Application of phosphodiesterase 6D as prostatic cancer medication guidance marker

Abstract

The invention relates to the technical field of biological medicine and tumor treatment, and particularly discloses application of phosphodiesterase 6D as a prostatic cancer medication guidance marker. Phosphodiesterase 6D (PDE6D) can guide medication for treating the prostatic cancer, the phosphodiesterase 6D can predict the treatment sensitivity of the prostatic cancer to the medicine metformin, and the phosphodiesterase 6D can also be used as a guiding marker for combined medication of the metformin and TMX-4100, and is different from a traditional auxiliary treatment mode of blindly giving the metformin. And a scientific basis is provided for whether a prostatic cancer patient is suitable for using metformin or not and whether the metformin needs to be combined with TMX-4100.

Description

Technical Field

[0001] The present application relates to the field of biomedicine and tumor treatment technology, and in particular to the application of phosphodiesterase 6D as a drug guidance marker for prostate cancer. Background Art

[0002] Prostate cancer (PCa) is an epithelial malignant tumor that occurs in the prostate gland and is the most common malignant tumor in the male urogenital system. Although significant progress has been made in the treatment strategies for prostate cancer in the past decade, such as radical prostatectomy (RP), radiotherapy (RT) and androgen deprivation therapy (ADT), the clinical efficacy is limited, especially in advanced patients, who are prone to transform into castration-resistant prostate cancer (CRPC), resulting in a median survival time of no more than two years.

[0003] For patients with castration-resistant prostate cancer (CRPC), although chemotherapy drugs such as docetaxel and immune checkpoint inhibitors have shown efficacy in some cancers, their efficacy in the treatment of CRPC is limited. Currently, there is still a lack of effective and individualized CRPC treatment methods in clinical practice, and new treatment strategies and biomarkers are urgently needed to guide drug application and optimize treatment plans.

[0004] Metabolic therapy is a hot topic in current research, and many clinical trials have also shown that interfering with tumor cell metabolic therapy has positive effects on patients. Among them, metformin, as the current first-line oral hypoglycemic drug, is widely used in tumor treatment research because of its effective inhibition of cellular energy metabolism and low cost. Studies have shown that metformin can inhibit tumor cell proliferation through AMPK-dependent and -independent mechanisms, especially interfering with tumor cell growth through metabolic pathway reprogramming. However, the specific anticancer effect of metformin in prostate cancer remains controversial. This controversy may be due to multiple factors such as drug concentration, bioavailability, and individual differences. In addition, high-dose metformin is prone to lactic acid accumulation and lactic acidosis, increasing treatment risks and limiting clinical safety doses. Therefore, how to increase the sensitivity of CRPC to metformin within a safe dose range has become a research focus in order to reduce toxic side effects while ensuring efficacy.

[0005] Metabolic reprogramming of cancer cells is a key mechanism in tumor progression. Compared with normal cells, CRPC cells show significant metabolic abnormalities, including changes in pathways such as glucose, purine, and lipid metabolism. Therefore, based on tumor metabolic characteristics, inhibiting tumor growth by regulating key metabolic pathways has become one of the potential therapeutic strategies. Summary of the invention

[0006] The purpose of the present application is to overcome the deficiencies of the above-mentioned prior art and provide an application of phosphodiesterase 6D (PDE6D) as a prostate cancer medication guidance marker. The phosphodiesterase 6D (PDE6D) of the present application can be used to predict the sensitivity of conventional concentrations of metformin and guide the combined use of metformin and TMX-4100 in prostate cancer.

[0007] To achieve the above purpose, the technical solution adopted by this application is: The present application provides the use of a phosphodiesterase 6D detection reagent in the preparation of a product for guiding the use of drugs for treating prostate cancer, wherein the drugs for treating prostate cancer include metformin.

[0008] Alternatively, the drug for treating prostate cancer includes metformin and TMX-4100.

[0009] PDE6D (phosphodiesterase 6D) is a regulatory subunit that was first discovered in the retina and is involved in the signal transduction of photoreceptors. Recent studies have shown that PDE6D is abnormally expressed in a variety of tumor cells, such as breast cancer and prostate cancer, and is closely related to the proliferation, apoptosis and metabolic abnormalities of tumor cells. PDE6D binds to ras proteins, assists their intracellular transport and activates multiple tumor-related signaling pathways, thereby supporting tumor growth and invasion. In addition, PDE6D is expressed in non-visual system tissues (such as the lungs and kidneys) and participates in the activation of the epidermal growth factor (EGF) pathway, further indicating its potential role in various types of tumors. Therefore, as a key factor in regulating tumor metabolism and signal transduction, PDE6D is becoming an important target for a new type of anticancer therapy, bringing new hope for the treatment of various malignant tumors such as prostate cancer.

[0010] As a preferred embodiment of the application described in the present application, the drug for treating prostate cancer also includes TMX-4100.

[0011] After extensive research and experiments, the inventors of the present application discovered that phosphodiesterase 6D (PDE6D) can guide the use of drugs to treat prostate cancer, phosphodiesterase 6D can predict the therapeutic sensitivity of prostate cancer to the drug metformin, and phosphodiesterase 6D can also be used as a guiding marker for the combined use of metformin and TMX-4100, which is different from the traditional method of blindly administering metformin as an adjuvant therapy, and provides a scientific basis for whether prostate cancer patients are suitable for the use of metformin and whether they need to be used in combination with TMX-4100.

[0012] As a preferred embodiment of the application described in the present application, the detection reagent of phosphodiesterase 6D includes a reagent for detecting mRNA of phosphodiesterase 6D or a reagent for detecting phosphodiesterase 6D protein.

[0013] As a preferred embodiment of the application described in the present application, the reagent for detecting the mRNA of phosphodiesterase 6D includes detection primers for phosphodiesterase 6D, and the detection primers for phosphodiesterase 6D include an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2.

[0014] As a preferred embodiment of the application described in the present application, the reagent for detecting phosphodiesterase 6D protein includes a primary antibody and a secondary antibody, the primary antibody is a rabbit-derived phosphodiesterase 6D polyclonal antibody, and the secondary antibody is a goat anti-rabbit secondary antibody.

[0015] The present application detects the expression levels of PDE6D mRNA and protein to analyze whether it is in a high expression state, thereby providing a basis for drug guidance for prostate cancer.

[0016] As a preferred embodiment of the application described in the present application, the prostate cancer includes locally advanced prostate cancer or castration-resistant prostate cancer.

[0017] High expression of PDE6D in prostate cancer tissue indicates that the treatment for prostate cancer is the combination of TMX-4100 and metformin.

[0018] The present application also provides the use of phosphodiesterase 6D in the preparation of a product for predicting the sensitivity of prostate cancer to metformin.

[0019] This application discovered for the first time that metformin at conventional concentrations (conventional doses) can inhibit the progression of prostate cancer by regulating the PDE6D / cGMP / PKG signaling pathway, and that increased expression of phosphodiesterase 6D indicates a decreased sensitivity of prostate cancer cells to metformin.

[0020] As a preferred embodiment of the application described in the present application, the human equivalent dose of metformin during application is 500 mg / day for oral administration.

[0021] As a preferred embodiment of the application described in the present application, the product includes a kit.

[0022] The present application also provides the use of TMX-4100 and metformin in combination for preparing a drug for treating castration-resistant prostate cancer.

[0023] Experiments have shown that high expression of PDE6D reduces the sensitivity of castration-resistant prostate cancer to metformin. In order to solve the low sensitivity caused by high expression of PDE6D, the use of targeted PDE6D inhibitor TMX-4100 can significantly increase the sensitivity of PDE6D high-expressing prostate cancer tumor cells to metformin. Therefore, this application uses PDE6D as a guiding marker for the combined use of TMX-4100 and metformin, which can provide a basis for whether prostate cancer patients need to use metformin combined with TMX-4100 as auxiliary endocrine therapy.

[0024] In addition, the combined use of metformin and TMX-4100 helps to enhance the anti-tumor effect of metformin, thereby improving the efficiency of drug use and significantly reducing toxic side effects. This application has important clinical application value and promotion prospects in individualized tumor treatment.

[0025] The present application also provides a phosphodiesterase 6D detection kit, which is a reagent for detecting the mRNA expression amount of phosphodiesterase 6D or a reagent for detecting the expression amount of phosphodiesterase 6D protein; The reagent for detecting the mRNA expression of phosphodiesterase 6D includes detection primers for phosphodiesterase 6D, and the detection primers for phosphodiesterase 6D include an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 2; The reagent for detecting the expression amount of phosphodiesterase 6D protein comprises a primary antibody and a secondary antibody, wherein the primary antibody is a rabbit-derived phosphodiesterase 6D polyclonal antibody, and the secondary antibody is a goat anti-rabbit secondary antibody.

[0026] The phosphodiesterase 6D detection kit provided in the present application can accurately detect the expression of PDE6D mRNA and protein and the degree of positive expression in prostate cancer patient tissues in vitro.

[0027] The experimental results showed that the expression level of PDE6D was negatively correlated with the sensitivity of metformin. By using this kit to detect PDE6D protein, patients with stronger staining intensity are usually less sensitive to metformin, thus providing an important basis for whether prostate cancer patients need to be treated with TMX-4100 in combination with metformin.

[0028] This application detects the mRNA and protein positive expression of PDE6D in prostate cancer tissues. This application can preliminarily evaluate whether prostate cancer patients need to use metformin combined with TMX-4100 as a basis for adjuvant endocrine therapy, and provide a new therapeutic target for endocrine therapy other than anti-androgen therapy. The detection kit can be used for the detection of clinically obtained prostate cancer tissue samples, and the tissue samples can be obtained by diagnostic prostate puncture examination or surgery. The kit can be detected by in vitro experiments, has a lower patient risk, and does not cause toxic side effects.

[0029] In some specific embodiments, the primary antibody is a rabbit-derived polyclonal antibody against phosphodiesterase 6D, which is highly specific, and the experimental steps are simple and fast, and the detection can be completed efficiently. The positive expression intensity of PDE6D can be scored by the kit, thereby providing a preliminary basis for predicting the efficacy of metformin combined with TMX-4100 in the treatment of castration-resistant prostate cancer patients.

[0030] The detection kit for phosphodiesterase 6D (PDE6D) provided in the present application can accurately detect the expression of PDE6D mRNA and protein in prostate cancer tissue and the degree of positive expression. Compared with the traditional method of blindly administering metformin as an adjuvant therapy, detecting the expression level of PDE6D can provide an effective basis for whether to use metformin and TMX-4100 in combination, thereby improving the efficiency of drug use. Therefore, the detection kit of the present application not only helps to improve the effect of metformin treatment, but also can expand the scope of application of TMX-4100 in cancer treatment.

[0031] Compared with the prior art, this application has the following beneficial effects: This application provides the application of phosphodiesterase 6D as a guiding marker for prostate cancer medication. Phosphodiesterase 6D (PDE6D) can guide the use of drugs for the treatment of prostate cancer. Phosphodiesterase 6D can predict the therapeutic sensitivity of prostate cancer to the drug metformin. Phosphodiesterase 6D can also be used as a guiding marker for the combined use of metformin and TMX-4100. Different from the traditional blind adjuvant treatment of metformin, it can provide a scientific basis for whether castration-resistant prostate cancer patients need to use metformin combined with TMX-4100 as adjuvant treatment. This method helps to improve the efficiency of drug use, and by selectively inhibiting prostate cancer cells with high expression of PDE6D, it can enhance their sensitivity to metformin.

[0032] In addition, TMX-4100 is used in combination with metformin to treat prostate cancer, especially advanced prostate cancer (such as locally advanced prostate cancer or castration-resistant prostate cancer). Combining TMX-4100 can reduce the side effects of metformin, especially the toxic side effects on the gastrointestinal tract. This combination therapy can, to a certain extent, supplement the negative effects caused by high expression of PDE6D and improve the treatment effect. In terms of economic benefits, the combination of TMX-4100 and metformin has been shown to effectively inhibit tumor growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a graph showing the results of nude mouse subcutaneous transplanted tumors constructed using human castration-resistant prostate cancer (CRPC) PC-3 cells and treated with conventional concentrations of metformin; Figure 2 This is the result of orthogonal partial least squares discriminant analysis (OPLS-DA) analysis after non-targeted metabolome sequencing of subcutaneous transplanted tumors in nude mice; Figure 3 This is a bar graph showing the results of differential metabolite pathway enrichment analysis for non-targeted metabolome sequencing; Figure 4 Heat map of the content of differential metabolites in the enriched pathways of non-targeted metabolome sequencing; Figure 5 The results of differential gene analysis and qPCR validation experiments after transcriptomic sequencing of subcutaneous transplanted tumors are shown in Figure 2. Figure 6 The results of tissue immunohistochemistry of PDE6D and downstream pathway protein markers in subcutaneous transplanted tumors of nude mice; Figure 7 This is the result of immunoblotting of PDE6D-overexpressing cells constructed by pcDNA3.1 using human castration-resistant prostate cancer PC-3 cells; Figure 8 This is a result diagram showing that increasing PDE6D can reduce the sensitivity of cells to metformin using plate cloning and CCK-8 experiments; Fig. 9 In order to find out that regulating PDE6D can reduce the sensitivity of cells to metformin by using apoptosis flow cytometry, whole transcriptome sequencing of constructed metformin-resistant cells was performed and it was found that the expression in resistant cells (MetR) was significantly higher than that in wild-type cells (WT), and the relationship between PDE6D expression and metformin sensitivity was found. Fig.10 This is the result of immunoblotting using RNAi technology to downregulate the expression of PDE6D; Fig.11 This is the result of using plate cloning experiments to find that reducing PDE6D can increase the sensitivity of CRPC cells to metformin; Fig.12 This is a result of using CCK-8 experiment to find that reducing PDE6D can increase the sensitivity of CRPC cells to metformin; Fig.13 The results of the apoptosis experiment show that reducing PDE6D can increase the sensitivity of CRPC cells to metformin; Fig.14 The result of using ELISA to find that reducing PDE6D can increase the relative content of intracellular cGMP; Fig.15 The results of immunoblotting experiments showed that downregulating PDE6D significantly activated PKG and downstream apoptosis pathways; Fig.16 The results of using the combination of PDE6D small molecule inhibitor TMX-4100 and metformin to significantly improve the sensitivity of CRPC cells to metformin's ability to inhibit plate formation; Fig.17 The results of using the combination of PDE6D small molecule inhibitor TMX-4100 and metformin to significantly improve the sensitivity of CRPC cells to metformin's ability to inhibit cell proliferation; Fig.18 The results of using the combination of PDE6D small molecule inhibitor TMX-4100 and metformin to significantly improve the sensitivity of CRPC cells to metformin's ability to promote apoptosis; Fig.19 This is the result of an animal experiment that used the combination of the PDE6D small molecule inhibitor TMX-4100 and metformin to significantly increase the sensitivity of CRPC cells to metformin; Fig. 20 for Fig.19 Results of H&E staining of the main organs and body weight of nude mice in different treatment groups in animal experiments; Fig.21 This is a survival analysis diagram of patients divided into high PDE6D expression and low PDE6D expression according to the median in the Cancer Genome Atlas (TCGA) database; Fig. 22 This is a comparison of PDE6D expression levels in patients with different clinical stages and Gleason scores in the Cancer Genome Atlas (TCGA) database; Fig.23 Survival analysis of patients with high and low PDE6D expression in 7 public databases; Fig.24 This is a comparison of PDE6D expression levels in patients with different Gleason scores in 6 public databases. DETAILED DESCRIPTION

[0034] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0035] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified, and the components and raw materials used in each parallel experiment are of the same type.

[0036] Example 1 Metabolome and transcriptome sequencing analysis was performed on nude mouse subcutaneous tumors transplanted with regular concentrations of metformin using castration-resistant prostate cancer PC-3 cells. The results are shown in the figure below. Figure 1-Figure 6 shown.

[0037] Specific experimental steps: In order to explore the anti-tumor effect of the conventional glucose-lowering metformin dose (500 mg / d) on castration-resistant prostate cancer (CRPC) in vivo and its effect on CRPC cells, this application used PC-3 wild-type cells (PC-3-WT) to construct a nude mouse subcutaneous transplant tumor model.

[0038] Approximately 2 × 10 6 PC-3 cells were injected subcutaneously. The nude mice were randomly divided into a control group and a metformin-treated group (n=6 in each group). 3 At 1:10 p.m., mice in the metformin-treated group began to receive oral administration of 102 mg / kg metformin in drinking water (the concentration was calculated by the mouse-human equivalent dose conversion formula). The tumor volumes of the control group and the metformin-treated group were measured every 2 days starting from the 5th day. The results showed that the subcutaneous tumor volume of the metformin-treated group cells was significantly smaller than that of the control group cells after the 19th day of treatment, and the difference between the two was statistically significant ( Figure 1 ).

[0039] After 21 days of treatment, the nude mice were euthanized and the tumors were removed to measure the tumor weights of the two groups. The results showed that the subcutaneous tumor weight of the cells in the metformin-treated group was significantly smaller than that of the cells in the control group, and the difference between the two was statistically significant.

[0040] Subsequently, this application performed non-targeted metabolomics sequencing analysis on 5 tumor samples in each group. The sequencing analysis steps are as follows: Metabolites were extracted from 10 tumor samples. 50 mg of each tumor sample was washed three times with cold phosphate buffered saline (PBS), and then 1000 μL of extraction solvent (acetonitrile: methanol: water = 2:2:1, containing 1 μg / mL internal standard substance) was added, ground with steel beads at 40 Hz for 4 minutes, and then sonicated in an ice water bath for 5 minutes. This grinding and sonication process was repeated 3 times, and then incubated at -20°C for 1 hour, followed by centrifugation at 4°C and 12,000 rpm for 15 minutes. The supernatant was stored at -80°C for LC-MS analysis.

[0041] All samples were uploaded and analyzed by UHPLC system (1290, Agilent Technologies) using UPLCHSST3 column (2.1 mm× 100 mm, 1.8 μm). The injected sample volume was 2 μL, and the flow rate was 0.5 mL / min. Mobile phase A was 0.1% formic acid in water (positive ion mode) or 5 mmol / L ammonium acetate in water (negative ion mode). Mobile phase B was acetonitrile. Gradient elution conditions were: 0 min, 1% B; 1 min, 1% B; 8 min, 99% B; 10 min, 99% B; 10.1 min, 1% B; 12 min, 1% B.

[0042] The first mass spectrometry (MS1) and the second mass spectrometry (MS2) data were collected using Q Exactive (Orbitrap MS, Thermo). The ESI source conditions were set as follows: protective gas flow rate 45 Arb, auxiliary gas flow rate 15 Arb, capillary temperature 400 °C, full scan resolution 70000, MS / MS resolution 17500, collision energy 20 / 40 / 60 eV (NCE mode), and spray voltage 4.0 kV for positive ions or -3.6 kV for negative ions.

[0043] The raw data were converted into mzXML format using ProteoWizard software. Then MAPS software was used for preprocessing, such as peak identification, peak extraction, and retention time correction. Metabolite annotation was performed using the built-in MS2 database (BiotreeDB).

[0044] This application uses orthogonal partial least squares discriminant analysis (OPLS-DA) to find differential metabolites in sequencing results. The OPLS-DA cation mode and anion mode score plots show a clear distinction between the two groups. In both ion modes, the metabolite composition of the transplanted tumors in the metformin treatment group and the control group changed significantly (e.g. Figure 2 as shown).

[0045] In positive ion mode, the metabolites are shown in Table 1: Table 1 In negative ion mode, the metabolites are shown in Table 2: Table 2 The enrichment analysis of significantly different metabolites between the control group and the metformin treatment group was performed, and the analysis process was as follows: The statistical significance and fold change of metabolites were calculated using two-tailed, equal variance t-test. Metabolites with P < 0.05 and VIP ≥ 1 were considered to be significantly different between groups. VIP score was used to assess the relative importance of each metabolite in the OPLS-DA model. The enriched pathways of differential metabolites were analyzed using the enrichment analysis module of MetaboAnalyst 6.0 based on the KEGG database. The pathways with P < 0.05 were visualized using the “ggplot2” package in R. The differential metabolites were displayed using heat maps.

[0046] The results showed that the differential metabolites in cationic and anionic modes were mainly enriched in the purine metabolic pathway (such as Figure 3 The differential metabolite heat map showed that the content of metformin increased in the treatment group, proving that the model construction was reliable.

[0047] In addition, some important metabolites such as guanosine and adenosine were upregulated in the treatment group, while adenylate was downregulated in the treatment group (e.g. Figure 4 In order to explore the epigenetic changes behind the differences in regulating metabolism, this application used transcriptome sequencing of 3 tumors in each group, and used the R language software package to perform differential expression analysis on the transcriptome sequencing results of the control group and metformin treatment.

[0048] The results showed that PDE6D was one of the genes that decreased most significantly in the metformin-treated group compared with the control group, and the difference was statistically significant (e.g. Figure 5 As shown), the present application then used real-time fluorescence quantitative PCR (qPCR) experiments to verify the sequencing results and found that the expression of PDE6D gene was reduced in the treatment group (as shown Figure 5 The primer sequences used for qPCR are as follows: PDE6D: Forward primer(5'-3'): ATGTCAGCCAAGGACGAGC (SEQ ID NO: 1); Reverse primer (5'-3'): CTTGGGAACACGGGGCTTCAT (SEQ ID NO: 2).

[0049] ACTB: Forward primer(5'-3'):GCTCACCATGGATGATGATATCGC (SEQ ID NO: 3); Reverse primer (5'-3'): CCACATAGGAATCCTTCTGACCCAT (SEQ ID NO: 4); PDE6D (phosphodiesterase 6D subunit) is one of the regulatory subunits of cyclic guanosine monophosphate (cGMP) hydrolase PDE6 (phosphodiesterase 6). Abnormally low expression of PDE6D will lead to the disintegration of PDE6, and subsequently trigger the accumulation of cGMP. Subsequently, the present application performed immunohistochemistry (IHC) staining on the tumor tissues of the two groups, and the results showed that the expression of PDE6D in the treatment group decreased, and the accumulation of cGMP in the cells would activate the downstream cGMP / PRKG1 pathway and activate cell apoptosis. The IHC experiment showed that the upregulation of PRKG1 expression was consistent with the scientific hypothesis of the present application, and PRKG1 activated the apoptosis pathway downstream. Bax (Bcl-2-associated X protein, an anti-apoptotic molecule) was downregulated, and BCL2 (B lymphocytoma-2, an apoptosis-promoting molecule) was upregulated, proving that the apoptosis pathway was activated (such as Figure 6 as shown).

[0050] Results: It was found that conventional concentrations of metformin inhibited prostate cancer progression by inhibiting the PDE6D / cGMP / PKG pathway, and a new mechanism of conventional concentrations of metformin treatment was discovered.

[0051] Example 2 PC-3 overexpression cell lines were constructed using pcDNA3.1. Plate cloning, CCK-8, and apoptosis flow cytometry experiments revealed that regulation of PDE6D could reduce the sensitivity of cells to metformin. The constructed metformin-resistant cells were used for whole transcriptome sequencing.

[0052] Specific experimental steps: The cells were transfected with pcDNA3.1-PDE6D or pcDNA (from Beijing Qingke Biotechnology Co., Ltd.) and TSnanofect V2 transfection reagent (TSV405, Qingke Biotechnology Co., Ltd.) to construct a PC-3 cell line with high expression of PDE6D.

[0053] The protein expression of PDE6D in PC-3 cell line was detected by western blotting. The operation method is as follows: first, extract protein, prepare lysis buffer according to the ratio of RIPA:100x PMSF:Loading buffer=100:1.25:25, fully lyse cells, heat in a 100℃ water bath for 20 minutes, separate target protein by protein electrophoresis, prepare transfer clip, transfer solution, sponge pad and filter paper, and set the transfer current to 280-320mA and transfer time to 65-85 minutes after electrophoresis. Wash 3 times after protein transfer, block with skim milk for 120 minutes, and incubate with rabbit PDE6D polyclonal antibody (28573-1-AP, proteintech) at 4℃ overnight. After the primary antibody incubation, wash 3 times, incubate with goat anti-rabbit secondary antibody 500μg / ml (ab205718, abcam) at room temperature on a shaker, and wash. Finally, prepare chemical substrate luminescent solution for chemiluminescence. The results showed that prostate cancer PC-3 cells with high expression of PDE6D were successfully constructed (e.g. Figure 7 as shown).

[0054] The present application conducted colony formation experiments on an empty vector group, a PDE6D overexpression group under metformin treatment, and a metformin treatment group.

[0055] 1000 cells were seeded in each well of a 12-well plate. The results showed that the empty vector group had the largest number of cell clones, followed by the PDE6D overexpression group under metformin treatment, and the metformin-treated group had the smallest number of cell clones (e.g. Figure 8 as shown).

[0056] The present application conducts CCK-8 proliferation experiments on the empty vector group, the PDE6D overexpression group under metformin treatment, and the metformin treatment group. Digest the cells in the logarithmic growth phase, take a 96-well plate, and set the number of cells added to each well according to the cell type: 3000 cells / well; add 100μL of whole serum culture medium to each well to dilute the cells to the required concentration. The surrounding cell wells are generally not inoculated with cells due to the large amount of volatilization, and are replaced with 200μL dPBS. After the cells adhere to the wall, add metformin for stimulation, and at the same time, replenish the culture medium volume to 200μL. After the stimulation time is over, prepare the CCK 8 working solution: CCK 8: whole serum RPMI1640 = 1:9. Add the working solution, and after the reaction time is over, use an enzyme reader to measure the OD value at 450nm. The results showed that the OD value of the metformin-treated group was the lowest, followed by the PDE6D overexpression group under metformin treatment, and the OD value of the empty vector group was the highest (such as Figure 8 as shown).

[0057] This application conducted a cell apoptosis experiment on the empty vector group, the PDE6D overexpression group under metformin treatment, and the metformin treatment group. After collecting cells in the logarithmic growth phase, the cells were treated with a cell apoptosis kit (Lianke Bio, AP105), and the samples were analyzed on a BD FACS flow cytometer to draw a statistical graph. The results showed that the apoptosis rate of the metformin treatment group was the highest, followed by the PDE6D overexpression group under metformin treatment, and the apoptosis rate of the empty vector group was the lowest (e.g. Fig. 9 As shown). The results of the metformin-resistant cell transcriptome constructed in the previous research of this application showed that the expression of PDE6D in the metformin-resistant cells of two castration-resistant prostate cancer cells was upregulated relative to the wild-type strain (as shown Fig. 9 as shown).

[0058] like Fig. 9 As shown, it was found that the expression in resistant cells (MetR) was significantly higher than that in wild-type cells (WT) (lower right), and the relationship between PDE6D expression and metformin sensitivity was further discovered.

[0059] The results of colony formation assay, CCK-8 assay and apoptosis assay together showed that overexpression of PDE6D could reverse the inhibitory effect of metformin on PC-3 cell proliferation. The results of the present application showed that PDE6D not only counteracted the effect of metformin on cell proliferation, but also activated the apoptosis pathway, thereby affecting the sensitivity of PC-3 cells to metformin treatment.

[0060] Example 3 By downregulating PDE6D expression using RNAi technology, it was found that CRPC cells were more sensitive to metformin treatment. At the same time, PKG and downstream apoptosis pathways were significantly activated, promoting cell apoptosis.

[0061] Specific experimental steps: This application constructs PDE6D low-expressing cell lines of castration-resistant prostate cancer 22RV1 and PC-3 by inhibiting PDE6D expression through RNA interference. The RNA interference sequence is as described in Table 3 below: Table 3 Then, the protein immunoblotting experiment was used to detect the expression of PDE6D protein in PC-3 cell line, and the operation was the same as that in Example 2 (such as Fig.10 as shown).

[0062] The results of colony formation assays showed that downregulation of PDE6D reduced the colony formation ability of 22Rv1 and PC-3 cells. This reduction was more obvious after metformin treatment (e.g. Fig.11 The results of CCK-8 proliferation assay showed that downregulation of PDE6D reduced the proliferation capacity of 22Rv1 and PC-3 cells (as shown in Fig.12 as shown).

[0063] Further apoptosis experimental results showed that downregulation of PDE6D led to an increase in the apoptosis rate, and metformin treatment further enhanced the apoptosis rate (e.g. Fig.13 as shown).

[0064] The present application detected the relative content of intracellular cGMP in different treatment groups in two cell lines. The results showed that metformin treatment could significantly increase the relative content of intracellular cGMP, while the downregulation of PDE6D led to an increase in the relative content of intracellular cGMP (e.g. Fig.14 The results of western blot experiments showed that the downregulation of PDE6D led to the activation of PRKG1 in the cGMP / PKG pathway and initiated the downstream apoptosis pathway, in which the anti-apoptotic molecule Bax was downregulated and the apoptotic molecule BCL2 was upregulated, proving the activation of the apoptosis pathway (as shown in Figure 2A). Fig.15 as shown).

[0065] Example 4 The combination of the PDE6D small molecule inhibitor TMX-4100 and metformin significantly increased the sensitivity of CRPC cells to metformin, and this was verified in animals.

[0066] Specific experimental steps: This application uses prostate cancer PC-3 and 22RV1 cell lines, which are treated with DMSO, metformin and TMX-4100, respectively. The clone colony formation experiment showed that TMX-4100 alone had no significant inhibitory effect on the clone ability of CRPC cells. However, when used in combination with metformin, the inhibitory effect on clone colony formation was significantly enhanced (e.g. Fig.16 Similar effects were observed in CCK-8 and flow cytometry apoptosis experiments (as shown). Figure 17-18In vivo, the combination of TMX-4100 and metformin also sensitized CRPC cells to the antitumor effects of metformin ( Fig.19 ).

[0067] Example 5 H&E staining of the main organs and body weight of mice in different treatment groups demonstrated the reliable biosafety of the combined method.

[0068] Specific experimental steps: (a) Dewaxing: 1. Take out the dried slices from the incubator and immediately put them into xylene for dewaxing for 5-10 minutes (can be done in two bottles). The dewaxing time depends on whether the wax is completely dissolved. If the temperature is low, the time can be extended. If the temperature is high, the time can be appropriately shortened or the dewaxing can be accelerated in the incubator.

[0069] 2. Transfer into anhydrous alcohol (100%) (two bottles) for about 2 minutes.

[0070] 3. Transfer to 90% alcohol (two bottles) for about 2 minutes.

[0071] 4. Transfer to 80% alcohol (two bottles) for about 2 minutes.

[0072] 5. Transfer to 70% alcohol for about 2 minutes.

[0073] 6. Move into water and wash off the alcohol for about 2 to 3 minutes.

[0074] 7. Transfer to distilled water for about 2 minutes.

[0075] (2) Dyeing: 1. Transfer to hematoxylin and stain for 8 to 15 minutes. Generally, a slightly darker stain is appropriate.

[0076] 2. Transfer to water and wash off hematoxylin and floating color for about 1 to 2 minutes.

[0077] 3. Move into differentiation solution (1% hydrochloric acid alcohol) and differentiate for a few seconds to 30 seconds until the slice fades to light blue-red. Differentiation can remove the blue color of the cytoplasm and make the nucleus clearer and more vivid. When differentiation is insufficient, the cytoplasm is blue and the nucleus is overstained. When differentiation is excessive, the nucleus is too light and difficult to identify. You can return to the hematoxylin staining solution and extend the time.

[0078] 4. Move into running water and wash for 30 to 60 minutes until the tissue turns bright blue or sky blue (bluish).

[0079] 5. Move into eosin solution and soak for 2 to 5 minutes. If dyeing is slow, add glacial acetic acid to the eosin solution (add 1 to 2 drops of glacial acetic acid to 100 ml of eosin solution) to aid dyeing.

[0080] 6. Move into water, wash off the eosin floating solution, and wipe off the excess dye on the slide with gauze.

[0081] (III) Dehydration: 1. After absorbing the water on the glass slide, immerse it in 80% alcohol (two bottles) for dehydration for about 1 to 2 minutes. If it fades quickly in alcohol, it can be quickly moved to 90% alcohol or returned to eosin solution for re-staining.

[0082] 2. Transfer to 90% alcohol (two bottles) and dehydrate for about 2 to 4 minutes.

[0083] 3. Transfer to anhydrous alcohol (100% alcohol) (two bottles) and dehydrate thoroughly for about 4 to 8 minutes.

[0084] (iv) Transparency: 1. Transfer to xylene I and let it clear for 3 to 5 minutes.

[0085] 2. Transfer to xylene II and let it become transparent for 5 to 10 minutes.

[0086] (V) Sealing: To seal with gum, first take the slice out of xylene II, quickly wipe off the xylene on the outside of the tissue, then drop a drop of gum on the tissue slice, then take a clean cover glass, carefully add it to the sealing agent, and slowly flatten it so that the cover glass is in the right position. After the slice is sealed, place it in a warm oven to dry, or place it flat to dry and then box it.

[0087] The results showed that the cell morphology and histological structure of the heart, liver, spleen, lung and kidney remained normal. In addition, TMX-4100 combined with metformin treatment did not significantly affect the body weight of mice, indicating that the combined treatment of TMX-4100 and metformin is safe in vivo. In summary, TMX-4100 combined with metformin treatment has reliable biosafety (such as Fig. 20 as shown).

[0088] Example 6 The biochemical recurrence-free survival results of patients with high PDE6D expression and low PDE6D expression in 8 public databases and the comparison of PDE6D expression levels in patients with different clinical stages and Gleason scores.

[0089] Specific experimental steps: This application uses bioinformatics to analyze the biochemical recurrence-free survival results of patients with high PDE6D expression and low expression in 8 public databases (TCGA, CancerMap, GSE54460, CIT, CPC, Taylor, DKFZ and Stockholm) and compare the PDE6D expression levels of patients with different clinical stages and Gleason scores. The results in the TCGA database show that patients with high PDE6D expression have a higher probability of biochemical recurrence (e.g. Fig.21As shown), the pathological T stage is higher, the pathological N stage is higher, and the Gleason score is higher (as shown Fig. 22 In the remaining 7 public databases, this application observed that patients with high PDE6D expression had higher Gleason scores (such as Figure 23-24 as shown).

[0090] In summary, the study of this application shows that patients with high PDE6D expression have a greater probability of biochemical recurrence and worse clinical stage and Gleason score.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.

Claims

1. Use of a phosphodiesterase 6D detection reagent in the preparation of a product for guiding medication for the treatment of prostate cancer, characterized in that: The drugs for treating prostate cancer include metformin.

2. The use according to claim 1, characterized in that The drug for treating prostate cancer also includes TMX-4100.

3. The use according to claim 1, characterized in that The phosphodiesterase 6D detection reagent includes a reagent for detecting phosphodiesterase 6D mRNA or a reagent for detecting phosphodiesterase 6D protein.

4. The use according to claim 3, characterized in that The reagent for detecting phosphodiesterase 6D mRNA includes phosphodiesterase 6D detection primers, and the phosphodiesterase 6D detection primers include an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:

2.

5. The use according to claim 3, characterized in that The reagent for detecting phosphodiesterase 6D protein comprises a primary antibody and a secondary antibody, wherein the primary antibody is a rabbit-derived phosphodiesterase 6D polyclonal antibody, and the secondary antibody is a goat anti-rabbit secondary antibody.

6. The use according to claim 1, characterized in that The prostate cancer includes locally advanced prostate cancer or castration-resistant prostate cancer.

7. Application of phosphodiesterase 6D in the preparation of products for predicting the sensitivity of prostate cancer to metformin.

8. The use according to claim 7, characterized in that The human equivalent dosage of metformin when used is 500 mg / day for oral administration.

9. The use of TMX-4100 and metformin in combination for the preparation of drugs for the treatment of castration-resistant prostate cancer.

10. A detection kit for phosphodiesterase 6D, characterized in that: The kit is a reagent for detecting the mRNA expression amount of phosphodiesterase 6D or a reagent for detecting the protein expression amount of phosphodiesterase 6D; The reagent for detecting the mRNA expression of phosphodiesterase 6D includes a detection primer for phosphodiesterase 6D, and the detection primer for phosphodiesterase 6D includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 2; The reagent for detecting the expression amount of phosphodiesterase 6D protein comprises a primary antibody and a secondary antibody, wherein the primary antibody is a rabbit-derived phosphodiesterase 6D polyclonal antibody, and the secondary antibody is a goat anti-rabbit secondary antibody.

Images