquisition channel was selected, and the reaction temperature and cycle number and other conditions were set, as shown in Table 4. The primer and probe sequences used are shown in Table 5.

[0093] Table 4 RT-dPCR reaction conditions

[0094]

[0095]

[0096] Table 5 RT-dPCR primers and probe sequences

[0097] Serial number name Sequence (5'→3') 1 Primer F gggagctctctggctaacta(SEQ ID NO.10) 2 Primer R ttaccagagtcacacaacagac(SEQ ID NO.11) 3 Probe FAM-tgccttgagtgcttcaagtagtgtgtg-BHQ1(SEQ ID NO.12)

[0098] The sample concentration was calculated according to the RT-dPCR calculation formula: sample concentration (copies / mL) = template concentration (copies / μL) × 40 (reaction system volume) / template volume × elution volume × (1000 / extraction volume). The average value of 3 replicates was taken for each sample. After the average value of the 3 test data was taken, the quantitative results of the pseudovirus supernatant pLL3.7 and pLL3.7-U6-del were 1.75×10 9 and 2.36×10 9 copies / mL.

[0099] Both the fluorescence results and RT-dPCR test results proved that the modified vector system could not only successfully package pseudoviruses, but also had a higher transfection efficiency and a higher viral load of the obtained pseudovirus supernatant compared to the pseudovirus packaging system before the modification.

[0100] Example 2 Design and construction of recombinant vector expression plasmid pLL3.7-gag-pol

[0101] 1. Design and synthesis of HIV-1 conserved sequences

[0102] The website of the National Medical Products Administration was used to search for HIV-1 nucleic acid detection kits currently available in China, and the detection target locations of different kits were collected and summarized. The summary results are shown in Table 6.

[0103] Table 6 Information on HIV-1 nucleic acid detection kits approved in China (as of the end of December 2023)

[0104]

[0105]

[0106] All known HIV-1 subtype sequences in China were downloaded from the HIV sequence Datebase website (https: / / www.hiv.lanl.gov / content / sequence / HIV / mainp age.html), totaling 884. The 884 HIV-1 sequences were compared with the HIV-1 standard strain HXB2 using BioEdit software, and the variation threshold was set to 80% to obtain the HIV-1 conservative sequence.

[0107] With the current commercial kit target region as a reference, the conservative sequence gag region 1280-1850nt (571bp), pol region 2328-4562nt (pol-1: 2235bp) and 4956-5130nt (pol-2: 175bp) were selected as the target sequence, totaling 2981bp. The above 2981bp target sequence was entrusted to Bomed for gene synthesis and cloned into the cloning vector plasmid pUC57 to obtain the plasmid pUC57-gag-pol containing the target sequence.

[0108] 2. Construction and identification of recombinant vector expression plasmid pLL3.7-gag-pol

[0109] (1) Linearized vector expression plasmid pLL3.7-U6-del

[0110] The vector expression plasmid pLL3.7-U6-del was digested with restriction endonuclease XbaI at 37°C for 1 h, and then heat treated at 65°C for 20 min. The linearized vector product pLL3.7-U6-del was recovered and purified by gel running. The digestion reaction system is shown in Table 7.

[0111] Table 7 Enzyme digestion reaction system

[0112]

[0113] (2) Obtaining double-stranded DNA fragments containing the target sequence

[0114] Using plasmid pUC57-gag-pol as a template, an upstream primer with an XbaI upstream homology arm sequence (without an XbaI sequence) and a restriction endonuclease BamHI sequence, and a downstream primer with an XhoI downstream homology arm sequence (with an XhoI sequence) were used to perform PCR amplification of the target sequence to obtain a double-stranded DNA fragment containing the target sequence.

[0115] The primer sequences are shown below. The underlined sequences in the upstream primer and the downstream primer represent the restriction endonuclease sites BamHI and XhoI, respectively.

[0116] F:5'-acagcagagatccagtttggggatccacaggagcagatgatacagta-3'(SEQ ID NO.6)

[0117] R:5'-ttaccgtaagttatgtaacg ctcgag cctactccctga-3' (SEQ ID NO.7)

[0118] (3) Obtaining the ligation product pLL3.7-gag-pol

[0119] The double-stranded DNA fragment obtained in step (2) was subjected to Gibson seamless cloning with the linearized vector pLL3.7-U6-del, and the ligation reaction conditions were 50°C for 30 min to obtain the ligation product pLL3.7-gag-pol. The Gibson seamless cloning system is shown in Table 8.

[0120] Table 8 Gibson seamless cloning system

[0121]

[0122] (4) Transformation of ligation product pLL3.7-gag-pol

[0123] The ligation product in step (3) is transformed into stble 3 competent cells, and the specific steps are as follows:

[0124] Take 10 μL of the ligation product and add it to 100 μL of stble 3 competent cells, place it in an ice bath for 30 minutes, place it in a 42°C water bath for 90 seconds, and then place it in an ice bath for 2 minutes. Add 500 μL of SOB culture medium for recovery (37°C, shaker 200 rpm for 1 hour). Take 200 μL of the mixed culture medium and spread it on an Amp-resistant LB plate, and culture it in a 37°C incubator overnight (15 hours).

[0125] (5) Obtaining the recombinant vector expression plasmid pLL3.7-gag-pol

[0126] Single clones were selected for plasmid extraction and sent for sequencing. The clones with correct sequencing were selected for plasmid extraction to obtain the recombinant vector expression plasmid pLL3.7-gag-pol.

[0127] The recombinant vector expression plasmid pLL3.7-gag-pol constructed above was double-digested with BamHI and XhoI for verification. The enzyme digestion system is shown in Table 9. The enzyme digestion was carried out at 37°C for 1 hour, and the gel was run for verification.

[0128] Table 9 Double enzyme digestion reaction system

[0129]

[0130] The results are as follows Figure 1 As shown in C, the electrophoresis band position of the product of double-enzyme digestion of the recombinant expression vector plasmid pLL3.7-gag-pol is consistent with the theoretical position. Sanger sequencing confirmed that the sequence of the constructed recombinant vector expression plasmid pLL3.7-gag-pol is correct.

[0131] The above experimental results all prove that the recombinant vector expression plasmid pLL3.7-gag-pol was successfully constructed.

[0132] Example 3 HIV-1 pseudovirus packaging and evaluation

[0133] 1. HIV-1 pseudovirus packaging and identification

[0134] The recombinant vector expression plasmid pLL3.7-gag-pol constructed in Example 2 was used to package HIV-1 pseudovirus as described in Example 1. To further verify whether HIV-1 pseudovirus packaging was successful, the packaging product was titered, p24 antigen was quantitatively detected, and virus morphology was identified.

[0135] (1) Identification of HIV-1 pseudovirus morphology

[0136] The harvested 20 mL HIV-1 pseudovirus supernatant was ultracentrifuged on a 20% sucrose buffer cushion at 100,000×g at 4° C. for 2.5-3 h in a HIMAC CP-NX ultracentrifuge using a P40ST rotor. The pseudovirus particles were resuspended in 2 mL phosphate buffered saline (PBS, pH 7.4).

[0137] 20 μL of resuspended pseudovirus particles were adsorbed on the grid, negatively stained with 1% phosphotungstic acid (pH 6.8), and observed using a transmission electron microscope (TEM). Figure 3 As shown in A, the packaged HIV-1 pseudoviral particles have a virus-like membrane structure when observed under a transmission electron microscope.

[0138] (2) HIV-1 pseudovirus titer TCID 50 Detection

[0139] HEK293T cells (5×10 4 cells / 100 μL / well) were seeded into a 96-well cell culture plate and cultured overnight at 37°C and 5% CO2.

[0140] After culturing for 24 hours, the medium was discarded. HIV-1 pseudovirus supernatant diluted 10 times with 10% DMEM was added to the 96-well plate, and the 10-fold dilution was used as the initial addition concentration. 10% DMEM was added to the last column as a negative cell control well.

[0141] After 48 hours of infection, the number of positive and negative wells with fluorescent cells at each dilution was observed and recorded, and the TCID was calculated using the Reed-Muench method. 50 =10 6 / mL.

[0142] (3) Quantitative detection of HIV-1 pseudovirus p24 antigen

[0143] The culture supernatant was taken 1-5 days after transfection and diluted 10 3 The p24 antigen concentration of the diluted culture supernatant was detected using the Hebei Medical University Biological Products HIV-1p24 Antigen Detection Kit (Hebei, China), and the experimental operation was carried out strictly in accordance with the reagent instructions.

[0144] The concentrations of p24 antigen in the culture supernatant from day 1 to day 5 were 12298.58, 24485.10, 33327.21, 30334.02, and 31464.10 pg / mL, respectively. Figure 3 As shown in B, it increased significantly on days 1-3 and stabilized on days 4-5. The above results prove that pseudoviruses continue to be produced within 1-3 days after transfection of cells, until reaching a plateau on day 4.

[0145] 2. Target sequence identification

[0146] use Viral RNA Mini Kit (purchased from QIAGEN) was used to extract 60 μL RNA solution from 140 μL pseudovirus supernatant. A one-step RT-PCR kit (TaKaRa code: RR024A) was used for amplification detection. The reaction system is shown in Table 10, and the detection procedure is shown in Table 11.

[0147] Table 10 RT-PCR reaction system

[0148]

[0149]

[0150] Table 11 RT-PCR reaction conditions

[0151]

[0152] use DNAMini Kit (purchased from QIAGEN) was used to extract HEK293T cells (5×10 6 100 μL DNA solution was extracted from cells / 200 μL PBS). Amplification detection was performed using a PCR kit (TaKaRa code: R050Q). The reaction system is shown in Table 12, and the detection procedure is shown in Table 13.

[0153] Table 12 PCR reaction system

[0154]

[0155] Table 13 PCR reaction conditions

[0156]

[0157] The primer sequences used in the reaction system Table 10 and Table 12 are:

[0158] F: 5'-tgcaggggaaagaatagtagac-3' (SEQ ID NO. 13),

[0159] R: 5'-agctctgcttatatagacct-3' (SEQ ID NO. 14).

[0160] The gel electrophoresis confirmed that the electrophoresis band positions of RT-PCR and PCR amplification products were consistent with the theoretical positions ( Figure 3 C), the sequence of the amplified product was verified by Sanger sequencing, proving that the target sequence was successfully inserted into the packaged HIV-1 pseudoviral particles.

[0161] 3. Safety evaluation of HIV-1 pseudovirus

[0162] HEK-293T cells were infected with HIV-1 pseudovirus supernatant. After 4 hours, the cells were washed thoroughly with PBS and replaced with fresh 10% DMEM. After 48 hours of incubation, the supernatant was collected and co-cultured with newly inoculated HEK-293T cells. After 48 hours, GFP fluorescence was observed using a fluorescence microscope.

[0163] The results are as follows Figure 4As shown, obvious GFP fluorescence expression can be observed after 48 hours of infection in the first generation, but no GFP fluorescence expression can be observed after 48 hours of infection in the second generation. The above results fully prove that the HIV-1 pseudovirus prepared by the present invention does not undergo a second round of infection, has only a single round of replication ability, and has a high degree of biosafety.

[0164] Example 4 Preparation and Evaluation of HIV-1 Nucleic Acid Detection Quality Control Products

[0165] 1. Preparation of Quality Control Products

[0166] (1) Preparation of HIV-1 pseudovirus nucleic acid detection quality control products

[0167] To evaluate the dynamic detection range of RT-dPCR described in Example 1, the HIV-1 pseudovirus solution was first diluted to 10 6 copies / mL, and then four 5-fold serial dilutions were performed to prepare serial dilution samples. Nucleic acid was extracted from the serial dilution samples and RT-dPCR was performed as described in Example 1, and a standard RT-dPCR regression equation was established.

[0168] The test results show that y = -0.9164x + 6.643, and the R value is 0.999 ( Figure 5 ), proving that RT-dPCR has a good linear relationship. Therefore, RT-dPCR was used as a quantitative method using the primer probe designed by the present invention, and all RT-dPCR test results were expressed in log10 copies / mL. After calculation, the quantitative result of HIV-1 pseudovirus supernatant was 1.88×10 9 copies / mL.

[0169] According to the quantitative results, HIV-1 pseudovirus supernatant was diluted with HIV-1 negative plasma to prepare high concentration (H: 10 5 copies / mL) and low concentration (L: 10 3 copies / mL) quality control product, 1mL / tube, stored at -80℃.

[0170] (2) Preparation of MS2-armored RNA and inactivated HIV-1 nucleic acid detection quality control products

[0171] MS2-armored RNA was packaged and prepared by Sangon Biotech (Shanghai) Co., Ltd. (the sequence of MS2-armored RNA is shown in SEQ ID NO.15), and MS2 contains a 622 bp HIV LTR and gag gene conservative sequence (the sequence is shown in SEQ ID NO.16). HIV-1 was inactivated by heating HIV-1B subtype virus culture at 56°C for 30 minutes.

[0172] The SEQ ID NO.15:

[0173]

[0174] The SEQ ID NO.16:

[0175] .

[0176] The RT-dPCR quantitative detection method established in the present invention was used to quantify MS2-armored RNA and inactivated HIV-1, and then HIV-1 negative plasma was used as a matrix to prepare high-concentration and low-concentration quality control products for subsequent comparative studies.

[0177] 2. Evaluation of quality control products

[0178] (1) Evaluation of the homogeneity and stability of three materials of HIV-1 nucleic acid detection quality control products

[0179] According to the China National Accreditation Service for Conformity Assessment GL003: Guidelines for the Evaluation of Sample Homogeneity and Stability for Proficiency Testing, the homogeneity and stability of the quality control product prepared by the present invention were evaluated and the results were analyzed.

[0180] Homogeneity: 10 samples of high-concentration and low-concentration quality control samples were randomly selected and each sample was tested twice.

[0181] Short-term stability: Store high-concentration and low-concentration quality control products at -20°C, 4°C and room temperature (25°C) for 7 days. Take 6 samples on days 0, 1, 2, 3, 5 and 7, and test each sample once.

[0182] Freeze-thaw stability: freeze high-concentration and low-concentration quality control products at -80°C and store at room temperature (25°C) and freeze-thaw repeatedly 1-5 times. Take 6 samples under each condition and test each sample once.

[0183] One way ANOVA was used to evaluate homogeneity, and t test was used to evaluate stability.

[0184] Table 14 shows the homogeneity analysis results of the quality control products of the three materials. The critical value F 0.05(9，10) =3.02, the calculated F value <F critical value, the results of one-way analysis of variance of each group of data showed P>0.05, there was no statistical difference, and the homogeneity of the three materials of HIV-1 nucleic acid detection quality control products was good.

[0185] Table 14 Homogeneity analysis of three material quality control products

[0186]

[0187]

[0188] The short-term stability test results of the quality control products prepared from the three materials are shown in Figure 6 At -20℃, the quality control samples prepared from the three materials were stable for 7 days ( Figure 6 A). At 4°C, the high-concentration inactivated HIV-1 quality control is only stable for 3 days; other materials and quality controls of different concentrations are stable for 7 days ( Figure 6 B). At room temperature (25°C), both high and low concentrations of the MS2-armored RNA control were stable for 7 days; high and low concentrations of the HIV-1 pseudovirus control were stable for 5 and 2 days, respectively; high and low concentrations of the inactivated HIV-1 control were not stable from day 1 ( Figure 6 C).

[0189] The freeze-thaw stability test results of the three material quality control products are shown in Figure 7The controls prepared with HIV-1 pseudovirus or inactivated HIV-1 remained stable at both high and low concentrations even after five freeze-thaw cycles. In contrast, the controls prepared with MS2-armored RNA were not stable at both high and low concentrations after two freeze-thaw cycles.

[0190] The above results prove that the quality control product prepared by the present invention has good uniformity and stability.

[0191] (2) Evaluation of matrix effect and applicability of quality control products for HIV-1 pseudovirus nucleic acid detection

[0192] According to the "Matrix Effect Evaluation and Interoperability Guidelines for Evaluating Matrix Effects Using Linear Regression (WS / T356-2011)" issued by the National Health Commission, 20 HIV-1 positive patient plasmas and 4 dilutions of HIV-1 pseudovirus supernatants (10 6 , 10 5 , 10 4 , 10 3 The results were repeated 3 times for each sample, and the mean of log10 copies / mL was taken. The mean of the measured values ​​of the Livzon method was used as the X-axis, and the mean of the measured values ​​of the Wantai method was used as the Y-axis to evaluate the matrix effect by linear regression analysis.

[0193] Figure 8 A is the test result based on HIV-1 negative plasma. Figure 8 B is the test result with 10% DMEM as the matrix. The test results show that the measured values ​​of pseudovirus quality control products detected by Wantai and Livzon are all distributed within the expected range of 95% of the regression line, proving that there is no matrix effect.

[0194] In the scope of application evaluation, 12 commercial HIV-1 nucleic acid quantitative detection kits commonly used in HIV-1 nucleic acid detection laboratories in my country were used to detect high-concentration quality control products. As shown in Table 15, all 12 commercial kits can successfully detect quality control products. The test results prove that the quality control products prepared by the present invention have good applicability and can meet the actual application requirements of existing HIV-1 nucleic acid detection laboratories.

[0195] Table 15 Results of 12 commercial HIV-1 nucleic acid quantitative detection kits for testing HIV-1 pseudovirus quality control products

[0196] brand Detection value (copies / mL) Detection value (log10copies / mL) Roche <![CDATA[1.99×10 5 ]]> 5.30 Ampli <![CDATA[1.01×10 5 ]]> 5.00 Daan <![CDATA[9.64×10 4 ]]> 4.98 See the micro <![CDATA[9.56×10 4 ]]> 4.98 Northeast Pharmaceutical <![CDATA[2.49×10 5 ]]> 5.40 Livzon <![CDATA[6.24×10 4 ]]> 4.80 Shengxiang <![CDATA[6.82×10 4 ]]> 4.83 Hauloti <![CDATA[3.16×10 4 ]]> 4.50 Rifdi <![CDATA[1.23×10 5 ]]> 5.09 Wantai <![CDATA[2.24×10 4 ]]> 4.35 Rendu <![CDATA[1.19×10 5 ]]> 5.08 Baoruiyuan <![CDATA[5.75×10 4 ]]> 4.76

[0197] Example 5 External Quality Assessment (EQA)

[0198] In order to verify the application value and effect of the HIV-1 nucleic acid detection quality control product prepared by the present invention in EQA, the high-concentration quality control product prepared in Example 4 was distributed together with the inactivated HIV-1 quality control product as EQA samples to 60 HIV-1 nucleic acid detection laboratories based on the currently popular Roche or Livzon HIV-1 nucleic acid quantitative detection platform. These laboratories are from different provincial, prefectural, and county hospitals and disease control agencies. The quality control products were transported to 60 laboratories via the cold chain within one week. After receiving the quality control products, the laboratories are required to test and analyze the quality control products and routine laboratory samples at the same time, complete the test and fill out the report form within the specified time, and finally report the results to the China Center for Disease Control and Prevention-National AIDS Reference Laboratory by email.

[0199] We received the result reports from 60 laboratories within the specified time. The results in Table 16 show that the CV values ​​of the HIV-1 pseudovirus and inactivated HIV-1 quality control test results of the 30 laboratories using Roche reagents were 3.55% and 1.79%, respectively. The CV values ​​of the HIV-1 pseudovirus and inactivated HIV-1EQA sample test results of the 30 laboratories using Livzon reagents were 3.73% and 1.89%, respectively. The CV values ​​of both quality control products were less than 5%. In addition, when we compared the quality control test results of the same laboratory in the first half and the second half of the year, the paired t-test results showed that there was no statistically significant difference in the test results of the two time periods, whether using HIV-1 pseudovirus quality control or inactivated HIV-1 quality control (P>0.05), which shows that both types of quality control products have good stability. In addition, the same results were obtained regardless of whether Roche reagents or Livzon reagents were used.

[0200] Table 1 EQA results of 1660 HIV-1 nucleic acid testing laboratories

[0201]

[0202]

[0203] As can be seen from the above embodiments, the present invention provides an HIV-1 pseudovirus of a lentiviral vector system and its application in the preparation of HIV-1 nucleic acid detection quality control products. The lentiviral vector system is based on the vector plasmid pLL3.7, and the U6 promoter between the restriction endonuclease sites XbaI and XhoI of pLL3.7 is deleted to obtain a modified four-plasmid lentiviral vector packaging system. Based on the modified lentiviral vector system, the present invention successfully prepared HIV-1 pseudovirus and further developed quality control products for nucleic acid detection. The present invention systematically evaluates the safety, uniformity, stability, matrix effect, applicability and inter-laboratory quality evaluation availability of the quality control products. The HIV-1 nucleic acid detection quality control products provided by the present invention have the following advantages: high biosafety, can highly simulate the real virus structure of HIV-1, and are suitable for the full process quality control of HIV-1 nucleic acid detection; at the same time, its preparation process is simple, low cost, easy to store and transport, and has broad application prospects.

[0204] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A vector expression plasmid pLL3.7-U6-del in a lentiviral vector system, characterized in that: The nucleotide sequence of the vector expression plasmid is shown in SEQ ID NO.

1.

2. The method for constructing the vector expression plasmid according to claim 1, characterized in that: The vector expression plasmid is based on the vector plasmid pLL3.7, and the U6 promoter carried on pLL3.7 is deleted.

3. A lentiviral packaging system, characterized in that: It comprises the vector expression plasmid pLL3.7-U6-del, backbone plasmids pRSV-Rev and pMDLgag-poL RRE, and envelope plasmid pMD2.G as described in claim 1.

4. A recombinant vector expression plasmid pLL3.7-gag-pol constructed based on the vector expression plasmid according to claim 1, characterized in that: The nucleotide sequence of the recombinant vector expression plasmid pLL3.7-gag-pol is shown in SEQ ID NO.

2.

5. The method for constructing the recombinant vector expression plasmid pLL3.7-gag-pol according to claim 4, characterized in that: The steps include: (1) pol region 2328-4562 nt, pol region 4956-5130 nt, and gag region 1280-1850 nt were selected as target sequences; (2) inserting the target sequence into the vector expression plasmid described in claim 1, and inserting a BamHI restriction site at a specific position to obtain a recombinant vector expression plasmid pLL3.7-gag-pol; The nucleotide sequence of 2328-4562 nt of the pol region in step (1) is shown in SEQ ID NO.3; the nucleotide sequence of 4956-5130 nt of the pol region is shown in SEQ ID NO.4; The nucleotide sequence of 1280-1850 nt of the gag region is shown in SEQ ID NO.

5. The above three sequences were synthesized into a target series with a length of 2981 bp; In step (2), the upstream primer of pol region 2328-4562 nt and the downstream primer of gag region 1280-1850 nt are used for cloning; The nucleotide sequence of the upstream primer of pol region 2328-4562 nt is shown in SEQ ID NO.6; The nucleotide sequence of the downstream primer of 1280-1850 nt of the gag region is shown in SEQ ID NO.

7.

6. A lentiviral vector system for packaging HIV-1 pseudovirus, characterized in that: The invention comprises the recombinant vector expression plasmid pLL3.7-gag-pol, the backbone plasmids pRSV-Rev and pMDLgag-poL RRE, and the envelope plasmid pMD2.G as described in claim 4.

7. A method for preparing HIV-1 pseudovirus using the lentiviral vector system of claim 6, characterized in that: The steps include: (1) using the lentiviral vector system of claim 6 to transfect HEK293T cells, mixing the plasmid and the transfection reagent, letting them stand, and then slowly adding them to the culture medium; (2) After transfection, culture for 44 to 52 h and collect the culture supernatant; (3) centrifuging and filtering the culture supernatant to obtain the HIV-1 pseudovirus supernatant; The transfection system used in step (1) is: 7-9 μg pLL3.7-gag-pol, 3-5 μg pRSV-Rev, 3-5 μg pMDLgag-pol RRE and 3-5 μg pMD2.G, 46-50 μL Lipofectamine 2000 is added to 240-260 μL Optimem and mixed, and 0.8-1.2×10 7 cells / T75 HEK293T cells; The standing time in step (1) is 10 to 15 minutes, and the culture medium is DMEM culture medium containing 8 to 12% FBS; The culture conditions in step (2) are 35-39° C. and 4.8-5.2% CO 2 ; The culture medium is replaced once after 3 to 5 hours of culture in step (2), and the culture supernatant is collected 44 to 52 hours after the culture medium is replaced; The centrifugation conditions in step (3) are 1800-2200 rpm, 3-5° C., and 8-12 min, and a 0.45 μm microporous filter is used for filtration.

8. HIV-1 pseudovirus prepared by the method according to claim 7.

9. A quality control product for HIV-1 nucleic acid detection prepared from the HIV-1 pseudovirus according to claim 8.

10. A primer probe set for quantitatively detecting the HIV-1 pseudovirus of claim 8 and the HIV-1 nucleic acid detection quality control product of claim 9, characterized in that: It comprises an upstream primer, a downstream primer and a probe, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.10, the nucleotide sequence of the downstream primer is shown as SEQ ID NO.11, and the nucleotide sequence of the probe is shown as SEQ ID NO.12.

Images