A solvent-tolerant transaminase mutant, genetically engineered bacteria, and their use in preparing remegipam intermediates

Abstract

The present invention relates to the field of engineered enzymes, and more particularly to a solvent-tolerant transaminase mutant, a genetically engineered bacterium, and its application in the preparation of a remedipam intermediate. The present invention provides an ω-transaminase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO.2 to single-site or multi-site combined mutations at positions 22, 398, and 419. The ω-transaminase mutant provided by the present invention has high conversion rates, organic solvent tolerance, and product stereoselectivity for the preparation of a remedipam intermediate. Compared with the prior art, it has good industrial application prospects and is low in cost, which is conducive to wide application.

Description

Technical Field

[0001] The present invention relates to the field of engineered enzymes, and in particular to a solvent-tolerant transaminase mutant, a genetically engineered bacterium, and applications in the preparation of a remedipam intermediate. Background Art

[0002] Chiral amines are building blocks of many important bioactive molecules and key intermediates in the synthesis of many chiral drugs. Currently, three main methods are available for the synthesis of chiral amines: chemical, bioresolvation, and bioasymmetric synthesis. Chemical methods suffer from long reaction pathways and harsh conditions, the use of toxic transition metal catalysts, low stereoselectivity, and low yields. Bioresolvation, on the other hand, offers a theoretical maximum yield of only 50%, and both methods present limitations in scale-up. Transaminase-catalyzed bioasymmetric synthesis of chiral amines has attracted increasing attention due to its advantages, including high selectivity, high conversion, mild reaction conditions, and environmental friendliness. It has become a widely used method for preparing chiral amines. However, most wild-type transaminases have a limited substrate range, making it difficult to synthesize sterically hindered chiral amines.

[0003] Rimegepant is a small molecule calcitonin gene-related peptide (CGRP) receptor antagonist specifically indicated for the acute treatment and prevention of migraine. Its mechanism of action is to block the activity of CGRP, thereby alleviating migraine symptoms. Rimegepant was first launched in the United States in 2020 and was approved in China in 2024, becoming the first drug indicated for both acute and preventive treatment. The currently accepted theory of migraine pathophysiology posits that dysfunction of the central nervous system (particularly the trigeminal ganglion) is the root cause of the disease. Stimulation of the trigeminal ganglion triggers activation of trigeminal afferent nerves, which project to the spinal cord and various pain-sensing synapses within and outside the skull. The pain signal is then further transmitted via secondary ascending neurons to the brainstem, hypothalamic, and thalamic nuclei, and from there to several cortical areas, including auditory and visual areas. The trigeminal ganglion amplifies and maintains migraines by activating perivascular fibers and releasing molecules involved in pain production (CGRP). CGRP levels are acutely elevated during migraine attacks and return to normal after treatment with triptans. Intravenous infusion of CGRP has been shown to trigger migraine-like headaches in patients with migraine. In addition to its vasodilatory properties, CGRP appears to be a pro-nociceptive factor that modulates neuronal excitability to promote pain responses. Remgipam is an antagonist of CGRP receptors, competing with CGRP for occupancy of these receptors, blocking the effects of CGRP and its ability to amplify and maintain migraine pain, ultimately relieving the headache.

[0004] In recent years, chemoenzymatic methods have gradually become the preferred method for synthesizing chiral pharmaceutical chemicals and their intermediates due to their high selectivity and environmental optimization advantages. ω-aminotransferase is a key enzyme in the production of remedipam. Many ω-aminotransferase genes have been cloned, and some have been expressed in different hosts (such as Escherichia coli and Pichia pastoris), resulting in genetically engineered bacteria with high enzyme activity and selectivity. Despite this, reports on natural ω-aminotransferases with R-selective transamination are rare. These ω-aminotransferases catalyze a narrow substrate spectrum and are often selected as optimal biocatalysts for specific reactions, which greatly limits their application.

[0005] Chinese patents CN116083385A, CN114875006A, CN113817699A, CN108048419A, CN112980899A, CN112980810A, CN112094830A, CN110592042A, and CN108384767A disclose rational evolution strategies based on an ω-transaminase, resulting in enzyme variants with catalytic activity toward large, sterically hindered chiral amines, improving the stability of the transaminase under extreme conditions. This strategy further promotes the immobilization and continuous application of the transaminase, improving production efficiency. However, the problem remains that the conversion rate is relatively low. Summary of the Invention

[0006] The present invention aims to overcome the problems of low catalytic activity, low thermal stability, and narrow substrate spectrum of transaminases, as well as low production efficiency and expensive catalysts in existing engineered transaminase technologies for synthesizing remdelin or chiral amino intermediates thereof. The present invention provides a solvent-tolerant transaminase mutant, a genetically engineered bacterium, and its use in the preparation of remdelin intermediates.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0008] In a first aspect, the present invention first provides an ω-transaminase mutant, which is obtained by performing single-site or multi-site combined mutations at positions 22, 398, and 419 of the amino acid sequence shown in SEQ ID NO.2.

[0009] ω-aminotransferases are the only enzyme in the transaminase family that can transfer amino groups at positions other than the α-position of an amino acid. ω-aminotransferases are ubiquitous in animals, plants, and microorganisms, with relatively high levels in animal tissues such as the myocardium, brain, liver, and kidney. ω-aminotransferases catalyze regio- and stereoselective transamination reactions of substrates such as aliphatic and aromatic keto acids, aldehydes, ketones, and ketoses. This reaction is of great significance for the synthesis of chiral amines, amino acids, and their derivatives.

[0010] Preferably, the ω-aminotransferase mutant is a mutant in which the amino acid sequence shown in SEQ ID NO. 2 is mutated into one of the following: (1) the phenylalanine at position 22 is mutated into leucine; (2) the phenylalanine at position 22 is mutated into leucine, and the glycine at position 398 is mutated into alanine; (3) the phenylalanine at position 22 is mutated into leucine, the glycine at position 398 is mutated into alanine, and the glycine at position 419 is mutated into threonine.

[0011] In a second aspect, the present invention provides a gene encoding an ω-transaminase mutant.

[0012] The mutation of phenylalanine at position 22 to leucine is F22L, with an amino acid sequence as shown in SEQ ID No. 4 and a nucleotide sequence as shown in SEQ ID NO. 3; the mutation of phenylalanine at position 22 to leucine and glycine at position 398 to alanine is F22L / G398A, with an amino acid sequence as shown in SEQ ID No. 6 and a nucleotide sequence as shown in SEQ ID NO. 5; the mutation of phenylalanine at position 22 to leucine, glycine at position 398 to alanine, and glycine at position 419 to threonine is F22L / G398A / G419T, with an amino acid sequence as shown in SEQ ID No. 8 and a nucleotide sequence as shown in SEQ ID NO. 7.

[0013] The ω-aminotransferase of the present invention (amino acid sequence shown in SEQ ID No. 2) is derived from Chromobacterium violaceum and can also be isolated from a transformant expressing the protein recombinantly or synthesized artificially. The identity between two amino acid sequences or two nucleotide sequences can be determined using algorithms commonly used in the art, preferably using NCBI Blastp and Blastn software using default parameters.

[0014] The amino acid sequences derived from the amino acid sequences shown in SEQ ID No. 4, SEQ ID No. 6, and SEQ ID No. 8 of the present invention, which have been substituted, deleted, or added with one or more amino acid residues and have transaminase activity, and proteins with at least 95% identity, all fall within the scope of protection of the present invention.

[0015] Due to the degeneracy of nucleotide codons, the polynucleotide sequence encoding the amino acid sequence of SEQ ID No.4, SEQ ID No.6, and SEQ ID No.8 is not limited to SEQ ID No.3, SEQ ID No.5, and SEQ ID No.7, but may also be any other nucleic acid sequence encoding the amino acid sequence shown in SEQ ID No.4, SEQ ID No.6, and SEQ ID No.8 in the sequence listing.

[0016] In a third aspect, the present invention provides a recombinant vector encoding a gene.

[0017] The recombinant vector of the present invention uses pET-28a(+) as the basic plasmid.

[0018] In a fourth aspect, the present invention provides a genetically engineered bacterium encoding a gene.

[0019] The genetically engineered bacteria of the present invention use Escherichia coli BL21 (DE3) as the host bacteria.

[0020] In a fifth aspect, the present invention provides a use of the ω-aminotransferase mutant in the preparation of a Remigipam intermediate from a Remigipam intermediate precursor ketone catalyzed by microorganisms.

[0021] Preferably, the method uses wet cells obtained from recombinant genetically engineered bacteria containing a gene encoding a mutant ω-transaminase or a pure enzyme solution extracted by ultrasonic crushing of wet cells as a catalyst, and a buffer solution as a reaction medium to form a reaction system for a biocatalytic reaction; after the reaction is completed, the reaction solution is separated and purified to obtain (5S, 6S, 9R)-5-amino-6-(2,3-difluorophenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-9-ol dihydrochloride; the remegipam intermediate precursor ketone refers to (6S, 9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-5-one.

[0022] The invention uses a precursor ketone, an intermediate of remegpam, as a substrate, dimethyl sulfoxide (methanol) as a cosolvent, pyridoxal phosphate (PLP) as a coenzyme, isopropylamine hydrochloride as a cosubstrate, and a pH 9.0 buffer as a reaction medium to form a reaction system, and performs a biocatalytic reaction at 45° C.-55° C. and 800 rpm-1200 rpm.

[0023] The wet bacterial cell dosage of the present invention is 100 g / L, and the pure enzyme solution dosage is 200-300 g / L based on protein content. When the final substrate concentration is 10 g / L, the final methanol volume concentration is 10-30%, pyridoxal phosphate is 0.25-2 g / L, and isopropylamine hydrochloride is 82.59 g / L. When the final substrate concentration is 10 g / L, the final methanol volume concentration is 10-30%, pyridoxal phosphate is 0.25-2 g / L, and isopropylamine hydrochloride is 412.96 g / L.

[0024] Preferably, the wet cells are prepared as follows: a recombinant genetically engineered bacterium containing a gene encoding a mutant ω-aminotransferase is inoculated into an LB liquid culture medium containing kanamycin for culture, and then inoculated into a fresh kanamycin-resistant LB liquid culture medium for culture. After induction of the culture by adding IPTG, the supernatant is discarded by centrifugation, and the precipitate is collected to obtain the wet cells.

[0025] The method for culturing the recombinant genetically engineered bacteria of the present invention is as follows: inoculating into LB liquid medium containing 50 μg / ml kanamycin, culturing at 35-39°C, 150 rpm-250 rpm for 11-13 hours. After the genetically engineered bacteria are obtained by culturing, inoculating into fresh LB liquid medium containing 50 μg / ml kanamycin resistance at an inoculum concentration of 1%-3% by volume, culturing at 35-39°C, 100 rpm-200 rpm until the bacterial OD reaches 0. 600 When the pH value reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mM, induce and culture at 26°C-30°C for 10h-14h, centrifuge at 4°C, 7000rpm-9000rpm for 10min, discard the supernatant, collect the precipitate, and obtain the wet bacteria.

[0026] Preferably, the pure enzyme solution is prepared as follows: the wet cells are resuspended with binding buffer, broken in an ice bath, centrifuged to remove impurities, then eluted with buffer and collected the target protein, dialyzed with sodium phosphate buffer, and the intercepted liquid is collected as the pure enzyme solution.

[0027] The buffer of the present invention is a 50mM sodium phosphate buffer with a pH of 7.0-9.0, containing 250mM-350mM NaCl. Ultrasonic disruption is performed in an ice bath at 300W for 10 minutes, with a 1s operation and a 3s pause. The supernatant is centrifuged at 11000-13000rpm for 10 minutes. The supernatant is incubated with a Ni affinity chromatography resin equilibrated with the binding solution, then rinsed with a wash buffer until substantially free of contaminants, followed by elution with an elution buffer. After electrophoresis to determine purity, the target proteins are combined and dialyzed with a dialysis buffer. After 48 hours of dialysis, the intercepted liquid is collected to obtain the pure enzyme solution.

[0028] Preferably, the catalyst includes wet cells of recombinant genetically engineered bacteria of ω-aminotransferase and its mutants, crude enzyme solution, crude enzyme powder, and pure enzyme solution.

[0029] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0030] (1) The ω-aminotransferase mutant provided by the present invention has high conversion rate, organic solvent tolerance and product stereoselectivity for the preparation of remedipam intermediates, and has good industrial application prospects compared with the existing technology.

[0031] (2) The application of the ω-aminotransferase mutant of the present invention in the preparation of the Remigipam intermediate from the Remigipam intermediate precursor ketone catalyzed by microorganisms has low cost and is conducive to wide application. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the reaction formula for synthesizing the intermediate of Remigipam.

[0033] Figure 2 Schematic diagram of the conversion rate of ω-transaminase mutants at a substrate concentration of 2 g / L.

[0034] Figure 3 Schematic diagram of the conversion rate of ω-transaminase mutants at a substrate concentration of 10 g / L. DETAILED DESCRIPTION

[0035] The present invention will be further described below with reference to specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below generally represent only a portion of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0036] Example 1: Amplification of the wild-type ω-aminotransferase gene WT

[0037] According to the ω-aminotransferase gene sequence information from Chromobacterium violaceum included in Genbank, RNA from Chromobacterium violaceum was extracted using the SPIN Kit, and DNA was obtained by reverse transcription. This DNA was used as a template for PCR amplification using primers 1 and 2.

[0038] Primer 1: ATGCAGAAACAGCGTACCTGTAGC;

[0039] Primer 2: TTAGTGGTGGTGGTGATGGTGT.

[0040] PCR reaction system (total volume 50 μL): 25 μL of 10× Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 (both at a concentration of 50 μM), 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase, and 20 μL of ddH2O.

[0041] A BioRad PCR instrument was used, and the PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0042] The results showed that the nucleotide sequence amplified by primers 1 and 2 was 1399 bp in length, which was the wild-type ω-transaminase gene, denoted as WT gene, and its nucleotide sequence was shown in SEQ ID NO.1. The amino acid sequence of the encoded protein was shown in SEQ ID NO.2, which encoded a complete open reading frame.

[0043] Example 2: Construction of wild-type recombinant expression vector pET-28a-WT

[0044] Primers 3 and 4 were designed according to the WT gene sequence in Example 1. The WT gene sequence was obtained using the recombinant plasmid pET28a-WT as a template under the action of high-fidelity polymerase Phanta Max Super-FIDelity DNA Polymerase. The amplified fragment was treated with Buffer, and the WT gene (nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) was connected to the plasmid vector pET-28a (Invitrogen) by one-step cloning to obtain the recombinant expression vector pET-28a-WT.

[0045] Primer 3: AGAAGGAGATATACCATGCAGAAACAGCG;

[0046] Primer 4: TTCTGCATGGTATATCTCCTTCTTAAAGTTAAA.

[0047] Example 3: Construction of wild-type recombinant Escherichia coli BL21 / pET28a-WT

[0048] The recombinant expression vector pET28a-WT constructed in Example 2 was transformed into Escherichia coli BL21 (DE3) (Invitrogen) (42°C, 90s), spread on an LB plate containing 50μg / ml kanamycin resistance, and cultured at 37°C for 12h. Clones were randomly picked to extract plasmids for sequencing identification, and wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT was screened and obtained. Example 4: Induced expression of wild-type recombinant Escherichia coli BL21 / pET28a-WT The wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT obtained in Example 3 was inoculated into LB liquid culture medium containing 50μg / ml kanamycin resistance, cultured at 37°C, 200rpm for 12h, and then inoculated into fresh LB liquid culture medium containing 50μg / ml kanamycin resistance at a 1% (v / v) inoculum amount, and cultured at 37°C, 150rpm until the bacterial OD 600 When the pH reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mM and induce the culture at 28°C for 12 hours. Centrifuge at 8000 rpm at 4°C for 10 minutes, discard the supernatant, and collect the precipitate to obtain the wild-type recombinant E. coli BL21 / pET28a-WT wet cells. This cell can be used directly as a biocatalyst or for protein purification.

[0049] Example 5: Preparation of wild-type ω-aminotransferase-WT pure enzyme solution

[0050] The wet cells obtained in Example 4 were resuspended in binding buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl), ultrasonically disrupted (under ice bath conditions, 220 W for 20 min, working for 1 s and pausing for 2 s), and centrifuged at 12000 rpm for 10 min; the supernatant was incubated with Ni affinity chromatography resin equilibrated with the above binding buffer, and then washed with wash buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 50 mM imidazole) until substantially free of impurities, and then eluted with elution buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 500 mM imidazole) and the target protein was collected. After electrophoresis to identify the purity, the target proteins were combined and dialyzed with dialysis buffer (50 mM, pH 8.0 sodium phosphate buffer) for 48 h (dialysis bag molecular cutoff 33 kDa). The intercepted liquid was collected, i.e., the wild-type ω-aminotransferase (WT) pure enzyme solution. The protein content was determined by the Coomassie Brilliant Blue method. The enzyme solution was diluted with 50 mM, pH 8.0 sodium phosphate buffer to a final concentration of 0.5 mg / mL, aliquoted, and frozen at -80°C.

[0051] Example 6: Construction of ω-transaminase mutant library

[0052] Based on the wild-type ω-aminotransferase gene sequence from Chromobacterium violaceum included in GenBank (amino acid sequence shown in SEQ ID NO. 2, nucleotide sequence shown in SEQ ID NO. 1), site-directed mutagenesis primers were designed. Using rapid PCR technology and the recombinant vector pET-28a-WT as a template, single mutations were introduced at positions 22, 398, and 419. The primers were:

[0053] F22L-F: TGCATCCGTTAACCGACACCG;

[0054] F22L-R: GGATGCAGATGGTGAGCAGCA.

[0055] G398A-F: CTTCGCCGAAATCGGTAGCCT;

[0056] G398A-R: CCGATTTCGGCGAAGTCTGGA.

[0057] G419T-F: CATCTGTACCGATCACATCGTAGCG;

[0058] G419T-R: TGGTGCCGCTACGATGTGATC.

[0059] PCR reaction system (total reaction system is 50 μL): 1× Phanta max Buffer 25 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, Phanta Max Super-FIDelity DNA Polymerase 1 μL, 1 μL each of upstream and downstream primers with a concentration of 50 μM, recombinant vector pET-28a-WT 1 μL, ddH2O 20 μL.

[0060] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 6 min 40 s, for a total of 30 cycles, and final extension at 72°C for 10 min.

[0061] 10 μL of PCR product was transferred into competent cells containing 100 μL of Escherichia coli BL21 (DE3), heat-shocked in a 42°C water bath for 90 s, and immediately placed on ice for 3 min. 600 μL of LB liquid culture medium was added to the tube and cultured in a 37°C incubator at 180 rpm for 1 h. The cultured bacterial liquid was centrifuged at 12000 rpm for 1 min, 600 μL of supernatant was discarded, and the remaining 100 μL of bacterial liquid was thoroughly mixed and applied to an LB plate containing 50 μg / ml kanamycin resistance. After inverted culture at 37°C for 14-16 h, a monoclonal strain was picked and sent to Hangzhou Qingke Sequencing Company for sequence detection. The sequencing results were analyzed using software.

[0062] Example 7: Determination of conversion rate of ω-transaminase mutants at 2 g / L substrate concentration

[0063] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT of Example 3 and the monoclonal strain verified by sequencing of Example 6 were used as catalysts by preparing wet cells according to the method of Example 4.

[0064] The final concentration of the reaction system per ml is as follows: 10 g / L enzyme catalyst, pH 9.0 isopropylamine hydrochloride buffer, 2 g / L of the intermediate precursor ketone (6S,9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, a final methanol concentration of 20% (v / v), 1 g / L pyridoxal phosphate, and 82.59 g / L isopropylamine hydrochloride.

[0065] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0066] The HPLC detection conditions are as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 1.

[0067] Table 1 Conversion rate of the synthesis of remedipam intermediates catalyzed by wild-type transaminase WT and its mutants

[0068] recombinant bacteria mutation site Conversion rate BL21 / pET-28a-WT WT 53.2％ BL21 / pET-28a-MUT1 F22L 57.34％ BL21 / pET-28a-MUT2 G398A 78.09％ BL21 / pET-28a-MUT3 G419T 61.89％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 95.47％

[0069] Example 8: Determination of the conversion rate of ω-transaminase mutants at a substrate concentration of 10 g / L

[0070] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT of Example 3 and the monoclonal strain verified by sequencing of Example 6 were used as catalysts by preparing wet cells according to the method of Example 4.

[0071] The final concentration of the reaction system per ml is as follows: 10 g / L enzyme catalyst, pH 9.0 isopropylamine hydrochloride buffer, 10 g / L of the intermediate precursor ketone (6S,9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, a final methanol concentration of 20% (v / v), 1 g / L pyridoxal phosphate, and 412.96 g / L isopropylamine hydrochloride.

[0072] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0073] The HPLC detection conditions were as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 2.

[0074] Table 2 Conversion rate of the synthesis of remedipam intermediates catalyzed by wild-type transaminase WT and its mutants

[0075] recombinant bacteria mutation site Conversion rate BL21 / pET-28a-WT WT 22.14％ BL21 / pET-28a-MUT1 F22L 35.69％ BL21 / pET-28a-MUT2 G398A 48.35％ BL21 / pET-28a-MUT3 G419T 37.43％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 83.76％

[0076] Example 9: Determination of the conversion rate of ω-transaminase mutants at a substrate concentration of 20 g / L

[0077] Catalyst: The wild-type recombinant Escherichia coli BL21 / pET-28a-WT of Example 3 and the monoclonal strain verified by sequencing of Example 6 were used as catalysts by preparing wet cells according to the method of Example 4.

[0078] The final concentration of the reaction system in 1 ml is as follows: 10 g / L enzyme catalyst, pH 9.0 isopropylamine hydrochloride buffer, 20 g / L of the intermediate precursor ketone (6S,9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one as substrate, a final methanol concentration of 40% (v / v), 1 g / L pyridoxal phosphate, and 600 g / L isopropylamine hydrochloride.

[0079] Reaction conditions: temperature 50°C, stirring speed 1000 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC detection of product peak area values, and the conversion rate was calculated based on the product standard curve.

[0080] The HPLC detection conditions were as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 ml / min; detection wavelength: 205 nm; detection temperature: 40°C. Several excellent mutants were obtained from the test results, and the conversion rates of some excellent mutants are shown in Table 2.

[0081] Table 2 Conversion rate of the synthesis of remedipam intermediates catalyzed by wild-type transaminase WT and its mutants

[0082] recombinant bacteria mutation site Conversion rate BL21 / pET-28a-WT WT 18.20％ BL21 / pET-28a-MUT1 F22L 23.45％ BL21 / pET-28a-MUT2 G398A 35.61％ BL21 / pET-28a-MUT3 G419T 41.69％ BL21 / pET-28a-MUT4 F22L / G398A / G419T 78.98％

[0083] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: by evolving transaminases, mutants with improved activity are obtained, and large steric hindrance chiral amines can be synthesized with high conversion rates under high temperature and organic solvent conditions, saving production costs while not requiring the participation of heavy metal catalysts and toxic reagents, thereby realizing green chemistry.

[0084] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A ω-transaminase mutant with improved stability, characterized in that The ω-aminotransferase mutant is a mutant in which the amino acid sequence shown in SEQ ID NO. 2 is mutated into one of the following: (1) the phenylalanine at position 22 is mutated into leucine; (2) the glycine at position 398 is mutated into alanine; (3) the glycine at position 419 is mutated into threonine; (4) the phenylalanine at position 22 is mutated into leucine, the glycine at position 398 is mutated into alanine, and the glycine at position 419 is mutated into threonine.

2. A gene encoding the ω-aminotransferase mutant according to claim 1.

3. A recombinant vector containing the gene according to claim 2.

4. A genetically engineered bacterium containing the gene according to claim 3.

5. Use of the ω-aminotransferase mutant with improved stability according to claim 1 in the preparation of a Remedipam intermediate from a Remedipam intermediate precursor ketone catalyzed by microorganisms.

6. The use according to claim 5, characterized in that The application is as follows: using wet bacteria obtained by fermentation and culture of recombinant genetically engineered bacteria containing a gene encoding a mutant ω-transaminase or pure enzyme liquid extracted by ultrasonic crushing of wet bacteria as a catalyst, preparing a buffer solution as a reaction medium, and conducting a biocatalytic reaction. After the reaction is completed, the reaction liquid is separated and purified to obtain (5S,6S,9R)-5-amino-6-(2,3-difluorophenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-9-ol dihydrochloride; the remegipam intermediate precursor ketone is (6S,9R)-6-(2,3-difluorophenyl)-9-hydroxy-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-5-one.

7. The use according to claim 6, characterized in that The wet cells are prepared as follows: a recombinant genetically engineered bacterium containing a gene encoding an ω-transaminase mutant is inoculated into an LB liquid culture medium containing kanamycin for culture, and then inoculated into a fresh kanamycin-resistant LB liquid culture medium for culture. After IPTG is added for induction culture, the supernatant is discarded by centrifugation, and the precipitate is collected to obtain the wet cells.

8. The use according to claim 6, characterized in that The pure enzyme solution is prepared as follows: the wet cells are resuspended in binding buffer, broken under ice bath conditions, centrifuged to remove impurities, then eluted with buffer and collected the target protein, dialyzed with sodium phosphate buffer, and the intercepted liquid is collected as the pure enzyme solution.

9. The use according to claim 6, characterized in that The catalyst includes wet cells of recombinant genetically engineered bacteria of ω-aminotransferase and its mutants, crude enzyme liquid, crude enzyme powder and pure enzyme liquid.

Images