Glucose dehydrogenase mutant as well as coding gene, plasmid, genetically engineered bacterium, immobilized enzyme and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a glucose dehydrogenase mutant as well as a coding gene, a plasmid, a genetically engineered bacterium, an immobilized enzyme and application thereof. The glucose dehydrogenase mutant is a mutant obtained by mutating wild valine at the 62nd site and / or alanine at the 197th site into other amino acids, and a mutant coupled with the 252nd site. The stability of the glucose dehydrogenase mutant disclosed by the invention is obviously improved and can be up to 6 times or more of that of a wild type, and meanwhile, the enzyme activity is improved to 2.5 times. The immobilized enzyme prepared from the glucose dehydrogenase mutant is stable in reaction completion time among batches and high in reaction efficiency, the reaction time is not obviously reduced after 10 batches of immobilized enzyme are repeatedly used, and the glucose dehydrogenase mutant is suitable for industrial production.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a glucose dehydrogenase mutant and its encoding gene, plasmid, genetic engineering bacteria, immobilized enzyme and application. Background Art

[0002] Oxidoreductases are widely used to catalyze the production of pharmaceutical intermediates by redox reactions. For example, ketoreductase catalyzes the conversion of ethyl 4-chloroacetoacetate into ethyl S-4-chloro-3-hydroxybutyrate. Such reactions often require the participation of coenzymes that are expensive and are continuously consumed during the reaction. Therefore, using glucose dehydrogenase to achieve in situ regeneration of the coenzyme NAD(P)H and then achieve recycling of the coenzyme (NAD(P)H) is an effective strategy to reduce reaction costs. Glucose dehydrogenase (GDH) can catalyze glucose to produce gluconic acid, catalyzing NAD(P) + NAP(P)H is generated, and the enzyme has high activity. The substrate glucose and its products have little effect on the catalytic performance of the enzyme, so the application effect is good.

[0003] When glucose dehydrogenase is actually applied in the redox reaction involving coenzymes, various forms such as bacteria, enzyme liquid, and immobilized enzyme can be selected. Among them, immobilized enzyme is beneficial to the impurity control of the enzymatic reaction system, and a large number of cycle batches is beneficial to cost control. There are many methods for enzyme immobilization, including covalent immobilization of resins, covalent organic frameworks (COFs), and many others. Since most natural enzyme structures are intolerant to immobilization conditions, especially glucose dehydrogenases often have poor thermal stability, which further limits their application in immobilized enzymes. Therefore, existing glucose dehydrogenase mutants, such as Chinese invention patent applications with application numbers 202310847450.3 and 202410500726.5, only focus on the improvement of enzyme activity for non-immobilized uses. Using these enzyme mutants for immobilization has the problem of insufficient stability and cannot be used continuously in multiple batches. Summary of the invention

[0004] The purpose of the present invention is to provide a glucose dehydrogenase mutant and the encoding gene, plasmid, genetic engineering bacteria and immobilized enzyme of the mutant. By using the encoding gene of the glucose dehydrogenase mutant, the corresponding plasmid is constructed and the genetic engineering bacteria are transformed to produce glucose dehydrogenase with ultra-high stability, so as to solve the problem that the existing glucose dehydrogenase has poor stability and poor immobilization effect.

[0005] Another object of the present invention is to provide a method for preparing an immobilized enzyme using a glucose dehydrogenase mutant and the use of the immobilized enzyme in the regeneration of coenzymes NADH and NADPH in redox reactions.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A glucose dehydrogenase mutant, whose amino acid sequence is based on the sequence shown in SEQ ID NO.1, and the 62nd valine and / or the 197th alanine are mutated to other amino acids.

[0008] Among them, sequence SEQ ID NO.1 is the wild-type Glucose 1-dehydrogenase [Bacillus] published by NCBI, and Sequence ID: WP_003246720.1 gene sequence SEQ ID NO.2 corresponds to the encoded amino acid sequence.

[0009] The sequence SEQ ID NO.2 is as follows:

[0010] ATGTACCCGGATCTGAAAGGTAAAGTGGTTGCAATTACTGGTGCTGCGAGCGGTCTGGGCAAAGCGATGGCAATTCGTTT CGGTAAAGAACAGGCCAAAGTTGTCATCAATTACTACTCCAACAAACAGGACCCGAACGAAGTGAAAGAGGAAGTGATCAAGGCTGGTGGCGAAGCTGTCGTGGTACAGGGTGACGTGACGAAAGAGGAAGACGTGAAGAACATCGTTCAGAC TG CAAT TAAA GA GT TT GG CACCCTG GATAT C AT GATCAACAAC GC GGGT CT GGAGAAT CC GGTAC C GT CC CAC GAAAT GC C GCT GAAAGACTGGGACAAGGT CAT C GGTAC GAAC CTGACCGGCGCT TTCCTGGGTT CCCGTGAAGC TATCAAATAC TTCGTCGAGAACGACATCAAAGGTAACGTTATCAATATGTCCTCTGTGCACGAAGTGATTCCTTGGCCCGCTGTTCGTTCATTACGCGGCATCCAAAGGTGGTATCAAACTGATGACCGAAACCCTGGCGCTGGAATATGCACCGAAGGGTATCCGCGTTA ACAACATTGGCCCGGGCGCTATTAACACCCCGATCAACGCTGAAAAATTCGCGGACCCAAAACAAAAGGCGGATGTAGTCTATGATTCCGATGGGGCTACATTGGCGAACCGGAAGAAATTGCTGCTGTGGCTGCGTGGCTGGCCTCTAAGGAAGCGTC TTATGTCACCGGTATCACCCTGTTCGCCGATGGTGGCATGA CTCA AT ACCC GT CTTTCCAGGCTGGTCGTGGCT GA

[0011] As a limitation of the present invention, based on the amino acid sequence as shown in SEQ ID NO.1, the valine at position 62 is mutated to glycine and / or the alanine at position 197 is mutated to arginine.

[0012] As another limitation of the present invention, based on the sequence shown in SEQ ID NO.1, the glutamine at position 252 is mutated to isoleucine.

[0013] The glucose dehydrogenase mutant according to claim 3 is characterized in that its amino acid sequence is shown in SEQ ID NO. 2. The mutation sites compared to the wild type are underlined, namely V62G, A197R and Q252I. The corresponding amino acid sequence is shown in SEQ ID NO. 3:

[0014] Met-Tyr-Pro-Asp-Leu-Lys-Gly-Lys-Val-Val-Ala-Ile-Thr-Gly-Ala-Ala-Ser-Gly-Leu-Gly-Lys-Ala-Met-Ala-Ile-Arg-Phe-Gly-Lys-Glu-Gl n-Ala-Lys-Val-Val-Ile-Asn-Tyr-Tyr-Ser-Asn-Lys-Gln-Asp-Pro-Asn-Glu-Val-Lys-Glu-Glu-Val-Ile-Lys-Ala-Gly-Gly-Glu-Ala-Val-Val- Gly-Gln-Gly-Asp-Val-Thr-Lys-Glu-Glu-Asp-Val-Lys-Asn-Ile-Val-Gln-Thr-Ala-Ile-Lys-Glu-Phe-Gly-Thr-Leu-Asp-Ile-Met-Ile-Asn-Asn-Ala-Gly-Leu-G lu-Asn-Pro-Val-Pro-Ser-His-Glu-Met-Pro-Leu-Lys-Asp-Trp-Asp-Lys-Val-Ile-Gly-Thr-Asn-Leu-Thr-Gly-Ala-Phe-Leu-Gly-Ser-Arg-Glu-Ala-Ile-Lys -Tyr-Phe-Val-Glu-Asn-Asp-Ile-Lys-Gly-Asn-Val-Ile-Asn-Met-Ser-Ser-Val-His-Glu-Val-Ile-Pro-Trp-Pro-Leu-Phe-Val-His-Tyr-Ala-Ala-Ser-Lys-G ly-Gly-Ile-Lys-Leu-Met-Thr-Glu-Thr-Leu-Ala-Leu-Glu-Tyr-Ala-Pro-Lys-Gly-Ile-Arg-Val-Asn-Asn-Ile-Gly-Pro-Gly-Ala-Ile-Asn-Thr-Pro-Ile-Asn- Arg -Glu-Lys-Phe-Ala-Asp-Pro-Lys-Gln-Lys-Ala-Asp-Val-Glu-Ser-Met-Ile-Pro-Met-Gly-Tyr-Ile-Gly-Glu-Pro-Glu-Glu-Ile -Ala-Ala-Val-Ala-Ala-Trp-Leu-Ala-Ser-Lys-Glu-Ala-Ser-Tyr-Val-Thr-Gly-Ile-Thr-Leu-Phe-Ala-Asp-Gly-Gly-Met-Thr- Ile -Tyr-Pro-Ser-Phe-Gln-Ala-Gly-Arg-Gly.

[0015] The present invention also provides a coding gene, wherein the coding gene encodes any one of the above-mentioned glucose dehydrogenase mutant genes.

[0016] The present invention also provides a plasmid, which carries the coding gene of the glucose dehydrogenase mutant.

[0017] The invention also provides a genetically engineered bacterium containing the plasmid for expressing a glucose dehydrogenase mutant.

[0018] An immobilized enzyme is a COFs immobilized enzyme (i.e. an immobilized enzyme based on a covalent organic framework material) or a resin immobilized enzyme prepared from a glucose dehydrogenase mutant expressed by the plasmid.

[0019] The present invention also provides the use of the immobilized enzyme in the regeneration of coenzymes NADH and NADPH in redox reactions.

[0020] The present invention also provides the use of the glucose dehydrogenase mutant in the preparation of an immobilized enzyme, preparing a genetically engineered bacterium containing a gene encoding the glucose dehydrogenase mutant, collecting the bacterial cells of the genetically engineered bacterium after cultivation, crushing the bacterial cells to extract the supernatant, preparing an enzyme freeze-dried powder, and immobilizing it with epoxy resin covalently or COFs to obtain the immobilized enzyme.

[0021] Due to the adoption of the above technical solution, the present invention has the following technical advances compared with the prior art:

[0022] (1) The present invention speculates possible mutation positions based on the protein structure information Sequence ID: 8W0O_A published by NCBI, selects positions for mutation and combines mutations, and unexpectedly obtains mutants with outstanding stability and high enzyme activity, which are suitable for preparing immobilized enzymes. Among them, the core mutations V62G and A197R can greatly improve the stability, and the stability is increased to 224% and 344% of the wild type, respectively. When the amino acid at position 252 is mutated to isoleucine, the enzyme activity can be further improved.

[0023] (2) The glucose dehydrogenase mutant provided by the present invention can be applied to an enzymatic reaction system requiring a coenzyme cycle in the form of an enzyme solution or an immobilized enzyme. The mutant has high enzyme activity and a small input amount, which can reduce the cost of enzyme use. At the same time, the stability can reach more than 6 times that of the wild type, and can be made into an immobilized enzyme with a longer life. After repeating 10 batches, the reaction time did not decrease significantly and stabilized at about 4h, while the wild type decreased significantly, and the reaction required an overnight reaction for about 10 batches to complete. Therefore, the glucose dehydrogenase mutant of the present invention can further reduce the reaction cost and can be compatible with a variety of demanding coupling reactions.

[0024] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The wild type of the present invention and the glucose dehydrogenase mutant GDH in Example 5 TB2 Soluble expression results. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below by specific examples. It should be understood that the described examples are only used to explain the present invention, and are not intended to limit the present invention.

[0027] Unless otherwise specified, the materials and reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0028] The molecular biology experimental operations in the examples, including plasmid construction, culture medium preparation, etc., were mainly performed with reference to Molecular Cloning Experiment Guide (3rd edition), edited by J. Sambrook and DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002).

[0029] In the present invention, the composition of the LB culture medium is 10 g / L of peptone, 5 g / L of yeast powder, and 10 g / L of NaCl.

[0030] Example 1 Glucose dehydrogenase mutant GDH containing V62G mutation site TB0 Genetically engineered bacteria

[0031] This example is a glucose dehydrogenase mutant GDH TB0 The mutant was synthesized after optimizing the codons of E. coli based on the sequence of Sequence ID: WP_003246720.1, modeled and inferred the possible mutation positions based on the protein structure information Sequence ID: 8W0O_A published by NCBI, and then screened after designing primer mutations. Compared with the wild-type glucose dehydrogenase corresponding to the gene sequence SEQ ID NO. 2 of Glucose 1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1, the mutant GDH TB0 The amino acid at position 62 in the amino acid sequence of is mutated from valine in the wild type to glycine.

[0032] Glucose dehydrogenase mutant GDH TB0 The preparation method is as follows:

[0033] (1) Construction of genetically engineered bacteria: Sequentially insert SEQ ID NO.2 between the Nde1 and EcoR1 restriction sites to construct a pET-29aGDH vector, construct a wild-type genetically engineered bacterium, and then design site-directed mutagenesis primers based on SEQ ID NO.2, as shown in Table 1; use primers with sequence numbers SEQ ID NO.4 and SEQ ID NO.5 to perform PCR reaction, transformation, and sequencing to obtain a genetically engineered bacterium containing a glucose dehydrogenase mutant gene with a V62G mutation site, and use the genetically engineered bacterium to express a glucose dehydrogenase mutant GDH TB0 .

[0034] Among them, the template in the PCR system is 1μL, the corresponding upstream and downstream primers are 1μL each, 2xPCRmix 25μL, and water is added to 50μL. The PCR program is 95℃10min; 95℃1min, 55℃30sec, 72℃7min, 15 cycles; 72℃10min. Digest the PCR product in the template 10μL, Dpn11μL, water is added to 50μL; 37℃30min. Take 10μL of bacterial solution to transform and coat the resistance plate, pick a single clone and sequence it, and save the correct genetically engineered bacteria.

[0035] (2) Preparation of enzyme solution and enzyme lyophilized powder of glucose dehydrogenase mutant: Pick a single colony of the correct genetically engineered bacteria from the plate and inoculate it into LB medium with kanamycin added to a kanamycin concentration of 50 mg / L. Culture it in a constant temperature shaker at 37°C and 220 rpm for 6 h. Add IPTG with a final concentration of 0.2 mmol / L and induce it overnight at 25°C. Collect the bacteria by centrifugation at 8500 rpm for 15 min, resuspend it in 1xPBS to 100 g / L, and ultrasonically disrupt it for 2 s. Stop ultrasonication and let it stand for 6 s. Ultrasonicate it again for 20 min. Take out the bacterial solution, centrifuge it at 12000 rpm for 2 min, and collect the supernatant, which is the glucose dehydrogenase mutant GDH. TB0 The enzyme solution was freeze-dried in a small freeze dryer for 48 hours to obtain enzyme freeze-dried powder.

[0036] Table 1 Primer sequences

[0037]

[0038] In addition, except for the specific primers selected in Table 1 for site-directed mutagenesis, wild-type glucose dehydrogenase (without site-directed mutagenesis) and enzyme solutions and enzyme lyophilized powders of various glucose dehydrogenase mutants were prepared according to the above method for subsequent detection experiments.

[0039] Example 2 Glucose dehydrogenase mutant GDH containing A197R mutation site TB1 Genetically engineered bacteria

[0040] This example provides a glucose dehydrogenase mutant GDH TB1 Compared with the wild-type glucose dehydrogenase corresponding to the gene sequence SEQ ID NO.1 of Glucose1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1, the mutant GDH TB1 The amino acid at position 197 in the amino acid sequence of is mutated from alanine in the wild type to arginine.

[0041] The glucose dehydrogenase mutant GDH TB1 The method for preparing the genetically engineered bacteria expressing the mutant is basically the same as that in Example 1, except that the primers used for site-directed mutagenesis are different. The primer sequences used are numbered as SEQ ID NO.6 and SEQ ID NO.7 in Table 1.

[0042] Example 3 Glucose dehydrogenase mutant GDH containing V62G and Q252I mutation sites TB01 Genetically engineered bacteria

[0043] This example provides a glucose dehydrogenase mutant GDH TB01 Compared with the wild-type glucose dehydrogenase corresponding to the gene sequence SEQ ID NO.1 of Glucose1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1, the mutant GDH TB01 The amino acid at position 62 in the amino acid sequence of is mutated from valine in the wild type to glycine, and the amino acid at position 252 is mutated from glutamine in the wild type to isoleucine.

[0044] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacteria expressing the mutant in this example is basically the same as that in Example 1, except that the primers used for site-directed mutagenesis are different. The primers used are the four primers with sequence numbers SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO.9 in Table 1.

[0045] Example 4 Glucose dehydrogenase mutant GDH containing A197R and Q252I mutation sites TB11 Genetically engineered bacteria

[0046] This example provides a glucose dehydrogenase mutant GDH TB11Compared with the wild-type glucose dehydrogenase corresponding to the gene sequence SEQ ID NO.1 of Glucose1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1, the mutant GDH TB11 The amino acid at position 197 in the amino acid sequence of mutated from alanine in the wild type to arginine, and the amino acid at position 252 mutated from glutamine in the wild type to isoleucine.

[0047] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacteria expressing the mutant in this example is basically the same as that in Example 1, except that the primers used for site-directed mutagenesis are different. The primers used are the four primers with sequence numbers SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 in Table 1.

[0048] Example 5 Glucose dehydrogenase mutant GDH containing V62G, A197R and Q252I mutation sites TB2 Genetically engineered bacteria

[0049] This example provides a glucose dehydrogenase mutant GDH TB2 , whose amino acid sequence is as shown in SEQ ID NO.2. Compared with the wild-type glucose dehydrogenase corresponding to the gene sequence SEQ ID NO.1 of Glucose 1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1, the mutant GDH TB2 In the amino acid sequence, the amino acid at position 62 is mutated from valine in the wild type to glycine, the amino acid at position 197 is mutated from alanine in the wild type to arginine, and the amino acid at position 252 is mutated from glutamine in the wild type to isoleucine.

[0050] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacteria expressing the mutant in this embodiment is basically the same as that in Example 1, except that the primers used for site-directed mutagenesis are different. The primers used are the six primers with sequence numbers SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 in Table 1.

[0051] (I) Soluble expression detection experiment

[0052] Identification of wild-type genetically engineered glucose dehydrogenase and the glucose dehydrogenase mutant GDH of Example 5 by SDS-PAGE TB2The expression of glucose dehydrogenase in the precipitate and supernatant of genetically engineered bacteria is shown in the following figure. Figure 1 .

[0053] Figure 1 Lane M is the maker, lane 1 is the protein in the precipitate of wild-type genetically engineered bacteria for glucose dehydrogenase, lane 2 is the protein in the supernatant of wild-type genetically engineered bacteria for glucose dehydrogenase, and lane 3 is the protein in the supernatant of mutant GDH TB2 Proteins in the genetically engineered bacterial precipitate, lane 4 is composed of glucose dehydrogenase mutant GDH TB2 Proteins in the supernatant of genetically engineered bacteria.

[0054] Depend on Figure 1 It can be seen that the mutation of glucose dehydrogenase does not affect its soluble expression.

[0055] (II) Enzyme activity and stability test

[0056] Enzyme activity detection method: At room temperature, take equal amounts of wild-type glucose dehydrogenase and glucose dehydrogenase mutant enzyme solutions of Examples 1 to 5, add 50x-100x PBS to dilute to 100μL, as the enzyme solution to be tested, and use the principle that NADPH has an absorption peak at 340nm to detect the generation of NADPH by spectrophotometry. The total reaction system volume is 3mL, and the reaction system contains: 1.75mLPBS, 1mL120mmol / L D-glucose, 150μL 2mmol / LNADPNa2, and finally add 100μL of the enzyme solution to be tested, and immediately record the OD of the reaction system. 340 Initial value, strictly record OD within 1 minute 340 The changes of OD were recorded for 3 minutes, and the average value was calculated and substituted into the absorbance formula of NADPH molar absorption coefficient to calculate the enzyme activity. The dilution multiple was controlled during the detection process so that OD 340 The change does not exceed 0.7.

[0057] The enzyme activity of 1U is defined as the amount of enzyme required to catalyze the production of 1μmol NADPH per minute under the above conditions.

[0058] Stability test method: During the stability test, equal amounts of enzyme solutions of each group were placed at 50°C for 10 minutes, and then the activity was determined according to the above enzyme activity test method. The specific results are shown in Table 2.

[0059] Table 2 Enzyme activity and stability test results

[0060]

[0061] As shown in Table 2, the enzyme mutant GDH containing the core mutations V62G and A197R TB0 , GDH TB1 The stability of the protein was significantly improved, which was 224% and 344% of the wild type, respectively, indicating that the two mutation forms of V62G and A197R can greatly improve the stability, and A197R also has a certain degree of improvement in activity. The Q252 position is a mutation position that can improve activity to a certain extent that was screened out in the early stage, but not every mutation can significantly improve activity. Only when it mutates to isoleucine can it better cooperate with the effect of the early stability improvement point and further improve activity and stability. The mutant GDH that was finally superimposed TB2 The activity of the enzyme is 265% of that of the wild type, and the stability is 611% of that of the wild type.

[0062] In other detection experiments, similar results were obtained by using lyophilized powder dissolving solution with appropriate dilution and immobilized enzyme instead of preparation solution.

[0063] The above results show that glucose dehydrogenase with three mutations, V62G, A197R and Q252I, can significantly improve the stability of the enzyme to more than 6 times that of the wild type, and the enzyme activity is also significantly improved, making it more suitable for immobilization.

[0064] Example 6 Glucose dehydrogenase mutant GDH TB0 Encoding genes and plasmids

[0065] This example is a coding gene, and its gene sequence is based on SEQ ID NO.1, with a V62G mutation, and the coding gene corresponding to the amino acid sequence of the other sequences unchanged. The plasmid of this example carries the glucose dehydrogenase mutant GDH TB0 coding genes.

[0066] Example 7 Glucose dehydrogenase mutant GDH TB1 Encoding genes and plasmids

[0067] This example is a coding gene, and its gene sequence is based on SEQ ID NO.1, with A197R mutation, and the coding gene corresponding to the amino acid sequence of other sequences unchanged. The plasmid of this example carries the glucose dehydrogenase mutant GDH TB1 coding genes.

[0068] Example 8 Glucose dehydrogenase mutant GDH TB01 Encoding genes and plasmids

[0069] This example is a coding gene, whose gene sequence is based on SEQ ID NO.1, with V62G and Q252I mutations, and the coding gene corresponding to the amino acid sequence of the other sequences unchanged. The plasmid of this example carries the glucose dehydrogenase mutant GDH TB01 coding genes.

[0070] Example 9 Glucose dehydrogenase mutant GDH TB11 Encoding genes and plasmids

[0071] This example is a coding gene, whose gene sequence is based on SEQ ID NO.1, with mutations A197R and Q252I, and the coding gene corresponding to the amino acid sequence of the other sequences unchanged. The plasmid of this example carries the mutant GDH TB11 coding genes.

[0072] Example 10 Glucose dehydrogenase mutant GDH TB2 Encoding genes and plasmids

[0073] This example is a coding gene, whose gene sequence is based on SEQ ID NO.1, with mutations of V62G, A197R and Q252I, and the coding gene corresponding to the amino acid sequence of other sequences unchanged. The plasmid of this example carries the mutant of glucose dehydrogenase GDH TB2 coding genes.

[0074] Example 11 Covalently immobilized enzyme on resin

[0075] Take epoxy resin LX-1000HFA, rinse it with purified water 4 times, and filter it to dryness to complete the epoxy resin pretreatment. Weigh the pretreated epoxy resin and place it in a conical flask, add glucose dehydrogenase mutant GDH TB2 Enzyme solution, add epoxy resin according to the weight ratio of enzyme activity to epoxy resin of 300U:1g, add potassium phosphate buffer with a final concentration of 2mol / LpH=7.3, add purified water to 5mL / g resin, shake on a shaker at 150rpm at 25℃ for 24h. Filter the immobilized resin, wash it with purified water 5 times, and store it at 4℃ to obtain GDH TB2 The resin covalently immobilizes the enzyme.

[0076] Example 12 Enzyme immobilized on COFs

[0077] The COFs material (i.e., immobilized material) prepared with toluenesulfonic acid and sodium bicarbonate was activated with 0.5% glutaraldehyde for 24 h, washed with water three times, and then filtered and dried. 6500 U / g of glucose dehydrogenase mutant GDH was added. TB20.2 g of freeze-dried powder and 1 g of immobilized material were added to a potassium phosphate buffer solution with a final concentration of 0.5 mol / L and pH = 7, and the mixture was shaken at 150 rpm at 25°C for 24 h. The mixture was washed with purified water 4 times and stored at 4°C to obtain GDH. TB2 Enzyme immobilization on COFs.

[0078] In addition to the above embodiments, in other embodiments, the enzyme activity of each mutant enzyme solution (or enzyme lyophilized powder) and the epoxy resin (or immobilization material) are according to any value between 100 and 400 U / g, and resin covalently immobilized enzyme (or COFs immobilized enzyme) is prepared respectively. The enzyme activity is detected, and the enzyme activity range of the obtained resin covalently immobilized enzyme is 200-400 U / g, and the enzyme activity range of the COFs immobilized enzyme is 150-300 U / g, which varies slightly according to different batches.

[0079] Example 13 Application of immobilized enzyme in redox reaction

[0080] This example is the application of the immobilized enzyme in the regeneration of the coenzymes NADH and NADPH in the redox reaction, and the application effect is detected by testing the catalytic performance of the immobilized enzyme.

[0081] The wild-type resin covalently immobilized enzyme, GDH prepared according to the method of Example 11 and Example 12 TB2 Covalent immobilization of enzyme and GDH on resin TB2 There are 3 kinds of immobilized enzymes in COFs, and the total activity is controlled to 150U. The catalytic performance of the immobilized enzymes is tested by the reaction endpoint method. The details are as follows:

[0082] Sufficient amount of liquid ketoreductase is added to establish the following reaction: ketoreductase catalyzes the conversion of ethyl 4-chloroacetoacetate into ethyl S-4-chloro-3-hydroxybutyrate, and glucose dehydrogenase is used for the coenzyme NADPH cycle.

[0083] Add 15 g of ethyl 4-chloroacetoacetate and 21.65 g of glucose into 63 mL of 0.1 mol / L pH 7.0 ethanolamine buffer and 75 ml of butyl acetate, stir and mix, adjust the pH to 7.0 with 2 mol / L sodium carbonate, add 350 mg of ketoreductase, 3 immobilized enzymes and 15 mg of NADPNa2 during stirring, as the pH decreases during the reaction, add sodium carbonate dropwise, and adjust the pH to 7.0 with a pH controller. After the reaction is completed, collect the immobilized enzyme buffer for rinsing and put into the next batch of reactions.

[0084] Gas chromatography detection of S-4 chloro-3-hydroxybutyric acid ethyl ester yield: At the initial stage of the reaction, butyl acetate and the aqueous phase can be separated, and gradually become an emulsion as the reaction proceeds. Samples are taken during stirring, and relatively uniform samples are obtained under the mixing state. Take 100μL of the reaction solution at different time points, add 900μL of butyl acetate, mix well, filter with a 0.45um microporous filter membrane, and perform gas chromatography detection according to the injection volume of 1uL.

[0085] Sampling was performed at intervals of 0.5 h, and the time for the reaction to be completed was calculated based on the results of gas chromatography. The results are shown in Table 3:

[0086] Table 3 Immobilized enzyme stability test

[0087]

[0088] The results showed that the wild-type immobilized enzyme took longer to complete the reaction as the number of reaction batches increased, indicating that the instability of the immobilized enzyme continued to increase, requiring a longer reaction time, affecting the application effect in continuous batch reactions. TB2 The two immobilized enzymes can be stable at 4 h for 10 consecutive batches, and the time for repeating the reaction is shorter, indicating that the reaction efficiency is higher and the immobilized enzymes are stable, and can be reused more than 10 times, reducing costs.

[0089] It should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the scope of protection of the claims of the present invention.

Claims

1. A glucose dehydrogenase mutant, characterized in that: The amino acid sequence is based on the sequence shown in SEQ ID NO. 1, with the 62nd valine and / or the 197th alanine mutated to other amino acids.

2. The glucose dehydrogenase mutant according to claim 1, characterized in that The valine at position 62 is mutated to glycine; and the alanine at position 197 is mutated to arginine.

3. The glucose dehydrogenase mutant according to claim 1 or 2, characterized in that Based on the sequence shown in SEQ ID NO. 1, the glutamine at position 252 is mutated to isoleucine.

4. The glucose dehydrogenase mutant according to claim 3, characterized in that Its amino acid sequence is shown in SEQ ID NO.

3.

5. A coding gene, characterized in that The coding gene encodes a gene of the glucose dehydrogenase mutant according to any one of claims 1 to 3.

6. A plasmid, characterized in that The plasmid carries the coding gene according to claim 5.

7. A genetically engineered bacterium, characterized in that: A plasmid comprising the plasmid as claimed in claim 6, used for expressing a glucose dehydrogenase mutant.

8. An immobilized enzyme, characterized in that The invention relates to a COFs-immobilized enzyme or a resin-immobilized enzyme prepared by the glucose dehydrogenase mutant expressed by the plasmid according to claim 6.

9. Use of the immobilized enzyme according to claim 8 in the regeneration of coenzymes NADH and NADPH in redox reactions.

10. Use of the glucose dehydrogenase mutant according to any one of claims 1 to 4 in preparing an immobilized enzyme, characterized in that: Genetically engineered bacteria containing a gene encoding a glucose dehydrogenase mutant are prepared, the bacterial cells of the genetically engineered bacteria are collected after cultivation, the bacterial cells are broken to extract the recombinant enzyme, and the recombinant enzyme is covalently immobilized with epoxy resin or immobilized with COFs to obtain the immobilized enzyme.

Images