Nucleoside-producing mutant strain as well as construction and application thereof

Abstract

The invention relates to the technical field of bioengineering and microbial fermentation, in particular to a nucleoside-producing mutant strain as well as construction and application thereof. The invention provides a novel microorganism capable of efficiently producing purine nucleoside through a genetic engineering means on the basis of the found mutant with weakened or inactivated cytidine deaminase function. Starting from the genome level of bacillus subtilis or bacillus amyloliquefaciens, the cdd gene in the uridine synthesis route is weakened through the metabolic engineering technology, and the nucleoside production capacity of recombinant bacteria is improved.

Description

Technical Field

[0001] The invention relates to the field of bioengineering and microbial fermentation technology, and in particular to a nucleoside-producing mutant strain and the construction and application thereof. Background Art

[0002] Nucleoside is a general term for a class of glycosides. Nucleoside is a component of nucleic acid and nucleotide. Nucleoside is formed by the condensation of D-ribose or DZ-deoxyribose with pyrimidine base or purine base. Nucleoside is generally a colorless crystal, insoluble in common organic solvents, easily soluble in hot water, with a melting point of 160-240°C. Nucleosides generated from D-ribose are called ribonucleosides and participate in the composition of RNA. Nucleosides generated from D-α-deoxyribose are called deoxyribonucleosides and participate in the composition of DNA.

[0003] D-ribose condenses with adenine, guanine, cytosine, thymine or uracil to form the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside and uracil ribonucleoside, which are respectively abbreviated as adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uridine (U).

[0004] Guanosine (guanosine) and inosine (inosine) play a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as food flavor enhancers, and are widely used in condiments such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for a variety of antiviral drugs, such as acyclovir, triazole nucleoside, and sodium guanosine triphosphate, which all require guanosine as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for the synthesis of adenosine (AMP) and guanylate (GMP), which is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons. In addition, it can also treat central retinitis and optic atrophy.

[0005] Adenosine is adenine nucleoside, and its chemical name is 6-amino-9-β-D-ribofuranosyl-9-hydrogen purine. It is the product of adenine nucleotide dephosphorylation and is an important nucleotide derivative. Adenosine is an endogenous nucleoside that is found throughout human cells. It can directly enter the myocardium and generate adenosine acid through phosphorylation, and participate in myocardial energy metabolism. It also participates in dilating coronary vessels and increasing blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. In addition to being used as a specific drug for treating the heart, adenosine is also an important intermediate for the synthesis of adenosine triphosphate (ATP), adenine, adenosine acid, and adenosine arabinoside, and is widely used in the pharmaceutical and other industries.

[0006] At present, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus. In the process of selecting and transforming the growing strains, ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding are used to selectively select high-yielding strains of nucleosides; or according to the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are deeply understood, and the strains are purposefully transformed through metabolic engineering methods to obtain production strains with excellent traits and high nucleoside production. However, the fermentation performance of nucleoside strains is still poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. Summary of the invention

[0007] The present invention provides a construction of a nucleoside-producing mutant strain and its application in the field of high nucleoside production.

[0008] In a first aspect, the present invention provides a cytidine deaminase mutant, wherein position 62 of the cytidine deaminase amino acid sequence is mutated from A to V; or position 1 of the cytidine deaminase nucleotide sequence is mutated from A to G or T; or positions 6-122 of the cytidine deaminase mutant amino acid sequence are deleted, or positions 1-127 of the cytidine deaminase mutant amino acid sequence are deleted.

[0009] The present invention weakens or inactivates cytidine deaminase (encoded by the cdd gene) in the metabolic pathway, reduces or cuts off the degradation of cytidine into uridine, thereby inhibiting the synthesis of uridine, promoting microorganisms to efficiently and quickly generate guanine nucleoside, adenine nucleotides or inosine nucleoside, and successfully creates new microorganisms that can efficiently produce nucleosides.

[0010] The amino acid sequence of the cytidine deaminase mutant provided by the present invention is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14 or SEQ ID NO.16.

[0011] Specifically, the amino acid sequence of the Bacillus subtilis cytidine deaminase mutant is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8.

[0012] The reference sequence number of the wild-type cytidine deaminase of Bacillus subtilis at NCBI is NP_390408.1.

[0013] The amino acid sequence of the Bacillus amyloliquefaciens cytidine deaminase mutant is shown in SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14 or SEQ ID NO.16.

[0014] The reference sequence number of the wild-type cytidine deaminase from Bacillus amyloliquefaciens at NCBI is WP_013352920.1.

[0015] In a second aspect, the present invention provides a gene encoding the above-mentioned cytidine deaminase mutant.

[0016] The gene encoding the above-mentioned cytidine deaminase mutant provided by the present invention is amplified by a primer combination;

[0017] The nucleotide sequence of the primer combination includes: SEQ ID NO.17 and SEQ ID NO.20, and also includes: SEQ ID NO.18-19, SEQ ID NO.21-22, SEQ ID NO.23-24 or SEQ ID NO.25-26;

[0018] Or the nucleotide sequence of the primer combination includes: SEQ ID NO.27 and SEQ ID NO.30, and also includes: SEQ ID NO.28-29, SEQ ID NO.31-32, SEQ ID NO.33-34 or SEQ ID NO.35-36.

[0019] The nucleotide sequences of the genes encoding the above-mentioned cytidine deaminase mutants provided by the present invention are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, and SEQ ID NO.15.

[0020] Specifically, the genomic DNA of Bacillus subtilis was used as a template and the primer combination shown in SEQ ID NO.17-20 was used to amplify the mutant cytidine deaminase gene as shown in SEQ ID NO.1, and the amino acid sequence of the mutant was shown in SEQ ID NO.2.

[0021] Using the genomic DNA of Bacillus subtilis as a template, using the primer combinations shown in SEQ ID NO.17, SEQ ID NO.20 and SEQ ID NO.21-22; or SEQ ID NO.17, SEQ ID NO.20, and SEQ ID NO.23-24; or SEQ ID NO.17, SEQ ID NO.20 and SEQ ID NO.25-26, the cytidine deaminase mutant genes obtained by amplification are shown in SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7, and the mutant amino acid sequences are shown in SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.8.

[0022] Preferably, the Bacillus subtilis is B. subtilis A5 which has been disclosed in CN110257315B.

[0023] The cytidine deaminase mutant gene obtained by using the genomic DNA of Bacillus amyloliquefaciens as a template and the primer combination shown in SEQ ID NO.27-30 is shown in SEQ ID NO.9, and the amino acid sequence of the mutant is shown in SEQ ID NO.10.

[0024] Using the genomic DNA of Bacillus amyloliquefaciens as a template, using primers as shown in SEQ ID NO.27, SEQ ID NO.30 and SEQ ID NO.31-32; or using primers as shown in SEQ ID NO.27, SEQ ID NO.30 and SEQ ID NO.33-34; or using primer combinations as shown in SEQ ID NO.27, SEQ ID NO.30 and SEQ ID NO.35-36, the obtained cytidine deaminase mutant genes are shown in SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, and the mutant amino acid sequence is shown in SEQ ID NO.12, SEQ ID NO.14 or SEQ ID NO.16.

[0025] Preferably, the Bacillus amyloliquefaciens is B.a836 which has been disclosed in CN112574934A.

[0026] In a third aspect, the present invention provides a primer combination, wherein the nucleotide sequence of the primer combination includes: SEQ ID NO.17 and SEQ ID NO.20, and further includes: SEQ ID NO.18-19, SEQ ID NO.21-22, SEQ ID NO.23-24 or SEQ ID NO.25-26;

[0027] Or the nucleotide sequence of the primer combination includes: SEQ ID NO.27 and SEQ ID NO.30, and also includes: SEQ ID NO.28-29, SEQ ID NO.31-32, SEQ ID NO.33-34 or SEQ ID NO.35-36.

[0028] As described above, the primer combination provided by the present invention can be used to amplify a cytidine deaminase mutant gene, and further obtain a cytidine deaminase mutant.

[0029] In a fourth aspect, the present invention provides a recombinant bacterium, in which the wild-type cytidine deaminase gene is replaced by the gene encoding the cytidine deaminase mutant.

[0030] In the recombinant bacteria provided by the present invention, the starting strain of the recombinant bacteria is a nucleoside-producing strain, preferably, the starting strain is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

[0031] The present invention uses Bacillus subtilis and Bacillus amyloliquefaciens (wild-type strain, genetically engineered production bacteria) of different genetic backgrounds as starting strains to construct the above-mentioned modified microorganisms, and after verification, the cytidine deaminase encoding gene of these starting strains is replaced by the encoding gene of the cytidine deaminase mutant, and the nucleoside production of the strain is significantly improved. It can be seen that the lifting effect of the cytidine deaminase mutant for the nucleoside production capacity of the strain does not depend on other genetic modifications contained by the above-mentioned strains, and these genetic modifications are only to make the strain have certain nucleoside production capacity. Therefore, the lifting effect of the cytidine deaminase mutant for the nucleoside production capacity of microorganisms has universality for the starting strain that can synthesize and accumulate nucleosides.

[0032] Therefore, those skilled in the art can understand that introducing the cytidine deaminase mutant into other nucleoside-producing strains can effectively promote the production of nucleosides.

[0033] In the recombinant bacteria provided by the present invention, the above primer combination is used with the DNA of the starting strain as a template to amplify the cytidine deaminase mutant gene, the cytidine deaminase mutant gene is constructed into a recombinant plasmid, and the recombinant plasmid is transformed into the starting strain to obtain the recombinant bacteria.

[0034] In a fifth aspect, the present invention also provides the use of the above-mentioned cytidine deaminase mutant or the above-mentioned gene or the above-mentioned primer combination or the above-mentioned recombinant bacteria in increasing the production of nucleosides.

[0035] The nucleoside described in the present invention is inosine, guanosine, adenosine or the corresponding nucleoside derivatives, such as hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid.

[0036] The beneficial effects of the present invention are:

[0037] The present invention provides a mutant with all or part of the cytidine deaminase function lost, which achieves the weakening or inactivation of the cytidine deaminase, reduces or cuts off the degradation of cytidine into uridine, thereby inhibiting the synthesis of uridine and promoting the efficient and high-speed generation of guanine nucleoside, adenine nucleotide or inosine nucleoside by microorganisms.

[0038] Specifically, by subjecting the cdd gene in the microbial strain to point mutation, weakening its start codon, and / or inactivating the gene, the nucleoside production capacity of the recombinant strain obtained is improved to varying degrees. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0041] The DNA polymerase, DNA purification kit, restriction endonuclease, DNA ligase and other molecular biological reagents used in the present invention were purchased from Beijing Quanshijin Company (http: / / www.https: / / www.transgen.com / ), and other biochemical reagents used were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0042] The names and sequences of the primers used in the examples are shown in Table 1.

[0043] Table 1 Primer names and sequence information used in the examples of the present invention Primer name

[0044] Primer sequences cdd-1f Aaaataaggatcctctagaaaagtccccaagtttatgcttag SEQ ID NO.17 cdd A62V-1r cgctttatttaaagTtgtttctgaaggg SEQ ID NO.18 cdd A62V-2f cccttcagaaacaActttaaataaagcg SEQ ID NO.19 cdd-2r Ttgcatgcctgcagtttctagctgtacacggatttctgc SEQ ID NO.20 cdd-gtg-1r aatgtacacGtgaacagacaagaatta SEQ ID NO.21 cdd-gtg-2f taattcttgtctgttcaCgtgtacatt SEQ ID NO.22 cdd-ttg-1r aggaatgtacacTtgaacagacaagaa SEQ ID NO.23 cdd-ttg-2f ttcttgtctgttcaAgtgtacattcct SEQ ID NO.24 △cdd-1r gacaagaaggcgcattttca SEQ ID NO.25 △cdd-2f Tgaaaatgcgccttcttgtc SEQ ID NO.26 DSM7 cdd-1f Ggatcctctagatggatcttatcaattttgtttacgatcag SEQ ID NO.27 DSM7 cdd A62V-1r ttcaaagTtgtttccgaggggg SEQ ID NO.28 DSM7 cdd A62V-2f ccccctcggaaacaActttgaa SEQ ID NO.29 DSM7 cdd-2r Gcatgcctgcagatctggaaaacggcgcgttc SEQ ID NO.30 DSM7 cdd-gtg-1r ggaataagtacacGtgaacagacaaga SEQ ID NO.31 DSM7 cdd-gtg-2f tcttgtctgttcaCgtgtacttattcc SEQ ID NO.32 DSM7 cdd-ttg-1r gaggaataagtacacTtgaacagacaag SEQ ID NO.33 DSM7 cdd-ttg-2f cttgtctgttcaAgtgtacttattcctc SEQ ID NO.34 DSM7△cdd-1r Aagtacacggaggatttacatgac SEQ ID NO.35 DSM7△cdd-2f Gtcatgtaaatcctccgtgtactt SEQ ID NO.36

[0045] Example 1 cdd in Bacillus subtilis A62V Point mutation strain construction

[0046] The genome of the adenosine production strain B. subtilis A5 (strain B. subtilis A5, see CN110257315B) constructed in the laboratory was used as a template, and the cdd-1f / cdd-A62V-1r and cdd-A62V-2f / cdd-2r primer pairs were used to amplify the upstream and downstream homologous arms of the cdd gene using pfu high-fidelity DNA polymerase. The obtained fragments were gel-recovered and fused, and the cddA62V full-length fragment was amplified and gel-recovered (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2).

[0047] The pKSU plasmid (pKSU plasmid was kindly donated by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B.amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production [J], Applied Microbiology and Biotechnology, 2014, 98 (21): 8963-8973. Zhang W, Gao W, Feng J, et al DOI: 10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and recovered by gel. The linearized plasmid and cdd after digestion were assembled using an assembly kit. A62V The fragments were assembled and transformed into TransT1 competent medium, and then identified and screened to obtain the recombinant plasmid pKSU-cddA62V.

[0048] The recombinant plasmid pKSU-cddA62V was transformed into Bacillus subtilis 168 (wild bacteria) and B. subtilis A5 strains, and the transformants were screened at 30°C using an LB plate containing 2.5 μg / mL chloramphenicol. The obtained transformants were inoculated into 5 ml LB liquid culture medium, cultured at 42°C and 200 rpm for 12 h and propagated for one generation, and diluted and coated on an LB plate containing 5 μg / mL chloramphenicol to obtain a primary recombinant; the primary recombinant was inoculated into 5 ml LB liquid culture medium, cultured at 42°C and 200 rpm for 12 h and propagated for one generation, and diluted and coated on an LB plate containing 0.8 μM 5-FU to screen a secondary recombinant, and cddA62V was screened. A62V The point mutation strains were named B. subtilis A116 and B. subtilis A117.

[0049] Example 2 cdd in Bacillus subtilis A1G Construction of strains with weakened start codons

[0050] Using the B. subtilis A5 genome as a template, the cdd-1f / cdd-gtg-1r and cdd-gtg-2f / cdd-2r primer pairs (SEQ ID NO.17, SEQ ID NO.21, SEQ ID NO.20, SEQ ID NO.22) were amplified using pfu high-fidelity DNA polymerase to obtain the cdd A1G The upstream and downstream homologous arms of the gene. The obtained fragments were recovered by gel and fused, and cdd was obtained by amplification. A1GThe full-length fragment was recovered by gel recovery (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4), and the recombinant plasmid pKSU-cddA1G was constructed according to the construction method in Example 1, and the recombinant plasmid pKSU-cddA1G was transformed into Bacillus subtilis 168 (wild bacteria) and B. subtilis A5 strains, and the obtained strains were named B. subtilis A118 and B. subtilis A119, respectively.

[0051] Example 3 cdd in Bacillus subtilis A1T Construction of strains with weakened start codons

[0052] Using the B. subtilis A5 genome as a template, the cdd-1f / cdd-ttg-1r, cdd-ttg-2f / cdd-2r primer pairs and pfu high-fidelity DNA polymerase were used to amplify the cdd A1T The upstream and downstream homologous arms of the gene. The obtained fragments were recovered by gel and fused, and cdd was obtained by amplification. A1T The full-length fragment was gel-recovered (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6), and the plasmid pKSU-cddA1T was constructed according to the construction method in Example 1, and the plasmid pKSU-cddA1T was transformed into Bacillus subtilis 168 (wild bacteria) and B. subtilis A5 strains, and the obtained strains were named B. subtilis A120 and B. subtilis A121, respectively.

[0053] Example 4 Construction of cdd-inactivated strain in Bacillus subtilis

[0054] Using the B.subtilis A5 genome as a template, using cdd-1f / △cdd-1r, △cdd-2f / cdd-2r primer pairs, pfu high-fidelity DNA polymerase amplification to obtain the upstream and downstream homologous arms of the △cdd gene. The obtained fragments were gel-recovered and fused, and the full-length △cdd fragment was amplified and gel-recovered (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO.8). The plasmid pKSU-△cdd was constructed according to the construction method in Example 1, and the plasmid pKSU-△cdd was transformed into Bacillus subtilis 168 (wild bacteria) and B.subtilis A5 strains, and the obtained strains were named B.subtilis A122 and B.subtilis A123, respectively.

[0055] Example 5 cdd in Bacillus amyloliquefaciens A62VPoint mutation strain construction

[0056] To determine whether the above point mutation has the same effect in Bacillus amyloliquefaciens, the mutation was also introduced into Bacillus amyloliquefaciens for verification, using the DSM7 strain genome as a template, using DSM7 cdd-1f / DSM7 cddA62V-1r, DSM7 cdd A62V-2f / DSM7-cdd-2r primer pairs, and pfu high-fidelity DNA polymerase amplification to obtain upstream and downstream homologous arms. The obtained fragments were gel-recovered and fused, and the full-length fragments were amplified and gel-recovered (the nucleotide sequence of the corresponding ORF box is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10). The plasmid pKSU-DSM7-cddA62V was constructed according to the construction method in Example 1, and transformed into guanosine-producing bacteria B.a836 (laboratory construction, disclosed in CN112574934A patent), and the strains obtained by screening were named Ba 8533.

[0057] Example 6 cdd in Bacillus amyloliquefaciens A1G Construction of strains with weakened start codons

[0058] Using the genome of the DSM7 strain as a template, the primer pairs DSM7 cdd-1f / DSM7 cdd-gtg-1r and DSM7 cdd-gtg-2f / DSM7-cdd-2r were used to amplify the full-length fragment (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12). The plasmid pKSU-DSM7-cddA1G was constructed according to the construction method in Example 1 and transformed into the guanosine-producing bacterium B.a836. The obtained strain was named Ba 8534.

[0059] Example 7 cdd in Bacillus amyloliquefaciens A1T Construction of strains with weakened start codons

[0060] Using the DSM7 strain genome as a template, the DSM7 cdd-1f / DSM7 cdd-ttg-1r and DSM7 cdd-ttg-2f / DSM7-cdd-2r primer pairs were used to amplify the full-length fragment (the nucleotide sequence of the corresponding ORF box is shown in SEQ ID NO.13, and the amino acid sequence is shown in SEQ ID NO.14). The plasmid pKSU-DSM7cddA1T was constructed according to the construction method in Example 1 and transformed into the guanosine-producing bacteria B.a836. The obtained strain was named Ba 8535.

[0061] Example 8 Construction of cdd-inactivated strain in Bacillus amyloliquefaciens

[0062] Using the genome of the DSM7 strain as a template, the primer pairs DSM7 cdd-1f / DSM7△cdd-1r and DSM7△cdd-2f / DSM7-cdd-2r were used to amplify the full-length fragment (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO.15, and the amino acid sequence is shown in SEQ ID NO.16). The plasmid pKSU-DSM7△cdd was constructed according to the construction method in Example 1 and transformed into the guanosine-producing bacterium B.a836. The obtained strain was named Ba 8536.

[0063] Example 9 Real-time quantitative fluorescence PCR verification of cdd expression levels in each engineered strain

[0064] In this example, all the engineered bacteria with cdd gene mutations constructed in Examples 1-8 and the control strains B.subtilis 168, B.subtilis A5 (the control strain corresponding to the mutant strain of Bacillus subtilis) and B.a836 (the control strain corresponding to the mutant strain of Bacillus amyloliquefaciens) were cultured in LB medium until the logarithmic growth phase, 1 mL of the bacterial solution was treated with an appropriate amount of lysozyme, and the total RNA was extracted for reverse transcription, and the real-time quantitative PCR reaction was performed using cDNA as a template. Reaction conditions: 95°C pre-denaturation for 10 min; 95°C for 15 s, 55°C for 1 min, and 40 cycles. After the reaction, the transcription level of the relevant gene was calculated according to the 2-ΔΔCT method using bacterial 16S rRNA as a reference. The results are shown in Table 2.

[0065] Table 2. Transcription level of strains

[0066] Strain number Mutation type Transcription level (relative value) Reduction ratio% Wild mushroom B.subtilis 168 1 - B. subtilis A116 <![CDATA[cdd A62V ]]> 0.69 31％ B. subtilis A118 <![CDATA[cdd A1G ]]> 0.38 62％ B. subtilis A120 <![CDATA[cdd A1T ]]> 0.19 81％ B. subtilis A122 △cdd 0 100％ Adenosine-producing bacteria B. subtilis A5 1 - B. subtilis A117 <![CDATA[cdd A62V ]]> 0.75 25％ B. subtilis A119 <![CDATA[cdd A1G ]]> 0.49 51％ B. subtilis A121 <![CDATA[cdd A1T ]]> 0.26 74％ B. subtilis A123 △cdd 0 100％ Guanosine-producing bacteria B.a836 1 - Ba 8533 <![CDATA[cdd A62V ]]> 0.86 12％ Ba 8534 <![CDATA[cdd A1G ]]> 0.54 46％ Ba 8535 <![CDATA[cdd A1T ]]> 0.35 65％ Ba 8536 △cdd 0 100％

[0067] As can be seen from the table, the transcription levels of the modified bacteria are reduced to varying degrees compared with the starting strains, indicating that the above-mentioned point mutations have achieved the effect of weakening the gene transcription level.

[0068] Example 10 Verification of the nucleoside production performance of mutant strains

[0069] In this example, the nucleoside production performance of all the engineered bacteria with cdd gene mutations constructed in Examples 1-8 and the control strains B. subtilis 168, B. subtilis A5 (control strain corresponding to the mutant strain of Bacillus subtilis) and B. a836 (control strain corresponding to the mutant strain of Bacillus amyloliquefaciens) was verified, and the steps were as follows:

[0070] 1. Culture the bacteria stored in glycerol at 37°C overnight.

[0071] 2. Pick a single colony and inoculate it into 30 mL of seed culture medium (g / L: glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2, sterilized at 121°C for 20 min), and culture at 37°C, 110 rpm shaking for 7-8 h.

[0072] 3. Transfer the inoculum to 30 mL fermentation medium (g / L: glucose 120, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, sodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0-7.2, sterilize at 121°C for 20 min) at a 10% v / v inoculum amount, shake at 130 rpm, and culture at 35.5°C for 48-72 h (B.a8533-8536 and its control strain B.a836 were fermented for 72 h; B.subtilis A116-123 and its control strains B.subtilis168 and B.subtilis A5 were fermented for 48 h).

[0073] 4. Use liquid chromatography to detect the glycosides produced in the fermentation broth (Table 3).

[0074] Table 3 Evaluation results of mutant strains producing guanosine, inosine and adenosine by shake flask fermentation (mean of three replicates)

[0075] strain Mutation type Guanosine yield (g / L) Inosine production (g / L) Adenosine production (g / L) OD562 Wild mushroom.subtilis168 0.1 0.8 5.1 25.2 B. subtilis A116 <![CDATA[cdd A62V ]]> 0.08 0.66 5.72 24.9 B. subtilis A118 <![CDATA[cdd A1G ]]> 013 0.37 6.35 25.8 B. subtilis A120 <![CDATA[cdd A1T ]]> 0.18 0.28 6.55 25.6 B. subtilis A122 △cdd 0.21 0.56 7.18 24.5 Adenosine-producing bacteria B. subtilis A5 0 1.1 8.9 24.8 B. subtilis A117 <![CDATA[cdd A62V ]]> 0 1.33 9.9 24.3 B. subtilis A119 <![CDATA[cdd A1G ]]> 0 0.93 10.7 24.8 B. subtilis A121 <![CDATA[cdd A1T ]]> 0 1.81 10.5 25.4 B. subtilis A123 △cdd 0 1.26 10.7 23.9 Guanosine-producing bacteria B.a836 3.2 1.5 0 28.5 B.a8533 <![CDATA[cdd A62V ]]> 4.26 1.33 0 28.9 B.a8534 <![CDATA[cdd A1G ]]> 4.33 1.51 0 27.3 B.a8535 <![CDATA[cdd A1T ]]> 4.56 1.66 0 28.6 B.a8536 △cdd 5.11 1.59 0 28.5

[0076] As can be seen from the table above, by mutating the amino acid at position 62 of cdd from A to V, weakening the start codon to varying degrees, or directly inactivating the gene, and introducing it into different starting strains, the corresponding nucleoside production increased to varying degrees. Combined with the transcription level data, it shows that weakening or inactivating this site is effective in improving the nucleoside production capacity of the strain.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A cytidine deaminase mutant, characterized in that The amino acid sequence of the wild-type cytidine deaminase is mutated from A to V at position 62; or the amino acid sequence of the wild-type cytidine deaminase is mutated from A to G or T at position 1; or the amino acid sequence of the wild-type cytidine deaminase mutant is deleted at positions 6-122, or the amino acid sequence of the wild-type cytidine deaminase mutant is deleted at positions 1-127.

2. The cytidine deaminase mutant according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14 or SEQ ID NO.

16.

3. A gene encoding the cytidine deaminase mutant according to claim 1.

4. The gene according to claim 3, characterized in that Amplified by using a primer combination; the nucleotide sequence of the primer combination includes: SEQ ID NO.17 and SEQ ID NO.20, and also includes: SEQ ID NO.18-19, SEQ ID NO.21-22, SEQ ID NO.23-24 or SEQ ID NO.25-26; Or the nucleotide sequence of the primer combination includes: SEQ ID NO.27 and SEQ ID NO.30, and also includes: SEQ ID NO.28-29, SEQ ID NO.31-32, SEQ ID NO.33-34 or SEQ ID NO.35-36.

5. The gene according to any one of claims 3 to 4, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, and SEQ ID NO.

15.

6. A primer combination, characterized in that: The nucleotide sequence of the primer combination includes: SEQ ID NO.17 and SEQ ID NO.20, and also includes: SEQ ID NO.18-19, SEQ ID NO.21-22, SEQ ID NO.23-24 or SEQ ID NO.25-26; Or the nucleotide sequence of the primer combination includes: SEQ ID NO.27 and SEQ ID NO.30, and also includes: SEQ ID NO.28-29, SEQ ID NO.31-32, SEQ ID NO.33-34 or SEQ ID NO.35-36.

7. A recombinant bacterium, characterized in that: In the recombinant bacteria, the gene according to any one of claims 3 to 5 is used as the gene encoding cytidine deaminase.

8. The recombinant bacterium according to claim 7, characterized in that The starting strain of the recombinant bacteria is a nucleoside-producing strain, preferably, the starting strain is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

9. The recombinant bacterium according to any one of claims 7-8, characterized in that The primer combination of claim 6 is used, and the DNA of the starting strain is used as a template to amplify the cytidine deaminase mutant gene, construct a recombinant plasmid with the cytidine deaminase mutant gene, and the recombinant plasmid is transformed into the starting strain to obtain a recombinant bacterium.

10. Use of the cytidine deaminase mutant according to any one of claims 1 to 2, the gene according to any one of claims 3 to 5, the primer combination according to claim 6, or the recombinant bacterium according to any one of claims 7 to 9 in improving nucleoside production.