Proximity marker enzyme and application thereof in in-situ proximity marker

Abstract

The invention relates to the field of gene engineering, in particular to a proximity marker enzyme mutant and application thereof. The proximity marker enzyme mutant takes ProtA-Turbo as a starting sequence, and one or more sites in K71, K240, K335, K345 and K351 are mutated into non-polar hydrophobic amino acid, polar neutral amino acid, acidic amino acid, basic amino acid or non-natural amino acid. The proximity marker enzyme mutant overcomes the influence of self biotinylation on the proximity marker activity, can continuously and stably mark the proximity proteome of the target protein on the immobilized cell, and obviously improves the sensitivity of identifying the proximity interacting protein of the target protein.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a proximity labeling enzyme and its application in in-situ proximity labeling. Background Art

[0002] It is proteins that functionally control cellular processes, and protein analysis is necessary to accurately determine the state of cells in disease. Proteins not only play a role on their own, but they also interact with other proteins or molecules that mediate signaling pathways and biological processes. The protein-protein interaction (PPI) network provides a holistic concept for understanding a variety of biological processes. Dysfunction of protein-protein interactions is an important cause of many diseases, and understanding how proteins interact within cells is also a key link in elucidating the mechanisms of disease. Therefore, the development of protein interaction research methods has received increasing attention.

[0003] Proximity labeling is a relatively novel protein interaction research method developed in recent years. This technology is to form a fusion protein with a biotin ligase with promiscuous labeling activity and the target protein, and biotinylate the protein adjacent to the target protein. By enriching the biotinylated protein with streptavidin, the selective separation and identification of the neighboring interaction proteome of the target protein can be achieved. At present, the main proximity labeling methods use biotin-labeled enzymes (BioID) or oxidoreductases (Apex). By forming these tool enzyme probes into fusion proteins with the target protein, the proteome near the target protein can be indiscriminately added with biotin labels. Combined with highly sensitive mass spectrometry detection technology, it provides the most direct neighboring proteome information and is used for protein complex configuration identification, organelle proteome analysis, protein interaction group identification, etc. In recent years, Alice Ting et al. obtained the TurboID tool enzyme by systematically mutating BirA* and proved that TurboID has stronger labeling activity. At present, TurboID has become a hot tool enzyme in the field of proximity labeling.

[0004] Commonly used proximity labeling methods usually require the fusion expression of protein biotin ligase and target gene. In order to change this labeling method, Santos-Barriopedro et al. fused TurboID proximity biotinylation enzyme with protein A and expressed and purified it in Escherichia coli to obtain ProtA-Turbo (protein A-TurboID) fusion protein. After the target cells were fixed with paraformaldehyde and permeabilized, ProtA-Turbo enzyme can target the target protein or specific post-translational modification sites using target protein-specific antibodies. Then, biotin is added to trigger proximity labeling, and proteins adjacent to the target protein or specific post-translational modification sites are biotinylated. The biotinylated proteins can then be enriched from the lysate and identified by mass spectrometry. ProtA-Turbo enzyme is an in situ proximity labeling method, which expands the labeling environment of proximity labeling technology from in vivo to outside the cell. However, the existing in situ proximity labeling method based on ProtA-Turbo enzyme will produce strong non-specific signals during the labeling process, and its labeling activity will be significantly reduced as the labeling time increases. These problems need to be explored and solved. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the object of the present invention is to provide a proximity labeling enzyme mutant and its application in in situ proximity labeling.

[0006] The first aspect of the present invention is to provide a proximity marker enzyme mutant, wherein the proximity marker enzyme mutant uses ProtA-Turbo as the starting sequence, and one or more of K71, K240, K335, K345 and K351 are mutated to non-polar hydrophobic amino acids, polar neutral amino acids, acidic amino acids, basic amino acids or non-natural amino acids. Preferably, the mutation site is K71, K240, K335, K345 or K351. More preferably, the mutation is K71R, K240R, K335R, K345R or K351R.

[0007] In some embodiments of the present invention, the amino acid sequence of the starting sequence is shown as SEQ ID NO:1.

[0008] In some embodiments of the present invention, the amino acid sequence of the proximity marker enzyme mutant is shown in one of SEQ ID NOs: 2-6.

[0009] The second aspect of the present invention is to provide a polynucleotide comprising a polynucleotide encoding the proximity marker enzyme mutant of the first aspect of the present invention.

[0010] The third aspect of the present invention is to provide a vector comprising the polynucleotide described in the second aspect of the present invention. The vector may be a viral vector or a non-viral vector.

[0011] The fourth aspect of the present invention is to provide a host cell comprising the vector described in the third aspect of the present invention.

[0012] The fifth aspect of the present invention is to provide the use of the proximity marker enzyme mutant described in the first aspect of the present invention, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the host cell described in the fourth aspect in detecting protein interactions.

[0013] The sixth aspect of the present invention is to provide the use of the proximity labeling enzyme mutant described in the first aspect of the present invention, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the host cell described in the fourth aspect in in situ proximity labeling.

[0014] Beneficial effects of the present invention:

[0015] In the existing in situ proximity labeling technology, during the in vitro cell labeling process, as the labeling time increases, the labeling activity of the proximity labeling enzyme ProtA-Turbo gradually loses. If the ProtA-Turbo enzyme is pre-biotinylated, it completely loses its labeling activity.

[0016] The proximity labeling enzyme mutants constructed by the present invention, especially the ProtA-Turbo-K71R mutant, not only have stronger labeling activity, but also the labeling activity will not be lost as the labeling proceeds, and even if it is completely biotinylated in advance, it still has good labeling activity. The proximity labeling enzyme mutants of the present invention overcome the influence of self-biotinylation on its proximity labeling activity, and can continuously and stably label the proximity protein group of the target protein on the fixed cells, significantly improving the sensitivity of identifying the proximity interacting proteins of the target protein.

[0017] Sequence listing of the present invention:

[0018]

[0019] BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Coomassie blue staining of ProtA-Turbo protein after expression and purification.

[0021] Figure 2The biotin signal detection diagram after the ProtA-Turbo protein is self-biotinylated. The left picture shows the result of biotin labeling detected by streptavidin-HRP, and the right picture shows the result of biotin labeling detected by Ponceau S.

[0022] Figure 3 Schematic diagram of the self-biotinylation sites of ProtA-Turbo protein identified by mass spectrometry. The sites marked with red K are the sites where ProtA-Turbo protein can undergo self-biotinylation.

[0023] Figure 4 Results of detection of proximity labeling activity of ProtA-Turbo protein mutants.

[0024] Figure 5 Results of detection of proximity labeling activity of biotin-ProtA-Turbo protein mutant after self-biotinylation. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content recorded in the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the present invention equally.

[0026] Example 1 Expression and purification of ProtA-Turbo protein

[0027] 1. Protein amplification and induced expression

[0028] The plasmid containing the nucleotide sequence encoding the ProtA-Turbo protein (amino acid sequence as shown in SEQ ID NO: 1) was transformed into BL21 for culture, and a single clone was picked and amplified, and then preserved in glycerol. A portion of the bacterial solution was transferred to 1.5LLB medium (ampicillin resistance) and incubated at 37°C for about 4 hours, and the OD was measured. 600 It can be induced when the concentration is between 0.8 and 1.0. Take 1 mL of bacterial solution as a control before induction. Add IPTG for induction at 1:1000 and shake at 18℃ and 200rpm overnight. Before protein extraction, measure the OD before and after induction. 600Value, use OD value to add PBS to adjust the concentration of bacterial solution to ensure the same amount of sample loading. Prepare protein sample, add 5× loading buffer, mix well; heat at 100℃ for 10min and run gel to verify whether the protein is successfully induced. Transfer the bacterial solution to a centrifuge tube, centrifuge at 8000rpm for 10min, resuspend with 5mL PBS at 4℃; transfer to a centrifuge tube, freeze at -80℃; add IPTG with a final concentration of 100μg / mL, shake overnight at 16℃, 180rpm for 16h. Centrifuge at 10000g for 1min to collect the bacterial solution, discard the supernatant and freeze.

[0029] 2. Protein Purification

[0030] Resuspend the cells with 20mL 10mM imidazole, add 100μM PMSF, 100μM DNase and 100μM lysozyme to a final concentration, place on ice for 30 minutes, then sonicate for 10 minutes (sonicate for 10s, stop for 10s). Centrifuge at 4℃, 15000g for 10min. The expression product is in the supernatant, collect the supernatant into a 50mL centrifuge tube. Balance the nickel column with 30-40mL 10mM imidazole at a drop rate of 1 drop / s. Add the supernatant of the expression product to the nickel column and pass it through the column at a drop rate of 1 drop / s. Pass the sample at least twice. Wash the impurities with 30-40mL 10mM imidazole at a drop rate of 1 drop / s. Elute with 6-8mL 250mM imidazole, elute twice. Desalt the eluted protein solution by dialysis or PD-10. Then quantify the protein concentration by Bradford method. Add 0.1% sodium azide and 50% glycerol, and store in aliquots at -80°C.

[0031] 3. Coomassie Brilliant Blue Staining

[0032] Dissolve the protein in protein loading buffer, boil and denature it, then add it to the gel well for SDS-PAGE electrophoresis. Run the electrophoresis at 110V for 1 hour until the front end of the loading buffer approaches the edge of the SDS-PAGE gel. After the electrophoresis, take the SDS-PAGE gel and put it into an appropriate amount of Coomassie Brilliant Blue staining solution until the staining solution covers the gel. Place it on a horizontal shaker at room temperature and shake it slowly for more than 1 hour to stain. After staining, add an appropriate amount of Coomassie Brilliant Blue staining destaining solution to ensure that the destaining solution can fully cover the gel. Place it on a horizontal shaker at room temperature for destaining for more than 24 hours. Change the destaining solution every 8 hours until the gel is nearly transparent. After destaining, take a picture of the gel for later use. The results are as follows: Figure 1 As shown, the size of the final ProtA-Turbo protein obtained was 40 kDa.

[0033] Example 2 Mass spectrometry identification of ProtA-Turbo protein self-biotinylation sites

[0034] 1μg of ProtA-Turbo protein was placed in a reaction buffer (100μM ATP, 10mM biotin, 10mM MgCl2, pH=7.4) and reacted at 37℃ for 0h, 30min, 1h, 2h, 4h and 16h. After the reaction, one-fifth volume of SDS denaturation buffer was added and boiled at 100℃ for 5min. After cooling, the biotin labeling effect was detected by WB and streptavidin-HRP. The results after successful labeling are shown in Figure 2. Figure 2 As shown, it can be seen that the ProtA-Turbo protein has a significant biotin signal.

[0035] Then perform in-gel digestion mass spectrometry sample preparation. First, place the gel after SDS-PAGE electrophoresis in a glass dish, cut off the band, then cut the gel band into small pieces, and add distilled water to rinse twice. Add an appropriate amount of decolorizing solution, place it in a 37°C constant temperature incubator, and decolorize until it is colorless or very light in color. Aspirate the decolorizing solution, add an appropriate amount of acetonitrile to rinse, aspirate the acetonitrile, then add acetonitrile, place it for 10 minutes, aspirate the acetonitrile, and use a vacuum centrifugal concentrator to dehydrate the gel block to dry it. Acetonitrile can remove the water inside the gel particles and dry the gel particles. Add 25mM dithiothreitol solution to the dried gel block, place it at 55°C, and incubate it for 45 minutes. Dithiothreitol opens the disulfide bonds, allowing trypsin to fully hydrolyze. After this step is completed, the next step of iodoacetamide operation must be carried out immediately, otherwise the disulfide bond may be formed again. Add an appropriate amount of acetonitrile to rinse, then dry, add acetonitrile again, 10 minutes, absorb the acetonitrile, and use a vacuum centrifugal concentrator to dehydrate the gel block. Add an appropriate amount of 55mM iodoacetamide solution and react for 30 minutes in the dark. Rinse with acetonitrile, then soak in acetonitrile for 10 minutes, and use a vacuum centrifugal concentrator to dehydrate the gel block. Add an appropriate amount of trypsin to cover the gel particles, invert in a 37℃ constant temperature box, and incubate for 12-16 hours. Use 1μL of 10% trifluoroacetic acid solution to terminate the enzymatic reaction, centrifuge at a low speed to separate the gel particles and the solution, aspirate the solution, and collect it in a new centrifuge tube. Add an appropriate amount of extraction solution (50% acetonitrile, 0.1% formic acid) to the gel particles, place at 37℃ for incubation for 30 minutes, and take the supernatant and combine it with the previous supernatant. Repeat the extraction step twice. After concentrating the supernatant in a vacuum centrifugal concentrator, add 20 μL of 0.1% formic acid solution to dissolve it. Vortex and mix well, then centrifuge, repeat twice. Add the peptide solution to the mass spectrometer loading bottle and store at 4°C for mass spectrometer analysis. The results are shown in Figure 3 As shown, a total of 12 lysine sites (marked with red K) were identified in the ProtA-Turbo protein, namely: K6, K9, K37, K52, K56, K71, K107, K236, K240, K335, K345 and K351. These sites are the sites where the ProtA-Turbo protein can undergo self-biotinylation.

[0036] Example 3 Point mutation of ProtA-Turbo self-biotinylation site

[0037] Design a pair of forward and reverse primers with a length of 30-40bp. Center the mutated base and add 12-20bp sequences on both sides. If the primers on both sides are too short, the mutation experiment may fail. The primers must have at least 11-12 basepairs to match the template. After the primers are synthesized, perform a normal PCR amplification reaction. After the reaction is completed, mix the two reaction systems and add an appropriate amount of high-fidelity polymerase (such as Q5), and then continue the reaction for 16 cycles using the above reaction program. Add 1μL DpnI enzyme and 4μL 10*NEB cutsmart buffer to the obtained PCR product to digest the template plasmid (the principle is that DpnI enzyme only digests methylated DNA) and place at 37℃ for 1h (or 2-3h to ensure clean processing). Take 5ul to run the gel to see if there are bands, and take the remaining part for bacterial transformation and plate. After 12h, pick 3-5 clones for sequencing. After obtaining the correct mutant sequence, the plasmid was expressed, purified and identified for in situ labeling activity according to the aforementioned steps.

[0038] Primer sequence list:

[0039] Primer name Sequence composition K71R-f GCGGAGGTGGCTCTGTCGACCGCGACAATACTGTGCCTCTGAA K71R-r TTCAGAGGCACAGTATTGTCGCGGTCGACAGAGCCACCTCCGC K240R-f GAGCAGACAAGGTGCGAGTCCGCTGGCCCAATGACCTGTATCT K240R-r AGATACAGGTCATTGGGCCAGCGGACTCGCACCTTGTCTGCTC K335R-f CATATCTGCCACGGTGGGAGCGCCTGGATAACTTCATCAATAG K335R-r CTATTGATGAAGTTATCCAGGCGCTCCCACCGTGGCAGATATG K345R-f ACTTCATCAATAGACCCGTGCGCCTGATCATTGGGGACAAAGA K345R-r TCTTTGTCCCCAAATGATCAGGCGCACGGGTCTATTGATGAAGT K351R-f TGAAGCTGATCATTGGGGACCGCGAGATTTTCGGGATTAGCCG K351R-r CGGCTAATCCCGAAAATCTCGCGGTCCCCCAATGATCAGCTTCA

[0040] For in situ labeling activity identification, cells were cultured in 60 mm culture dishes. When the cell density was above 80%, the cells were taken out and placed on ice. Washed three times with 2 mL of 4°C pre-cooled PBS solution. PBS was removed, fixed with 4% PFA for 15 min, and washed twice with PBS. 0.3% Triton x-100 was treated for 10 min, and washed twice with PBS. 3% BSA (containing 0.3% Triton x-100, PBS) was blocked for 30 min. Antibody dilution was prepared with blocking solution, 1 μg antibody per well, and incubated at room temperature for 1 h. Washed twice with PBS. 1 μg ProtA-Turbo protein mutant was added to each well (protein / antibody molar ratio ≈ 1:1), incubated at room temperature for 1 h, and washed twice with PBS. Biotin Buffer (5 μM biotin, 5 mM MgCl2, 1 mM ATP, adjusted to pH 7.5 with 1 M NaOH) was added, reacted at 37°C for 30 min, and washed twice with TBST. Cells were collected, RIPA lysis buffer was added, cells were collected, and incubated overnight at 4°C. Add SDS at a final concentration of 1% and boil at 99℃ for 1h until the precipitate is completely dissolved. Quantify the protein concentration by BCA and adjust to a consistent level. Take an equal amount of total protein and add 5× loading buffer to each sample and boil at 99℃ for 5min to denature. WB and HRP-streptavidin are used to detect the proximity labeling effect.

[0041] We selected 5 sites from the 10 biotinylated lysines on ProtA-Turbo that are most likely to affect its structure or protein activity, and mutated the sites to study whether the biotinylation of these lysine sites affected the labeling activity of ProtA-Turbo. We mutated K71, K240, K335, K345 and K351 to R, respectively, and constructed and expressed the K71R, K240R, K335R, K345R and K351R mutant proteins of ProtA-Turbo. We used anti-TUBB to verify the in vitro in situ proximity labeling activity of the K71R, K240R, K335R, K345R and K351R mutant proteins of ProtA-Turbo on H1975 cells. The results are shown in Figure 4 As shown, the five mutants all have good proximity labeling activity on H1975 cells, just like the wild-type ProtA-Turbo. Among them, the proximity labeling ability of the three mutants K71R, K335R and K345R is significantly improved compared with the wild-type ProtA-Turbo.

[0042] Next, we tested whether K71R, K240R, K335R, K345R, and K351R could affect the sustained labeling ability of ProtA-Turbo after self-biotinylation. In vitro proximity labeling experiments were also performed on H1975 cells using anti-TUBB. Figure 5 As shown, after self-biotinylation, the K71R mutant has a significantly improved continuous proximity labeling ability compared to the wild-type ProtA-Turbo, indicating that the biotinylation of the K71 site is essential for the activity of ProtA-Turbo, and mutating it can greatly improve the continuous biotinylation activity of ProtA-Turbo after self-biotinylation.

[0043] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A proximity marker enzyme mutant, characterized in that: The proximity labeling enzyme mutant uses ProtA-Turbo as the starting sequence, and mutates one or more sites among K71, K240, K335, K345 and K351 to non-polar hydrophobic amino acids, polar neutral amino acids, acidic amino acids, basic amino acids or non-natural amino acids.

2. The proximity marker enzyme mutant according to claim 1, characterized in that: The mutation is K71R, K240R, K335R, K345R or K351R mutation.

3. The proximity marker enzyme mutant according to claim 1, characterized in that: The amino acid sequence of the starting sequence is shown in SEQ ID NO:

1.

4. The proximity marker enzyme mutant according to claim 1, characterized in that: The amino acid sequence of the proximity labeling enzyme mutant is shown in one of SEQ ID NOs: 2-6.

5. A polynucleotide, characterized in that The polynucleotide comprises a polynucleotide encoding the proximity marker enzyme mutant according to any one of claims 1-4.

6. A carrier, characterized in that The vector comprises the polynucleotide of claim 5.

7. A host cell, characterized in that The host cell comprises the vector of claim 6.

8. Use of the mutant according to any one of claims 1 to 4, or the polynucleotide according to claim 5, or the vector according to claim 6, or the host cell according to claim 7 in detecting protein interactions.

9. Use of the mutant according to any one of claims 1 to 4, or the polynucleotide according to claim 5, or the vector according to claim 6, or the host cell according to claim 7 in in situ proximity labeling.

Images