Fermented milk for increasing IgA crossing human coronavirus in human saliva and food composition containing same as active ingredient

Abstract

The present invention addresses the problem of providing a measure for preventing human coronavirus infection, excluding hand washing and gargling. The fermented milk disclosed by the invention is prepared by utilizing lactic acid bacteria capable of generating exopolysaccharides, and has the function of increasing IgA crossed with human coronavirus in human saliva. It is required to be specified that the lactic acid bacteria are preferably lactic acid bacteria of the family Lactobacillus, more preferably lactic acid bacteria of the genus Lactobacillus, further preferably Lactobacillus delbrueckii subsp. Bulgaricus, and particularly preferably Lactobacillus delbrueckii subsp. Bulgaricus OLL1073R-1 (FERM BP-10741).

Description

Technical Field

[0001] The present invention relates to fermented milk that increases IgA cross-linked with human coronavirus in human saliva. In addition, the present invention also relates to a food composition containing the fermented milk as an effective ingredient. Background Art

[0002] Human coronaviruses (HCoV) include HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, which are the causes of cold syndrome, MERS-CoV, SARS-CoV, which are the causes of severe pneumonia, and SARS-CoV-2, which is the cause of COVID-19 that occurred in 2019. 10% to 15% (about 35% during the epidemic period) of cold syndromes are caused by HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1, and their epidemic peaks mainly occur in winter.

[0003] Prior art literature

[0004] Patent Literature

[0005] Patent Document 1: Japanese Patent Application Laid-Open No. 07-061934

[0006] Patent Document 2: Japanese Patent Application Publication No. 2014-073130 Summary of the invention

[0007] Problem that the invention aims to solve

[0008] In addition, hand washing and gargling are recommended as preventive measures for human coronavirus infection, but other more effective preventive measures are also desired. The subject of the present invention is to provide effective preventive measures for human coronavirus infection other than hand washing and gargling.

[0009] Solutions for solving problems

[0010] In order to solve the above problems, the present inventors focused on fermented milk prepared by lactic acid bacteria that can produce exopolysaccharides, and studied in detail the effect of ingesting the fermented milk on the production of IgA that crosses with human coronavirus in human saliva. As a result, it was found that by making people ingest the fermented milk, IgA that crosses with human coronavirus in their human saliva can be increased, thereby completing the present invention.

[0011] That is, the present invention is as follows.

[0012] (1) A fermented milk for increasing IgA cross-linked with human coronavirus in human saliva, which is prepared using lactic acid bacteria capable of producing exopolysaccharide.

[0013] (2) The fermented milk according to (1), which is obtained by fermenting a milk raw material with lactic acid bacteria that can produce exopolysaccharide.

[0014] (3) The fermented milk according to (1) or (2), wherein the human coronavirus is α-type.

[0015] (4) The fermented milk according to any one of (1) to (3), wherein the lactic acid bacteria are lactic acid bacteria of the family Lactobacillaceae.

[0016] (5) The fermented milk according to (4), wherein the lactic acid bacteria of the family Lactobacillaceae are lactic acid bacteria of the genus Lactobacillus.

[0017] (6) The fermented milk according to (5), wherein the lactic acid bacteria of the genus Lactobacillus are lactic acid bacteria having a 16S rRNA gene having a sequence identity of 95% or more to the base sequence of the following SEQ ID NO: 1.

[0018] <16S rRNA gene (SEQ ID NO. 1)>

[0019] GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0020] (7) The fermented milk according to (5), wherein the lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus.

[0021] (8) The fermented milk according to (7), wherein the Lactobacillus delbrueckii subsp. bulgaricus is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

[0022] (9) The fermented milk according to any one of (1) to (8), which is produced by using Streptococcus thermophilus in combination.

[0023] (10) The fermented milk according to any one of (1) to (9), wherein the human being is an elderly person. In addition, the "elderly person" referred to here refers to a person who is 65 years old or older.

[0024] (11) The fermented milk according to any one of (1) to (10), wherein the concentration of non-fat milk solids is in the range of 4.0 mass % to 12.0 mass %, and the amount is orally ingested once a day for more than 4 weeks in the range of 100 g / day to 120 g / day or in the range of 100 mL / day to 120 mL / day.

[0025] (12) A food composition for increasing IgA cross-linked with human coronavirus in human saliva, comprising the fermented milk according to any one of (1) to (11) as an active ingredient.

[0026] In addition, the present invention also includes the following inventions.

[0027] (13) A method for increasing IgA cross-linked with human coronavirus in human saliva, comprising administering fermented milk prepared using lactic acid bacteria capable of producing exopolysaccharide to a person in need thereof.

[0028] (14) Use of fermented milk prepared by lactic acid bacteria capable of producing extracellular polysaccharides for increasing IgA cross-linked with human coronavirus in human saliva.

[0029] (15) A fermented milk produced by lactic acid bacteria that produce exopolysaccharide, which is used as an active ingredient of the fermented milk for increasing IgA cross-linked with human coronavirus in human saliva.

[0030] (16) Use of lactic acid bacteria capable of producing exopolysaccharides for producing fermented milk that increases IgA cross-linked with human coronavirus in human saliva.

[0031] (17) A method of using fermented milk prepared by lactic acid bacteria capable of producing exopolysaccharide as an agent for increasing IgA cross-linked with human coronavirus in human saliva.

[0032] (18) A method for producing fermented milk for increasing IgA that crosses with human coronavirus in human saliva, the method comprising supplying a milk raw material to lactic acid bacteria that can produce exopolysaccharide to produce fermented milk for increasing IgA that crosses with human coronavirus in human saliva.

[0033] Effects of the Invention

[0034] According to the present invention, by having a human ingest fermented milk prepared by lactic acid bacteria that can produce exopolysaccharide, IgA that crosses with human coronavirus in human saliva can be increased, thereby achieving prevention of human coronavirus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The graph shows the effects of the test example Meiji Probio yogurt R-1 hard type on the secretion rate of total IgA in the saliva of residents of a special care home for the elderly A and a nursing care facility for the elderly B, and the secretion rate of IgA cross-linked with α-type human coronaviruses HCoV-229E and HCoV-NL63. DETAILED DESCRIPTION

[0036] The fermented milk of the embodiment of the present invention is prepared by lactic acid bacteria that can produce extracellular polysaccharides, and has the function of increasing IgA that crosses with human coronavirus in human saliva. It should be noted that the fermented milk is particularly effective in increasing IgA that crosses with α-type human coronavirus in human saliva. In addition, α-type human coronavirus includes human coronavirus HCoV-229E and HCoV-NL63. In addition, the person referred to here is preferably a person over 65 years old with a tendency to decline in immune function, and further, it can be an elderly person, for example, a person over 70 years old, or a person over 75 years old.

[0037] The lactic acid bacteria are preferably lactic acid bacteria of the family Lactobacillus (Lactobacillaceae). The lactic acid bacteria of the family Lactobacillus are classified according to the classification described in Reference 4 below, unless otherwise specified.

[0038] Reference 4: Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr;70(4):2782-2858

[0039] Specifically, the Lactobacilaceae family is divided into the following 31 genera: Lactobacillus, Paralactobacillus, Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacillus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, Dellaglioa, Liquorilactobacillus, and Lactobacillus. gilactobacillus, Lactiplantibacillus, Furfurilactobacillus, Paucilactobacillus, Limosilactobacillus, Fructilactobacillus, Acetilactobacillus, Apilactobacillus, Levilactobacillus, Secundilactobacillus, Lentilactobacillus, Pediococcus, Convivina, Leuconostoc, Fructobacillus, Oenococcus, Weissella. In addition, it is preferable to use lactic acid bacteria of the genus Lactobacillus for the fermented milk of the embodiment of the present invention. The lactic acid bacteria of the genus Lactobacillus are as follows.

[0040] The lactobacillus lactic acid bacteria of the embodiment of the present invention is a general term for all bacteria that are identified as the genus Lactobacillus in taxonomy, and the species, strains, etc. are not limited. It should be noted that the lactobacillus lactic acid bacteria are sometimes divided into any one of plant sources and animal sources according to their source. In the present invention, plant-derived lactic acid bacteria and animal-derived lactic acid bacteria can be used. The strain of the lactobacillus lactic acid bacteria of the present invention is preferably one or more strains belonging to the lactobacillus lactic acid bacteria that can prepare fermented milk (such as yogurt, etc.) with sufficient edible experience. As such a Lactobacillus lactic acid bacterium, preferably, it is a Lactobacillus lactic acid bacterium having a 16S rRNA gene having a sequence identity of 95% or more with the base sequence of the following sequence number 1 (i.e., all or a characteristic part of the 16S rRNA gene sequence (V1 region, V2 region, V3 region, or all or a part of the V1 region, V2 region and V3 region, or a part including the V1 region, V2 region and V3 region, etc.)), more preferably, it is a Lactobacillus lactic acid bacterium having a 16S rRNA gene having a sequence identity of 98% or more with the base sequence of the sequence number 1, and further preferably, it is a Lactobacillus lactic acid bacterium having a 16S rRNA gene having a sequence identity of 99% or more with the base sequence of the sequence number 1. It should be noted that SEQ ID NO. 1 is the base sequence (sometimes also referred to as “nucleotide sequence”) of the V1 to V3 region of the 16S rRNA gene of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (equivalent to the base sequence at positions 34 to 535 in the full-length sequence of the 16S rRNA gene).

[0041] (Sequence Listing)

[0042] <16S rRNA gene (SEQ ID NO. 1)>

[0043] GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0044] In the embodiment of the present invention, when being referred to as sequence identity, except the situation that there is special record, all refer to the number ratio of the consistent bases shared between sequences when two sequences are optimally arranged. The analysis about base sequence identity can be carried out using an algorithm or program (such as BLASTN, BLASTP, BLASTX, ClustalW) known to those skilled in the art. The parameters when using the program can be appropriately set by those skilled in the art, and the default parameters of each program can be used in addition. The specific methods of these analytical methods are also known to those skilled in the art. In the calculation of identity, commercially available gene information processing software can be used.

[0045] Alternatively, a strain having the same mycological properties as Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (hereinafter sometimes referred to as "this strain") may be used. Its mycological properties are as follows.

[0046] (1) Morphological characteristics

[0047] Cell shape: Bacillus

[0048] Sportiness: None

[0049] Presence of spores: None

[0050] Gram staining: positive

[0051] (2) Growth status on culture medium

[0052] The strain was spread on a BL agar medium (Eiken Chemical) plate and cultured at 37°C for 48 hours using the steel wool method, showing an opaque, rough colony morphology.

[0053] (3) Physiological characteristics

[0054] Nitrate reduction: negative

[0055] Indole production: negative

[0056] Gelatin liquefaction: negative

[0057] Catalase: Negative

[0058] Attitude towards oxygen: Facultative anaerobic

[0059] D(-) lactic acid is produced from glucose through homolactic fermentation. No gas is produced. Growth in BL liquid medium at 10°C is negative and growth at 45°C is positive.

[0060] Arginine degradation: negative

[0061] Gas production from malic acid: Negative

[0062] Decomposition of various carbohydrates (positive +, negative -)

[0063]

[0064]

[0065] In addition, the present strain has the following characteristics: it has the ability to produce polysaccharides, and produces polysaccharides containing galactose and glucose as constituent sugars and containing phosphorus outside the cell.

[0066] As lactic acid bacteria of the Lactobacillaceae family that produce polysaccharides containing galactose and glucose as constituent sugars outside the cell, in addition to this strain, there are Lactobacillus plantarum C88 (see reference 5), Lactobacillus johnsonii 151 strain (see reference 6), Lactobacillus delbrueckii subsp. bulgaricus NCFB2074 (see reference 7), Lactobacillus casei CG11 (see reference 8), Lactobacillus rhamnosus E / N (see reference 9), Lactobacillus fermentum TDS030603 (see reference 10), Lactobacillus gasseri FR4 (see reference 11), etc. The composition of an embodiment of the present invention preferably contains extracellular polysaccharides produced by Lactobacillus lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars extracellularly, more preferably contains extracellular polysaccharides produced by Lactobacillus lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars extracellularly, and particularly preferably contains extracellular polysaccharides produced by Lactobacillus lactic acid bacteria that produce polysaccharides containing galactose and glucose as constituent sugars (preferably galactose and glucose as constituent sugars) and containing phosphorus extracellularly.

[0067] Reference 5: Zhang, L., Liu, C., Li, D., Zhao, Y., Zhang, X., Zeng, X., Yang, Z., Li, S., 2013. Antioxidant activity on exopolysaccharide isolated from Lactobacillus plantarum C88. Int.

[0068] Table 6:Gorska-Froczek,S.,Sandstrom,C.,Kenne,L.,Paociak,M.,Brzozowska,E.,Strus,M.,Heczko,P.,Gamian,A.,2013 Lactobacillus johnsonistrain 151.Carbohydr.Res.378,148–153.

[0069] Table 7:Harding,LP,Marshall,VM,Hernandez,Y.,Gu,Y.,Maqsood,M.,Mclay,N.,Laws,AP,2005 ssp.bulgaricusNCFB2074.Carbohydr.Res.340,1107–1111.

[0070] Reference 8:JCMCCerning,CMGCRenard,JFThibault,C.Bouillanne,M.Landon,M.Desmazeaud&L.Topisirovic:Appl.Environ.Microbiol.,60,3914(1994).

[0071] Publication 9:M.Polak-Berecka,A.Wasko,D.Szwajgier&A.Choma:Pol.J.Microbiol.,62,181(2013).

[0072] Materials 10:K.Fukuda,T.Shi,K.Nagami,F.Leo,T.Nakamura,K.Yasuda,A.Senda,H.Motoshima&T.Urashima:Carbohydr.Polym.,79,1040(2010).

[0073] Reference 11: International Journal of Biological MacromoleculesVolume109,1April 2018,Pages 772-783.

[0074] The exopolysaccharide of an embodiment of the present invention is preferably produced by lactic acid bacteria of the Lactobacilaceae family, more preferably produced by lactic acid bacteria of the genus Lactobacillus, further preferably produced by Lactobacillus delbrueckii, further preferably produced by Lactobacillus delbrueckii subsp. bulgaricus, and particularly preferably produced by Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (Accession No.: FERM BP-10741) lactic acid bacteria (i.e., OLL1073R-1 strain).

[0075] In addition, the exopolysaccharide referred to herein is not particularly limited as long as it has the target effect, and is preferably produced by fermenting raw milk (preferably a raw material of milk in the province such as milk) using the above-mentioned lactic acid bacteria. The exopolysaccharide used in the embodiment of the present invention can be one kind or a combination of two or more kinds. In addition, the exopolysaccharide preferably includes a phosphorylated polysaccharide. In addition, the exopolysaccharide may include a non-phosphorylated polysaccharide, and preferably the non-phosphorylated polysaccharide does not include a sulfated polysaccharide.

[0076] It should be noted that "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1" is deposited in the Patent Organism Depository of the National Institute of Advanced Industrial Science and Technology under the deposit number FERM BP-10741 (deposit date: November 29, 2006).

[0077] The fermented milk according to the embodiment of the present invention can be easily taken. In addition, since fermented milk has a long history of consumption, it is highly safe and has no side effects to worry about, so the person who takes it can take it with confidence.

[0078] As described above, the "fermented milk" in the embodiment of the present invention refers to a substance obtained by fermenting milk, and includes, for example, "fermented milk", "lactic acid bacteria beverage", "milk beverage", "natural cheese" and the like defined in the provincial ordinance on the ingredient standards of milk and dairy products (milk, etc. provincial ordinance), but is not limited to these. For example, fermented milk refers to the "fermented milk" defined in the provincial ordinance on milk, etc., that is, raw milk, cow's milk, special cow's milk, raw goat's milk, sterilized goat's milk, raw sheep's milk, ingredient-adjusted cow's milk, low-fat cow's milk, fat-free cow's milk and processed milk, or milk containing the same or more non-fat milk solid components, etc., which is fermented with lactic acid bacteria or yeast to form a solid (hard type), paste (soft type) or liquid (beverage type), or frozen, but is not limited to this. In the fermented milk according to the embodiment of the present invention, the concentration range of the non-fat milk solids component is, for example, preferably in the range of 4.0 mass % or more and 12.0 mass % or less, more preferably in the range of 6.0 mass % or more and 10.0 mass % or less, and further preferably in the range of 7.0 mass % or more and 9.0 mass % or less. In addition, the concentration of the milk fat component is, for example, preferably in the range of 0.2 mass % or more and 4.0 mass % or less, more preferably in the range of 0.3 mass % or more and 3.0 mass % or less, and further preferably in the range of 0.4 mass % or more and 2.0 mass % or less.

[0079] Yogurt can be cited as a typical example of fermented milk. The international standard defined by the Food and Agriculture Organization (FAO) / World Health Organization (WHO) stipulates that "the product called yogurt is made from dairy products such as milk and skimmed milk powder by lactic acid fermentation of two bacteria, Streptococcus thermophilus and Lactobacillus delbrueckii subspecies bulgaricus, and a large amount of live bacteria of the above two bacteria are present in the final product." In the present invention, "yogurt" includes the yogurt defined by the above FAO / WHO. The yogurt includes, for example, plain yogurt, hard yogurt (set yogurt), soft yogurt, yogurt drinks, etc. As the yogurt of an embodiment of the present invention, hard yogurt is particularly preferred from the viewpoint of eating feel and satisfaction. In addition, when the subject is an elderly person, hard yogurt is particularly preferred from the viewpoint of preventing accidental swallowing.

[0080] As a method for preparing fermented milk according to an embodiment of the present invention, for example, there can be cited “a method in which, after sterilizing and cooling the raw milk, a lactic acid bacteria starter containing the above-mentioned lactic acid bacteria is added to the raw milk, and the raw milk to which the lactic acid bacteria starter is added is fermented at a fermentation temperature and for a fermentation time that can achieve a predetermined lactic acid acidity”. Extracellular polysaccharides are produced by lactic acid bacteria of the genus Lactobacillus during fermentation. In this method, the lactic acid acidity is, for example, 0.6 to 1.2. It should be noted that the lactic acid acidity is preferably 0.6 to 0.8. In addition, the fermentation temperature is, for example, 40 to 45°C. In addition, the fermentation time is, for example, 2 to 12 hours. It should be noted that the fermentation time is preferably 3 to 8 hours.

[0081] As a lactic acid bacteria fermentation agent, from the viewpoint of production efficiency and palatability, it is preferred to use Streptococcus lactic acid bacteria or thermophilic Streptococcus (Streptococcus thermophilus) in combination with lactobacillus lactic acid bacteria, particularly lactobacillus lactic acid bacteria. Furthermore, when the lactic acid bacteria of the genus Lactobacillus is Lactobacillus delbrueckii subsp.bulgaricus OLL1073R-1 (preservation number: FERM BP-10741), the thermophilic bacteria are more preferably thermophilic Streptococcus 1131 and thermophilic Streptococcus OLS3059. The thermophilic Streptococcus OLS3059 is deposited in the Patent Organism Depository of the National Institute of Advanced Industrial Science and Technology with the deposit number FERM BP-10740 (deposit date: November 29, 2006). Streptococcus thermophilus 1131 can be obtained from Meiji Bulgarian yogurt "LB81" manufactured by Meiji Co., Ltd.

[0082] Furthermore, for the purpose of using it as a lactic acid bacteria starter or imparting functionality, lactic acid bacteria other than Lactobacillus lactic acid bacteria and Streptococcus lactic acid bacteria, lactococci, bifidobacteria, yeast and other fermentation microorganisms may be added.

[0083] By making the fermented milk of the embodiment of the present invention into a packaged form in an amount suitable for one intake, the fermented milk of the embodiment of the present invention can be appropriately and easily ingested, which is preferable from the aspect of usability. There are individual differences and deviations in the amount suitable for one intake. In the case of fermented milk with a non-fat milk solid content of 8.0% by mass, each time is preferably in the range of 10 mL or more and 1000 mL or less, more preferably in the range of 30 mL or more and 500 mL or less, further preferably in the range of 50 mL or more and 200 mL or less, and preferably in the range of 80 mL or more and 120 mL or less. Alternatively, each time is preferably in the range of 10 g or more and 1000 g or less, preferably in the range of 30 g or more and 500 g or less, preferably in the range of 50 g or more and 200 g or less, more preferably in the range of 80 g or more and 150 g or less, and further preferably in the range of 100 g or more and 120 g or less.

[0084] In the embodiment of the present invention, "one package form" includes all forms, such as a container with a lid, a bottle with a lid, an independent bag, a pouch, a tube, and other conventional packaging methods. In the embodiment of the present invention, the use, efficacy, and method of ingestion of the fermented milk according to the embodiment of the present invention are recorded on each independent package or a package including a plurality of independent packages, and / or an article recording the description is enclosed, and / or an article recording the description such as an instruction manual is separately posted, so that the use can be clarified.

[0085] From the viewpoint of improving the infection prevention effect of human coronavirus, it is preferred to continue to ingest the fermented milk of the embodiment of the present invention for more than 3 days, preferably for more than 5 days, preferably for more than 1 week, preferably for more than 2 weeks, preferably for more than 4 weeks, more preferably for more than 6 weeks, further preferably for more than 8 weeks, further preferably for more than 10 weeks, further preferably for more than 12 weeks, further preferably for more than 24 weeks, and particularly preferably for more than 36 weeks. It should be noted that the fermented milk of the embodiment of the present invention has a long history of consumption and can be safely ingested, so the upper limit of the intake period is not particularly limited, and can be permanently continued. If an upper limit must be set, for example, it is less than 60 weeks. It should be noted that the upper limit can be set to, for example, less than 120 weeks, less than 100 weeks, or less than 80 weeks. It should be noted that as a mode of ingestion, oral ingestion is preferred.

[0086] In addition, it is preferred that the fermented milk of the embodiment of the present invention is marked with instructions such as its purpose, efficacy, function, type of active ingredients, and method of use. The "labeling" referred to here includes all labels used to make the above-mentioned effect descriptions known to the needy. The labeling can be a label that can be imagined and inferred from the above-mentioned labeling content, and can include all labels that are completely unrestricted, such as the purpose of the labeling, the content of the labeling, and the object or medium for labeling. For example, the above-mentioned instructions can be marked on the packaging or container of the product, the above-mentioned instructions can be marked on the advertisement, price list or transaction document related to the product and displayed or published, or information with these contents can be provided through electromagnetic methods (Internet, etc.).

[0087] It is preferable to add a label such as "increases IgA that crosses with human coronavirus in saliva" to the product in which the fermented milk according to the embodiment of the present invention is packaged.

[0088] It should be noted that the phrases used for the above-mentioned marking are not limited to the above-mentioned examples, and can be phrases with the same meaning as this. As such phrases, various phrases such as "increase IgA in saliva" and "increase IgA against coronavirus in saliva" are acceptable to the needer.

[0089] It should be noted that the fermented milk can also be made into special purpose food, comprehensive nutritional food, nutritional supplement food, specific health food, functional label food, processed food, etc. In addition, the fermented milk can also be formulated into a composition such as a beverage or liquid food other than a beverage yogurt. In addition, the fermented milk can also be used after drying, concentration, etc.

[0090] Hereinafter, the present invention will be described in more detail based on Examples and Comparative Examples. It should be noted that these Examples do not limit the present invention.

[0091] [Example]

[0092] (Test example)

[0093] -Test Samples-

[0094] The following test was conducted using Meiji Probio Yogurt R-1 hard type manufactured by Meiji Co., Ltd. It should be noted that the hard yogurt is obtained by fermenting milk with Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741) and Streptococcus thermophilus. Here, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741) is a lactic acid bacterium that can produce exopolysaccharides. In addition, the hard yogurt contains exopolysaccharides produced by OLL1073R-1 (FERM BP-10741). In addition, this hard yogurt has been on sale since 2009 and has sufficient sales volume. There have been no reports of serious side effects caused by this product in the past.

[0095] -Test Methods-

[0096] The above-mentioned Meiji Probio yogurt R-1 hard type was provided to the special care home for the elderly A for several consecutive years, and the residents continuously took one (112g) every day. 41 residents of the special care home for the elderly A (76 to 102 years old (average age 86.7 years old)) and 49 residents of the nursing care facility B for the elderly who were not provided with the above-mentioned Meiji Probio yogurt R-1 hard type as controls (76 to 99 years old (average age 90.4 years old)) were selected as the analysis objects. In addition, 4 years and 8 months after the above-mentioned Meiji Probio yogurt R-1 hard type was provided to the special care home for the elderly A, saliva was collected from the residents of each nursing home and the saliva secretion rate was measured. It should be noted that at this time, residents who had caught a cold 2 months before the saliva was collected were excluded from the analysis objects. This is to exclude the possibility of hypersecretion of IgA in saliva due to a cold. As a result, the number of analysis subjects of the special care home for the elderly A remained unchanged at 41, while the number of analysis subjects of the nursing care facility for the elderly B became 43.

[0097] Then, the total IgA concentration in each collected saliva was measured, and the IgA concentration in the saliva crossed with HCoV-229E and HCoV-NL63 as α-type human coronaviruses was measured according to the ELISA method, and the values ​​of each IgA concentration were multiplied by the saliva secretion rate to calculate each IgA secretion rate. It should be noted that for the IgA concentration crossed with the α-type human coronavirus, the value of the mixture of the optional saliva specimens was set to 1 arbitrary unit (AU) / mL, and expressed as its relative value (AU / mL).

[0098] The method for measuring the concentration of IgA in saliva that crosses with α-type human coronavirus by the ELISA method is as follows.

[0099] (1) Reagents and instruments

[0100] 96-well plate (Corning #3590)

[0101] Coating buffer (0.1M sodium carbonate, pH 9.5)

[0102] Washing buffer (PBS containing 0.05% Tween 20)

[0103] ChonBlock Blocking / Sample Dilution Buffer (Chondrex #9068)

[0104] ChonBlock Detection Antibody Dilution Buffer (Chondrex #90681)

[0105] TMB Substrate Reagent Set (BD#555214)

[0106] Antigen: HCoV-229E spike protein / S1 protein (Sino Biological #40601-V08H)

[0107] Antigen: HCoV-NL63 spike protein / S1 protein (Sino Biological #40600-V08H)

[0108] Secondary antibody: Goat anti-human IgA α chain (HRP) (Abcam #ab97215)

[0109] ·2N H2SO4

[0110] (2) Pre-treatment

[0111] (2-1) Saliva treatment

[0112] After thawing each saliva, the saliva was centrifuged at 4°C and 3000 g for 5 minutes to obtain a supernatant. The supernatant was used for the following test.

[0113] (2-2) Preparation of standard samples

[0114] The saliva of each test subject is mixed in equal amounts to prepare a standard sample. As mentioned above, for the IgA concentration that crosses with the α-type human coronavirus, the IgA concentration that crosses with the α-type human coronavirus of the standard sample is set to 1 arbitrary unit (AU) / mL. Then, an appropriate amount of the standard sample is dispensed and stored frozen until use.

[0115] (3) ELISA steps

[0116] (3-1) Antigen Immobilization

[0117] Each of the above antigens was adjusted to 1 μg / mL with coating buffer. Then, 80 μL of the solution was introduced into each well of a 96-well plate. Next, the 96-well plate was sealed and left to stand at 4°C overnight. It should be noted that in order to confirm non-specific reactions, wells without antigens were prepared.

[0118] (3-2) Closure

[0119] After the 96-well plate with the antigen immobilized thereon was washed three times with the washing buffer, 200 μL of ChonBlock blocking buffer was injected into each well of the 96-well plate, and the 96-well plate was sealed and left to stand at 37° C. for 1 hour.

[0120] (3-3) Primary Antibody Reaction

[0121] After the blocked 96-well plate was washed three times with a washing buffer, 80 μL of saliva diluted (about 50 to 200 times) with a ChonBlock antibody dilution buffer was injected into each well of the 96-well plate. The 96-well plate was then sealed and left to stand at 37° C. for 2 hours.

[0122] (3-4) Secondary Antibody Reaction

[0123] After the primary antibody reaction treatment, the 96-well plate was washed five times with a washing buffer, and then 80 μL of HPR secondary antibody diluted 10,000 times with ChonBlock antibody dilution buffer was injected into each well of the 96-well plate. The 96-well plate was then sealed and left to stand at 37° C. for 1 hour.

[0124] (3-5) Luminescence measurement

[0125] Dispense equal amounts of TMB substrate solution A and solution B respectively. In addition, wash the 96-well plate after secondary antibody reaction treatment with washing buffer 5 times. Mix the above-mentioned solution A and solution B, and inject 80 μL of the mixture into each well of the washed 96-well plate. Then, let the 96-well plate stand at room temperature and light-shielded for 30 minutes without sealing, and then inject 40 μL of 2N H2SO4 into each well to stop the reaction in each well. Finally, measure the optical density (OD) of the sample in each well at 450nm~570nm.

[0126] -Statistical methods for various data processing-

[0127] The differences in IgA secretion rate among nursing homes were analyzed by Mann-Whitney U test.

[0128] - Test results -

[0129] like Figure 1 As shown, there was no difference between nursing homes for the total IgA secretion rate in saliva, but the secretion rate of IgA in saliva that crosses with HCoV-229E and HCoV-NL63 was significantly higher in residents of special care nursing home A than in residents of nursing nursing care facility B. It should be noted that the p value for HCoV-229E was less than 0.05 (p < 0.05), and the p value for HCoV-NL63 was less than 0.1 (p < 0.1). Therefore, it was confirmed that Meiji Probio yogurt R-1 Hard Type increased IgA that crosses with human coronavirus in human saliva.

[0130] Industrial Applicability

[0131] The fermented milk of the invention is prepared by using lactic acid bacteria capable of producing extracellular polysaccharide, and has the function of increasing IgA in human saliva that crosses with human coronavirus.

[0132]

[0133]

Claims

1. A fermented milk for increasing IgA cross-linked with human coronavirus in human saliva, which is prepared by using lactic acid bacteria capable of producing extracellular polysaccharides. 2 . The fermented milk according to claim 1 , which is obtained by fermenting a milk raw material with the lactic acid bacteria capable of producing exopolysaccharide. 3 .

3. The fermented milk according to claim 1, wherein Human coronavirus is alpha type.

4. The fermented milk according to claim 1, wherein The lactic acid bacteria are lactic acid bacteria of the family Lactobacillaceae.

5. The fermented milk according to claim 4, wherein The lactic acid bacteria of the family Lactobacillus (Lactobacillaceae) are lactic acid bacteria of the genus Lactobacillus.

6. The fermented milk according to claim 5, wherein The lactic acid bacteria of the genus Lactobacillus are lactic acid bacteria of the genus Lactobacillus having a 16S rRNA gene having a sequence identity of 95% or more to the base sequence of the following SEQ ID NO: 1, <16S rRNA gene (SEQ ID NO. 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATG GAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT.

7. The fermented milk according to claim 5, wherein The lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus.

8. The fermented milk according to claim 7, wherein The Lactobacillus delbrueckii subspecies bulgaricus is Lactobacillus delbrueckii subspecies bulgaricus OLL1073R-1 (FERM BP-10741). 9 . The fermented milk according to claim 4 , which is produced by using Streptococcus thermophilus in combination.

10. The fermented milk according to claim 1, wherein The person is an elderly person.

11. The fermented milk according to claim 7, wherein The elderly are those who are over 65 years old.

12. The fermented milk according to claim 1, wherein The concentration of non-fat milk solids is within the range of 4.0% by mass or more and 12.0% by mass or less, An amount within the range of 100 g / day to 120 g / day or within the range of 100 mL / day to 120 mL / day is orally ingested once a day for 4 weeks or more.

13. A food composition for increasing IgA cross-linked with human coronavirus in human saliva, comprising the fermented milk according to any one of claims 1 to 12 as an effective ingredient.

Images