circascc3 inhibitors and uses thereof

By using circASCC3 inhibitors such as siRNA and shRNA, combined with chemotherapy drugs, targeting circASCC3 can overcome the resistance of cancer cells to genotoxic damage and improve the anti-tumor effect of chemotherapy.

CN119955786BActive Publication Date: 2026-01-27XINXIANG MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510102639.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2026-01-27
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the resistance of cancer cells to genotoxic damage, thus affecting the anti-tumor effects of chemotherapy.

Method used

Provide circASCC3 inhibitors, especially siRNA and shRNA, for targeting circASCC3, in combination with chemotherapy drugs to enhance tumor sensitivity to genomic stress.

Benefits of technology

By targeting circASCC3, the expression of circASCC3 in tumor cells is reduced, thereby enhancing the killing effect of chemotherapy drugs on tumor cells, especially on chemotherapy-resistant tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955786B_ABST
    Figure CN119955786B_ABST
Patent Text Reader

Abstract

The application discloses a circASCC3 inhibitor and application thereof. Specifically, the siRNA of the application can effectively knock out circASCC3, and increase the sensitivity of a tumor to genotoxic stress. The siRNA of the application targeting circASCC3 is combined with a chemotherapeutic drug to effectively improve the killing effect of the chemotherapeutic drug on tumor cells, especially on tumor cells with chemotherapeutic drug resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and biomedicine, specifically, this invention relates to circASCC3 inhibitors and their uses. Background Technology

[0002] Genomic instability is a cause of malignant transformation and cancer progression. Defects in the DNA damage repair system lead to chromosomal alterations and gene mutations. Amplification of oncogenes such as c-MYC results in uncontrolled DNA replication and cell proliferation, which in turn can exacerbate genomic instability. Furthermore, depletion or mutations in DNA repair genes can further disrupt genomic integrity to promote tumorigenesis. However, defects in DNA repair genes can drive apoptosis in chemotherapy-exposed cancer cells because the impaired repair system cannot detect or resolve damaged DNA. For example, while BRCA1 / 2 mutations or homologous recombination defects (HRD) increase cancer susceptibility, these defects can enhance tumor sensitivity to genotoxic therapies such as chemotherapy drugs and PARP inhibitors. Therefore, a robust DNA repair system can prevent cancer development while also protecting cancer cells from genotoxicity and subsequent apoptosis.

[0003] Therefore, those skilled in the art are dedicated to finding drugs and methods that can reduce the resistance of cancer cells to genotoxic damage and improve the anti-tumor effect of chemotherapy. Summary of the Invention

[0004] The purpose of this invention is to provide circASCC3 inhibitors and their use in antitumor therapy.

[0005] In a first aspect, the present invention provides a siRNA targeting circASCC3, said siRNA being selected from the group consisting of:

[0006] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0007] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0008] In another preferred embodiment, the circASCC3 is derived from mammals (including humans).

[0009] A second aspect of the present invention provides a precursor of siRNA (shRNA), said siRNA precursor being the precursor of the siRNA according to claim 1; preferably, the 5' to 3' ends of said siRNA precursor sequentially comprise: a first sequence unit, a stem-loop sequence unit, and a second sequence unit, the first sequence unit and the second sequence unit being complementary such that said siRNA precursor forms a hairpin structure, and the first sequence unit is selected from the group consisting of:

[0010] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0011] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0012] A third aspect of the present invention provides an exosome loaded with the siRNA or its precursor as described in claim 1.

[0013] A fourth aspect of the present invention provides the use of siRNA as described in the first aspect of the present invention, or siRNA precursor as described in the second aspect of the present invention, or exosomes as described in the third aspect of the present invention, for:

[0014] (1) To prepare drugs for the prevention or treatment of tumors;

[0015] (2) Prepare reagents to enhance tumor sensitivity to chemotherapy or reduce tumor resistance to chemotherapy;

[0016] (3) To prepare drugs that inhibit tumors through a p53-dependent mechanism; or

[0017] (4) Prepare drugs that inhibit tumors through a p53-independent mechanism.

[0018] In another preferred embodiment, the tumor is a p53 wild-type tumor or a p53 mutant tumor.

[0019] In another preferred embodiment, the tumor is a chemotherapy-resistant tumor.

[0020] In another preferred embodiment, the tumor is selected from: lung cancer, stomach cancer, liver cancer, kidney tumor, small intestine cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, cervical cancer, ovarian cancer, lymphoma, nasopharyngeal carcinoma, adrenal tumor, bladder tumor, brain cancer, endometrial cancer, testicular cancer, thyroid cancer, or combinations thereof.

[0021] A fifth aspect of the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is siRNA as described in the first aspect of the present invention, or a siRNA precursor as described in the second aspect of the present invention, or an exosome as described in the third aspect of the present invention.

[0022] In another preferred embodiment, the pharmaceutical composition further includes an effective amount of a chemotherapeutic agent.

[0023] In another preferred embodiment, the pharmaceutical composition is used for the prevention or treatment of tumors.

[0024] A sixth aspect of the present invention provides a method for knocking down the expression level of circASCC3 in cells, comprising the steps of: culturing cells in the presence of siRNA as described in the first aspect of the present invention, or siRNA precursor as described in the second aspect of the present invention, or exosomes as described in the third aspect of the present invention, thereby achieving knockdown of the expression level of circASCC3 in cells.

[0025] A seventh aspect of the present invention provides a method for in vitro non-therapeutic inhibition of tumor cells, comprising the steps of: culturing tumor cells in the presence of an inhibitor of circASCC3, thereby inhibiting tumor cells.

[0026] In another preferred embodiment, the inhibition of tumor cells is to inhibit the growth of tumor cells or to inhibit tumor cell tumorigenesis.

[0027] In another preferred embodiment, compared with control tumor cells, the expression of circASCC3 in the tumor cells is reduced by more than 10%, preferably by more than 20%, more preferably by more than 30%, more preferably by more than 40%, more preferably by more than 50%, more preferably by more than 60%, more preferably by more than 70%, more preferably by more than 80%, more preferably by more than 90%, and most preferably by no expression of circASCC3 at all.

[0028] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0029] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0030] Figure 1CircASCC3 is a circular RNA that responds to DNA damage. (A) Heatmap of differentially expressed circRNAs in cancer cells treated with DMSO, Nutlin-3 (10 μM), cisplatin (10 μM), or 5-FU (20 μM). (B) Volcano plot of differentially expressed circRNAs after treatment with all three drugs (Nutlin-3, cisplatin, and 5-FU). (C) Venn diagram of circRNAs based on specified criteria. (D) Sequencing analysis of circASCC3 genomic loci and circASCC3 head-tail splice junctions. Blue arrows represent convergent primers, and yellow arrows represent divergent primers. (E) Amplification of circASCC3 from cDNA in CAL51, MCF7, and RKO cells using divergent primers compared to gDNA. circNSUN2 was used as a positive control, and ACTB as a negative control. (F) CircASCC3 is more stable than ASCC3 and p21 mRNA. RT-qPCR analysis was performed after cells were treated with actinomycin D for a specified time. (G) Compared to ASCC3 and p21 mRNA, CircASCC3 was resistant to RNase R digestion. Cells were treated with RNase R and then analyzed by RT-qPCR. (H) CircASCC3 was mainly located in the cytoplasm. Cell lysates were analyzed by RT-qPCR after cytoplasmic and nuclear RNA separation and assay. ACTB, U1, and circNSUN2 were used as comparative references. **p<0.01,***p<0.001.

[0031] Figure 2p53 transcription induces circASCC3 expression. (AD) Treatment with Nutlin-3 or a DNA damage inducer increased the expression of circASCC3 and ASCC3 mRNA. RT-qPCR analysis was performed on CAL51(A), MCF7(B), HCT116(C), and A549(D) cells after treatment with Nutlin-3 (10 μM), cisplatin (10 μM), or 5-FU (20 μM) for 48 hours. The right panel indicates the relative abundance of circASCC3 by normalization to ASCC3 mRNA. (EG) Knockdown of p53 canceled the increase in circASCC3 and ASCC3 mRNA levels. RT-qPCR analysis was performed on CAL51(E), MCF7(F), and HCT116(G) cells after treatment with the specified drugs for 48 hours and siRNAs for 60 hours. (HK) In p53-negative or mutant cancer cells, circASCC3 and ASCC3 mRNA levels were unaffected by Nutlin-3 (10 μM) or cisplatin (10 μM) treatment, including HCT116 p53- / - (H), H1299 (I), TOV112D (J), and OVCA420 (K) cells. (L,M) In TOV112D (L) and ES-2 (M) cells, p53 knockdown had no effect on circASCC3 expression. (N) Overexpression of wild-type p53, but not some p53 mutants, significantly induced circASCC3 expression. (O) Schematic diagram of potential p53-responsive elements (p53-REs) within the ASCC3 promoter and first intron. (P) ChIP analysis confirmed the binding of p53 to p53-RE-1 and -2. (Q) p53 overexpression triggered luciferase activity driven by the ASCC3 promoter, as analyzed by luciferase reporter gene assay. *p<0.05,**p<0.01,***p<0.001.

[0032] Figure 3SFPQ is involved in p53-mediated upregulation of circASCC3. (A, B) Levels of circASCC3 after knockdown of a series of RNA-binding proteins in CAL51(A) and HCT116(B) cells. RT-qPCR analysis was performed 48 hours after cell transfection with specified siRNAs. (C, D) SFPQ knockdown increased circASCC3 levels but decreased ASCC3 mRNA expression. RT-qPCR analysis was performed 48 hours after transfection of specified siRNAs in CAL51(C) and HCT116(D) cells. The right panel indicates the relative abundance of circASCC3 by normalization to ASCC3 mRNA. (E) Schematic diagram of potential SFPQ binding sites within repeat elements and repeat elements near the flanking regions of circASCC3. (F) RIP analysis to determine SFPQ binding to repeat elements. (G, H) SFPQ mRNA levels decreased after treatment with Nutlin-3 (10 μM) or cisplatin (10 μM). CAL51(G) and HCT116(H) cells were treated with the specified drug for 48 hours before RT-qPCR analysis. (I) Knockdown of p53 increased the level of SFPQ mRNA. Cells were treated with the specified drug for 48 hours and siRNAs for 60 hours before RT-qPCR analysis. *p<0.05,**p<0.01,***p<0.001.

[0033] Figure 4Ectopic circASCC3 promotes tumor resistance to genotoxic stress. (AD) Overexpression of circASCC3 increased the growth of cancer cells exposed to pulsed treatment with DNA damage inducers. CAL51(A), MCF7(B), HCT116(C), and RKO(D) cells were treated with MMS (1 mM), cisplatin (100 μM), or etoposide (80 μM) for 0.5–2 h and transfected with the specified plasmids before cell viability was measured. (EH) Overexpression of circASCC3 reduced apoptosis in cancer cells exposed to pulsed treatment with DNA damage inducers. CAL51(E), MCF7(F), HCT116(G), and RKO(H) cells were exposed to pulsed treatment and transfected with the specified plasmids before flow cytometry analysis. (I,J) Overexpression of circASCC3 reduced the level of lysed PARP in cancer cells exposed to pulsed MMS. CAL51(I) and HCT116(J) cells were treated with MMS and specified plasmids, followed by IB analysis. Overexpression of (K,L)circASCC3 increased the resistance of cancer cells to DNA damage inducers. Cell viability was measured after treatment of CAL51(K) and HCT116(L) cells with different doses of specified drugs. Stable overexpression of (MP)circASCC3 increased the growth rate (M), weight (N), and size (O) of HCT116-derived xenografts. Mouse body weight was unaffected (P). Cisplatin was administered as specified. Data are presented as mean ± SD, n = 7. p-values ​​were determined by a two-tailed unpaired t-test. **p < 0.01, ***p < 0.001.

[0034] Figure 5 Knockout of circASCC3 increased tumor sensitivity to genotoxic stress. (AC) circASCC3 knockout inhibited the growth of cancer cells exposed to pulsed treatment with DNA damage inducers. CAL51(A), MCF7(B), and RKO(C) cells were treated with MMS (1 mM) or etoposide (80 μM) for 0.5–2 h and transfected with specified siRNAs before cell viability was measured. (DG) circASCC3 knockout increased apoptosis in cancer cells exposed to pulsed treatment with DNA damage inducers. CAL51(D,E) and MCF7(F,G) cells were exposed to pulsed treatment and transfected with specified plasmids before flow cytometry analysis. Stable knockout of (HK) circASCC3 reduced the growth rate (H), weight (I), and size (J) of HCT116-derived xenografts. Mouse body weight was unaffected (K). Cisplatin was administered as specified. Data are presented as mean ± SD, n = 7. p-values ​​were determined by a two-tailed unpaired t-test. *1p<0.05, **p<0.01, ***p<0.001.

[0035] Figure 6 CircASCC3 interacts with and stabilizes DDX5. (A) Biotin-labeled RNA probes complementary to the reverse splicing of endogenous circASCC3 were used to identify circASCC3 interacting proteins. (B) Biotin-labeled linear circASCC3 transcripts were used as bait to identify circASCC3 interacting proteins. (C,D) CircASCC3 binds to DDX5 but not to NONO, RUVBL1, or EIF4A3. RIP assays were performed after cells were transfected with plasmids encoding specified circASCC3 or RNA-binding proteins. (EH) Knockout of circASCC3 reduced DDX5 protein levels without affecting DDX5 mRNA expression. IB and RT-qPCR analyses were performed on MCF7 (E,G) and HCT116 (F,H) cells transfected with specified siRNAs. (I,J) The proteasome inhibitor MG132 restored DDX5 protein levels in circASCC3-depleted cells. CAL51(I) and HCT116(J) cells transfected with the specified plasmids were treated with DMSO or MG132 (20 μM) for 8 hours before IB analysis. (K, L) Overexpression of circASCC3 prolonged the half-life of DDX5 protein. MCF7(K) and HCT116(L) cells transfected with the specified plasmids were treated with CHX at different time points before IB analysis. (M, N) Knockout of DDX5 restored circASCC3-mediated cell growth and apoptosis. Cell viability was measured (M) or analyzed by flow cytometry (N) after transfection with the specified plasmids or siRNAs. **p<0.01,***p<0.001.

[0036] Figure 7The p53-circASCC3 axis inhibits R-loop accumulation via DDX5. (A) circASCC3 overexpression reduced R-loop levels at ACTB and RPS23 sites. Cells were treated with cisplatin and transfected with the specified plasmids, followed by DRIP analysis using the S9.6 antibody. (B) circASCC3 knockout increased R-loop levels at ACTB and RPS23 sites. Cells were treated with cisplatin and transfected with the specified siRNAs, followed by DRIP analysis using the S9.6 antibody. RNase H, catalyzing RNA cleavage in RNA / DNA hybridization, served as a negative control. (C) circASCC3 overexpression reduced R-loop levels at JUN and NEAT1 sites. Cells were treated with cisplatin and transfected with the specified plasmids, followed by R-ChIP analysis using the anti-V5 antibody. TSS, transcription start site. (D) circASCC3 knockout increased R-loop levels, while DDX5 overexpression reversed this effect. Cells were treated with or without cisplatin and transfected with designated siRNAs or plasmids, followed by IF staining using the S9.6 antibody. (E) Compared with 15 matched adjacent normal tissues, the expression level of circASCC3 was lower in the 15 colorectal cancer samples. (F,G) In 80 colorectal cancer patients, higher levels of circASCC3 were associated with poorer prognosis. *p<0.05,**p<0.01,***p<0.001.

[0037] Figure 8 Schematic diagram of the role of the .p53-circASCC3 axis in cancer. Detailed Implementation

[0038] Through extensive and in-depth research, the inventors unexpectedly discovered that ectopic circASCC3 promotes cancer cell survival under genotoxic stress both in vitro and in vivo. The siRNA of this invention can effectively knock out circASCC3, increasing the tumor's sensitivity to genotoxic stress. Specifically, circASCC3 triggers chemotherapy resistance by stabilizing DDX5, thereby eliminating the R-loop. Knocking down circASCC3, such as with the circASCC3-targeting siRNA of this invention (SEQ ID NO. 2 and SEQ ID NO. 3), can reduce tumor chemotherapy resistance, thereby improving the anti-tumor effect of chemotherapy drugs. The combined use of the circASCC3-targeting siRNA of this invention with chemotherapy drugs can effectively enhance the killing effect of chemotherapy drugs on tumor cells, especially on chemotherapy-resistant tumors.

[0039] The tumor suppressor p53 is considered a "guardian of the genome" because it prevents tumorigenesis by maintaining genomic integrity. Under moderate genotoxic stress, p53 transcriptionally activates the expression of genes such as p21 and GADD45A to induce cell cycle arrest. Simultaneously, it promotes the repair of damaged DNA by activating numerous repair-related genes. In this way, p53 maintains genomic stability and prevents malignant transformation of cells. In contrast, germline mutations in the TP53 gene lead to increased genomic instability and a familial cancer susceptibility disorder called Li-Fraumeni syndrome. However, recent evidence reveals that p53 can also confer drug resistance in cancer by promoting DNA repair through various mechanisms. For example, p53 induces transcription of the nucleotide excision repair (NER) genes XPC and DDB2 to promote melanoma resistance to chemotherapy drugs. Another p53 target gene, MGMT, encodes O-6-methylguanine-DNA methyltransferase, which promotes the repair of DNA alkylation damage, leading to tumor resistance to alkylating agents. Furthermore, p53 can prevent aberrant chromosomal alterations by activating a long non-coding RNA (lncRNA) called GUARDIN. p53 promotes resistance to genotoxic stress, especially when it is not fully activated. RMRP has been reported to limit the full activation of p53, potentially leading to cell cycle arrest and DNA damage repair, which ultimately triggers tumor resistance to PARP inhibitors.

[0040] R-loops are RNA / DNA hybrid structures formed during transcription, when the RNA strand invades double-stranded DNA. R-loop accumulation due to DNA damage, oncogenic activation, or dysfunction of R-loop removal mechanisms leads to transcription-replication conflict, replication stress, and repair of damaged double-strand breaks. Recently, p53 has been reported to prevent R-loop-related genomic instability by restricting aberrant satellite transcription. Furthermore, elevated R-loop levels resulting from p53 inactivation by E6 viral oncoproteins have been found to be essential for HPV replication and pathogenesis. These studies indicate that p53 plays a crucial but poorly understood role in regulating unplanned R-loop formation.

[0041] In this invention, p53-induced circular RNA circASCC3 was identified as increasing cancer cell survival and growth under DNA damage stress. circASCC3 interacts with the DEAD-box RNA helicase DDX5, leading to the resolution of the R-loop. This invention reveals the important role of circASCC3 in p53-mediated R-loop resolution and genome stability.

[0042] circASCC3 and its inhibitors

[0043] The sequence of circASCC3 in this invention is as follows:

[0044] CTATTTGAACTGCTGGGACCTGAAGGACTTGAACTTATTGAGAAACT

[0045] CCTCCAGAACAATTACATTGTGGATAGATTTCTTAATTCTTCAAATG

[0046] ATCATAGGTTTCAGGCTCTTCAAGACAATTGTAAAAAAATTTTAGGAGAA

[0047] AATGCTAAACCCAATTATGGTTGTCAAGTCACTATTCAGTCTGAACAA

[0048] AAAGCAGTTAAATGAAACAATATCGACGTGAAGAAAAAAAGAATTGCCAGA

[0049] CGAGAAAAAAGGCTGGAGAAGATTTAGAAGTTTCAGAAGGACTTATGT

[0050] GCTTTGATCCTAAGGAATTGCGGATACAAAGGAACAGGCACTTCTGAAT

[0051] GCTAGAAGTGTTCCAATTCTGAGCAGGCAGAGAGATGCAGACGTTGAAA

[0052] AAATACATTATCCCCATGTGTATGATTCCCAGGCTGAAGCCATGAAAAACA

[0053] TCAGCATTTATTGCTGGTGCAAAGATGATTTTGCCAGAAGGAATCCAAAG

[0054] AGAGAATAACAAGCTTTATGAAGAAGTAAGGATTCCCTACAGCGAACCA

[0055] ATGCCACTCAGCTTTGAGGAAAAGCCAGTTTATATCCAAGACTTAGATGA

[0056] G(SEQ ID NO.1)

[0057] As used herein, the term "circASCC3 inhibitor" refers to a substance that inhibits the replication or transcription of circASCC3, or a substance that reduces the level of circASCC3. Inhibitors of circASCC3 include (but are not limited to): siRNA, microRNA, compounds, or combinations thereof. Inhibitors of the circASCC3 gene are preferably siRNA or microRNA.

[0058] As used in this article, the term "RNAi" (RNA interference) refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of RNA with complementary sequences induced by double-stranded RNA (dsRNA). Because RNAi technology can specifically shut down the expression of specific genes, it has been widely used in areas such as gene function research and gene therapy for infectious diseases and tumors.

[0059] In a preferred embodiment of the present invention, the present invention provides an siRNA sequence of circASCC3. As used herein, the term "siRNA" (Small interfering RNA) refers to a small RNA molecule (approximately 21-25 nucleotides) that can be processed from its precursors (such as dsRNA, shRNA, etc.) by Dicer (an enzyme in the RNase III family that is specific for double-stranded RNA), or it can be synthesized chemically or produced by processing other proteins. siRNA is a major member of siRISC, stimulating the rapid cleavage and degradation of target RNA with its complementary sequence, leading to the silencing of the target gene, thus becoming a key functional molecule in RNAi.

[0060] In a preferred embodiment of the present invention, the present invention provides an siRNA precursor having the siRNA sequence of the present invention. As used herein, the term "siRNA precursor" refers to an RNA molecule that can be processed in mammalian cells to produce siRNA, specifically, that is, selectively processed by Dicer or other similar proteins to produce mature siRNA, thereby enabling RNAi.

[0061] In a preferred embodiment of the present invention, a nucleic acid construct is provided. As used herein, the term "construct" refers to a nucleic acid construct comprising the siRNA precursor of the present invention.

[0062] In a preferred embodiment of the present invention, an expression cassette is provided. As used herein, the term "expression cassette" refers to an expression cassette containing the coding sequence of the siRNA precursor of the present invention, as well as a promoter and a termination signal operatively linked to said coding sequence, said expression cassette producing the siRNA precursor of the present invention post-transcriptionally.

[0063] One way to generate small interfering RNA (siRNA) in vivo is to clone the siRNA sequence as part of a short hairpin into a plasmid vector. When introduced into an animal, this hairpin sequence is expressed, forming a double-stranded RNA (shRNA) with a terminal loop structure. This shRNA is then recognized and processed by the Dicer protein in the cell, producing a functional siRNA.

[0064] As used herein, the term "shRNA" refers to a specific type of shRNA constructed using the precursor of human miR-26b as its backbone. The shRNA comprises, from 5′ to 3′, the following: (a) a 5′ flanking sequence region; (b) a 5′ paired siRNA region; (c) a apical loop region; (d) a 3′ paired siRNA region, wherein the 5′ paired siRNA region and the 3′ paired siRNA region form a double-stranded region; and (e) a 3′ flanking sequence region. The shRNA produces siRNA, and the nucleotide sequence of the siRNA corresponds to either the 3′ paired siRNA region or the 5′ paired siRNA region.

[0065] In a broad sense, shRNA is an abbreviation for short hairpin RNA. shRNA consists of two short, inversely complementary sequences separated by a terminal loop sequence, forming a hairpin structure. Transcription is typically controlled by the promoter of endogenous RNA polymerase III, with 5-6 T-termini attached to the end of the shRNA sequence as a transcription terminator for RNA polymerase III. shRNA can also be transcribed from the promoters of other RNA polymerases.

[0066] In a preferred embodiment of the present invention, the siRNA targeting the circASCC3 gene is selected from the following group:

[0067] siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), and

[0068] siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

[0069] Chemotherapy drugs

[0070] Chemotherapy drugs are medications used to treat tumors. They kill tumor cells. These drugs act on different stages of tumor cell growth and reproduction, inhibiting or killing the cells. Chemotherapy is currently one of the main methods for treating tumors.

[0071] In a preferred embodiment of the present invention, the chemotherapeutic drug is a DNA damage inducer, such as Nutlin-3, 5-fluorouracil (5-FU), or cisplatin.

[0072] Pharmaceutical Composition

[0073] The term "pharmaceutical composition" refers to a mixture containing a therapeutically effective amount of one or more of the said compounds and their pharmaceutically acceptable tautomers, solvates, hydrates, or salts, along with other pharmaceutically acceptable carriers. The purpose of preparing the said compounds into a pharmaceutical composition is to facilitate administration to the therapeutic subject.

[0074] According to one aspect of the present invention, a pharmaceutical composition is provided comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA or a precursor thereof of the present invention, or an exosome loaded with the siRNA or a precursor thereof of the present invention.

[0075] According to certain embodiments of the present invention, the pharmaceutical composition comprises a first component and a second component, wherein the first component is the siRNA of the present invention or its precursor, or an exosome loaded with the siRNA of the present invention or its precursor, and the second component is a chemotherapeutic drug.

[0076] According to certain embodiments of the present invention, the molar concentration ratio of the first component and the second component is about 1:5000-100:1, for example 1:4000-10:1, 1:3000-10:1, 1:2000-10:1, 1:1000-10:1, 1:100-10:1, 1:100-10:1, 1:10-10:1, 1:10-10:1.

[0077] According to certain embodiments of the present invention, the pharmaceutical composition is used to treat cancer.

[0078] According to certain embodiments of the present invention, the cancers include prostate cancer, colorectal cancer, lung cancer, and breast cancer.

[0079] According to certain embodiments of the present invention, the total content of the first component and the second component accounts for 1-100% of the pharmaceutical composition, for example, 1-99.5%, 1-99%, 1-90%, 1-80%, 1-70%, 1-60%, 1-50%, 1-40%, 1-30%, 1-20%, 1-10%, 10-100%, 10-99.5%, 10-99%, 10-90%. 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 20-100%, 20-99.5%, 20-99%, 20-90%, 20-80%, 20-70%, 20-60%, 20-50%, 20-40%, 20-30%, 30-100%, 30-99.5%, 30-99% 30-90%, 30-80%, 30-70%, 30-60%, 30-50%, 30-40%, 40-100%, 40-99.5%, 40-99%, 40-90%, 40-80%, 40-70%, 40-60%, 40-50%, 50-100%, 50-99.5%, 50-99%, 50-90%, 50-80%, 50-70%. 50–60%, 60–100%, 60–99.5%, 60–99%, 60–90%, 60–80%, 60–70%, 70–100%, 70–99.5%, 70–99%, 70–80%, 80–100%, 80–99.5%, 80–99%, 80–90%, 90–100%, 90–99.5%, or 90–99%.

[0080] According to certain embodiments of this application, the total content of the first component and the second component accounts for approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 4% of the pharmaceutical composition. 8%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%.

[0081] Synergistic effect: When two or more drugs are used together, if their actions are aligned and they enhance each other, this is called a synergistic effect. The total effect exceeds the sum of the effects of each drug used alone. In other words, the combined effect of two drugs is greater than the efficacy of either drug alone, and greater than the additive effect of the two drugs.

[0082] The term "about" can refer to a value or composition within an acceptable range of error for a particular value or composition as determined by a person skilled in the art, which will depend in part on how the value or composition is measured or determined. In this application, when "about" is used to modify a numerical value, it means that the value can fluctuate within a range of ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1%.

[0083] The term "regulation" includes treatment, prevention, or intervention.

[0084] The term "treatment" refers to the administration of the medicine of this invention to a subject requiring treatment, with the aim of curing, alleviating, improving, reducing, or influencing the disease, symptoms, or predisposition of the subject. Subjects of treatment according to this invention include mice, rabbits, monkeys, humans, and other mammals.

[0085] The term "therapeutic effective amount" refers to the amount of drug that can achieve a therapeutic effect in the body of the treated patient. Those skilled in the art will understand that the "therapeutic effective amount" can vary depending on the route of administration, the excipients used, and the combination with other drugs.

[0086] The pharmaceutical compositions of the present invention comprise the medicament (active ingredient) of the present invention within a safe and effective range, and a pharmacologically acceptable excipient or carrier. "Safe and effective range" means that the amount of the active ingredient is sufficient to significantly improve the condition without causing serious side effects. Typically, the pharmaceutical composition contains 0.001-1000 mg of the active ingredient per dose, preferably 0.05-300 mg of the active ingredient per dose, and more preferably 0.5-200 mg of the active ingredient per dose.

[0087] The active ingredient of this invention and its pharmacologically acceptable salt can be formulated into various preparations containing, within a safe and effective range, the active ingredient of this invention or its pharmacologically acceptable salt, and a pharmacologically acceptable excipient or carrier. "Safe and effective range" refers to an amount of active ingredient sufficient to significantly improve the condition without causing serious side effects. The safe and effective range of the active ingredient is determined based on the age, condition, and course of treatment of the patient.

[0088] "Pharmacologically acceptable excipients or carriers" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmacologically acceptable excipients or carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.).

[0089] When administering the compositions of the present invention, they can be taken orally, rectally, parenterally (intravenously, intramuscularly, or subcutaneously), or topically. They can be prepared into any pharmaceutically permissible dosage form, including but not limited to tablets, oral preparations, granules, injections, liposomes, targeted drug delivery injections, pills, capsules, granules, powders, suppositories, powders, ointments, patches, injection solutions, solutions, suspensions, sprays, lotions, drops, liniments, etc. The pharmaceutical compositions can be prepared as dry powders and mixed with sterile water or buffer solutions to form a solution before administration. The pH of the buffer solution is typically 3-11, preferably 5-9, and more preferably 7-8.

[0090] The compositions of the present invention can be administered alone or in combination with other pharmaceutically acceptable compounds.

[0091] Microcapsules containing the pharmaceutical compositions of the present invention can be used for sustained-release administration of the active ingredients of the present invention. Sustained-release formulations of the active ingredients of the present invention can be prepared from lactide / glycolide polymers (PLGA), which have good biocompatibility and broad biodegradability. The degradation products of PLGA, lactic acid and glycolic acid, are rapidly eliminated by the human body. Moreover, the degradation capacity of this polymer can be extended from several months to several years depending on its molecular weight and composition (Lewis, “Controlled release of bioactive agents from lactide / glycolide polymer,” in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41)).

[0092] When using the pharmaceutical composition, a safe and effective amount of the active ingredient of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the usual dose is 0.01–300 mg, preferably 0.5–100 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skill of a skilled physician.

[0093] According to one aspect of the present invention, the present invention provides a method for preparing the pharmaceutical composition, the method comprising mixing the first component and the second component with a pharmaceutically acceptable excipient.

[0094] The term "excipient" refers to a pharmaceutically acceptable ingredient that does not have any pharmacological activity and is commonly used in pharmaceutical techniques for preparing granular and / or solid oral dosage forms and / or liquid injectable dosage forms. Excipients may act as carriers, diluents, solubilizers, absorption enhancers, stabilizers, or adjuvants in the preparation of pharmaceutical compositions, and other functions. Excipients useful in the preparation of pharmaceutical compositions are generally safe, non-toxic, and acceptable for medical and pharmaceutical use. As used in this specification, "excipient" or "pharmaceutically acceptable excipient" includes one or more such excipients.

[0095] medicine box

[0096] In this application, the terms "pharmacy kit" and "reagent kit" are used interchangeably. This application discloses a pharmaceutical kit containing a therapeutically effective amount of the therapeutic agent or pharmaceutical composition. According to some embodiments of this application, the pharmaceutical kit further contains one or more other therapeutic agents. According to some embodiments of this application, the pharmaceutical kit further includes instructions for use. According to some embodiments of this application, the pharmaceutical kit further includes a device for a corresponding route of administration, such as, but not limited to, a needle.

[0097] According to one aspect of the present invention, a kit is provided comprising the siRNA or its precursor of the present invention, or exosomes loaded with the siRNA or its precursor of the present invention, and a chemotherapy drug.

[0098] Treatment methods

[0099] According to one aspect of the present invention, a method for treating cancer is provided, using the siRNA or its precursor, or exosomes loaded with the siRNA or its precursor, or a pharmaceutical composition of the present invention.

[0100] According to certain embodiments of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the siRNA of the present invention or its precursor, or an exosome loaded with the siRNA of the present invention or its precursor.

[0101] According to certain embodiments of the present invention, the pharmaceutical composition comprises a first component and a second component, wherein the first component is the siRNA of the present invention or its precursor, or an exosome loaded with the siRNA of the present invention or its precursor, and the second component is a chemotherapeutic drug.

[0102] Unless otherwise stated in this application or obviously contradicted by the context, the terms “a,” “an,” “the,” “the,” and “at least one,” and similar designations used in the context of describing this application (including the claims) are to be interpreted to cover both the singular and plural. Unless otherwise stated in this application or obviously contradicted by the context, the terms “comprising,” “having,” “including,” and “containing” used in this application are to be interpreted as open-ended terms (i.e., “including but not limited to”). Unless otherwise stated in this application or obviously contradicted by the context, all methods described in this application may be performed in any suitable order as understood by those skilled in the art.

[0103] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, parts and percentages are by weight.

[0104] Materials and methods

[0105] Plasmids and antibodies: The circular sequence of circASCC3 was cloned into the plasmid pLCDH-GFP-CiR. DDX5, NONO, RUVBL1, and EIF4A3 were cloned into the pcDNA3.1 vector with a Myc tag. The p53 response element (p53-RE) was cloned into the pGL3 vector. The pPyCAG-RNASEH1-D210N and -WKKD plasmids were gifts from Liang Chen's laboratory. The purchased antibodies include anti-Flag (F1804, Sigma-Aldrich), anti-Myc (60003-2-Ig and 16286-1-AP, Proteintech), anti-DDX5 (Cat. No. 67025-1-Ig, Proteintech), anti-α-Tubulin (66031-1-Ig, Proteintech), anti-β-actin (Cat. No. 66009-1-Ig, Proteintech), anti-Cleaved PARP (Cat. No. 13371-1-AP, Proteintech), anti-γ-H2AX (Cat. No. 9718, Cell Signaling Technology), and anti-S9.6 (Cat. No. GS50001, Mabnus).

[0106] Cell culture and transient transfection: Human cancer cell lines including CAL51, MCF7, HCT116, HCT116 p53- / -, RKO, H1299, TOV112D, and ES-2 were cultured in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin. OVCA420 cells were cultured in 1640 supplemented with 10% FBS and 1% penicillin and streptomycin. All cells were mycoplasma-free and identified using a mycoplasma detection kit (Yeasen, Shanghai, China) and cultured at 37°C in a humidified incubator containing 5% CO2. Transient transfection of plasmids and siRNAs was performed using Hieff Trans Liposomal transfection reagent according to the manufacturer's protocol (Yeasen, Shanghai, China). The siRNAs used in the study are listed in Table 1.

[0107] Quantitative real-time polymerase chain reaction: Total RNA was extracted using RNAiso Plus (Takara, Japan). III. Complementary DNA (cDNA) synthesis was performed using RT SuperMix for qPCR (+gDNA wiper) (Vazyme). Quantitative RNA real-time polymerase chain reaction (RT-qPCR) was performed using a SYBR Green SuperMix (Takara, Japan) and a QuantStudio™ 6Flex real-time PCR system (ThermoFisher Scientific, USA).

[0108] RNA stability analysis: For actinomycin D treatment, cells were seeded in six-well plates and grown to 60% confluence. Cells were then treated with 5 μg / ml actinomycin D and collected at specified time points. Total RNA was extracted using RNAiso Plus (Takara, Japan) and analyzed by RT-qPCR. For RNase R treatment, total RNA (3 μg) was incubated with 5 U RNase R (Lucigen, Wisconsin, USA) at 37°C for 15 min, followed by incubation at 70°C for 10 min to inactivate RNase R. RNA abundance was indicated by RT-qPCR analysis.

[0109] Immunoblot: Cells were collected and lysed in a lysis buffer containing 50 mM Tris / HCl (pH 8.0), 150 mM NaCl, 1% (v / v) Triton X-100, 0.1% (w / v) SDS, 1% sodium dodecyl sulfate, and a complete protease inhibitor mixture. Equal volumes of protein lysates were separated by SDS-PAGE gel electrophoresis and then transferred to a PVDF membrane (Millipore, USA). The membrane was incubated overnight with primary antibody at 4°C, followed by incubation with secondary antibody at room temperature for 1 hour. Immunoreactivity signals were detected using an enhanced chemiluminescence (ECL) kit.

[0110] Immunoprecipitation: Cells were collected and lysed in immunoprecipitation (IP) lysis buffer containing 50 mM Tris / HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% (v / v) NP-40, and a complete protease inhibitor mixture. 500–1000 mg of total protein was incubated overnight at 4°C with the indicated antibody, followed by mixing with protein A or G beads at 4°C for 2 hours. The mixture was washed five times with IP lysis buffer. Bound proteins were detected by IB analysis.

[0111] RNA precipitation assay: Cell lysates were prepared in RIP buffer supplemented with a complete protease inhibitor mixture and an RNase inhibitor. The cell lysates were incubated with in vitro transcribed biotin-labeled RNA or RNA probes at 4°C for 3 hours. The mixture was then incubated overnight at 4°C with pre-cleaned streptavidin beads. After washing the mixture five times, SDS loading buffer was added to the beads, and the mixture was boiled at 100°C for 10 minutes. The samples were analyzed by SDS-PAGE gel electrophoresis and mass spectrometry.

[0112] RNA Immunoprecipitation: Cells were lysed in RNA immunoprecipitation (RIP) buffer containing 10 mM Tris / HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 0.1% (w / v) sodium dodecyl sulfate, 1% (v / v) NP-40, a complete protease inhibitor mixture, and an RNase inhibitor. Equal volumes of cell lysate were immunoprecipitated overnight at 4°C with the indicated antibody, followed by incubation with protein A or G beads at 4°C for 3 hours. Input analysis was performed using 2% of each sample, by immunoblotting or PCR. After washing the mixture six times, bound RNA was extracted using RNAiso Plus and analyzed by RT-qPCR.

[0113] Chromatin Immunoprecipitation: Chromatin immunoprecipitation (ChIP) assays were performed using the Magna ChIP™ A / G Chromatin IP Kit according to the manufacturer's protocol (Merck). Briefly, 1% formaldehyde was added to a cell plate to crosslink cells at room temperature for 10 minutes, followed by the addition of glycine to a final concentration of 125 mM to stop the crosslinking. After rinsing with ice-cold PBS, cells were scraped from the plate and suspended in chromatin lysis buffer supplemented with protease inhibitors. Nuclei were then collected and lysed using nuclear lysis buffer. Chromatin was sheared into 200-1000 bp fragments by sonication. Magnetic beads containing anti-p53 antibody or IgG were mixed with the sheared chromatin and incubated overnight at 4°C. The beads were washed four times and eluted with elution buffer. The purified DNA was purified and analyzed by qPCR.

[0114] DNA-RNA Immunoprecipitation: Cells were lysed overnight at 37°C with SDS / proteinase K. Nucleic acids were purified using phenol-chloroform and high-density Maxtract lock gel electrophoresis, followed by precipitation with ethanol at room temperature. The obtained nucleic acids were digested overnight at 37°C with a combination of restriction enzymes (BsrGI, EcoRI, HindIII, SspI, and XbaI) supplemented with 1 mM spermine and 100 μg / ml BSA in NEB buffer 2.1. The digested DNA was purified by phenol-chloroform extraction and then treated either overnight at 37°C with RNase H or left untreated. DNA:RNA hybrids extracted from 10 μg of digested nucleic acids were incubated with 3 μl S9.6 antibody (specifically capturing DNA:RNA hybrids) and 50 μl Protein A / G agarose beads at 4°C for 3 h in DNA-RNA immunoprecipitation (DRIP) binding buffer (10 mM NaPO4, 140 mM NaCl, 0.05% Triton X-100). The beads were then washed three times with DRIP binding buffer at room temperature and incubated at 55°C for 45 minutes with elution buffer (50 mM Tris pH 8.0, 10 mM EDTA pH 8.0, 0.5% SDS, and 140 μg proteinase K). The nucleic acids were purified by phenol-chloroform extraction and then precipitated with ethanol overnight at -20°C.

[0115] R-chromatin immunoprecipitation: HEK-293T cells expressing V5-labeled RNA SEH1-D210N or -WKKD mutant proteins were cross-linked with 1% formaldehyde for 10-15 minutes. Glycine was added to a final concentration of 125 mM at room temperature to stop the reaction. After washing twice with PBS, the cells were scraped off, and the nuclei were extracted using cell lysis buffer (10 mM Tris / HCl pH 8.0, 10 mM NaCl, 0.5% Igepal CA-630) and resuspended in nuclear lysis buffer (50 mM Tris / HCl pH 8.0, 10 mM EDTA pH 8.0, 1% SDS). Chromatin DNA was cleaved into 100-600 bp fragments by sonication. 5% of the chromatin fragments were retained for analysis. The remaining samples were incubated overnight at 4°C with beads containing anti-V5 antibody. The beads were then washed once each with wash buffer I (20 mM Tris / HCl pH 8.0, 2 mM EDTA pH 8.0, 1% Triton X-100, 0.1% SDS, 150 mM NaCl), wash buffer II (20 mM Tris / HCl pH 8.0, 2 mM EDTA pH 8.0, 1% Triton X-100, 0.1% SDS, 500 mM NaCl), wash buffer III (10 mM Tris / HCl pH 8.0, 1 mM EDTA pH 8.0, 1% Igepal CA-630, 250 mM LiCl, 1% sodium dodecyl sulfate), and TE buffer. The beads were then incubated overnight at 65°C with elution buffer (10 mM Tris / HCl pH 8.0, 1 mM EDTA pH 8.0, 1% SDS) and treated with RNase A and proteinase K. DNA was purified by phenol-chloroform extraction and precipitated with ethanol overnight at -20°C.

[0116] Immunofluorescence staining: to determine if cells were treated with cisplatin and transfected with specific siRNA and plasmids. Cells were then fixed overnight with methanol at -20°C. Cells were washed three times with PBS and blocked for 1 hour at room temperature with blocking buffer (8% BSA and 0.3% Triton X-100). Next, cells were incubated overnight at 4°C with primary antibody (anti-S9.6, 1:100). Cells were then washed with PBS and incubated with fluorescent secondary antibody (Yeasen) and DAPI (Sigma-Aldrich). Images were acquired using a confocal fluorescence microscope (Leica, Wetzlar, Germany).

[0117] Cell viability assay: Cell viability was measured using the Cell Counting Kit-8 (CCK-8) (Dojindo, Shanghai, China) according to the manufacturer's instructions. Cells transfected with the indicated plasmid or siRNA, or treated with a pulse agent, were seeded in 96-well plates at 2000-4000 cells per well. 10% WST-8 was added to each well every 24 hours, and the absorbance of the sample was measured at 450 nm.

[0118] Flow cytometry: Apoptosis was assessed using the PE Annexin V Apoptosis Detection Kit (BD Pharmingen). Cells were collected with trypsin, washed with pre-chilled PBS, and resuspended in 100 μl of 1× binding buffer. They were then incubated in the dark at room temperature with Annexin V-PE and 7-aminoactinomycin D (7AAD) for 15 min. Apoptosis levels were determined by flow cytometry (CytoFLEXS, Beckman Coulter).

[0119] Mouse xenograft experiment: Five-week-old female BALB / c nude mice were obtained from the Laboratory Animal Science Department of Shanghai Cancer Center, Fudan University. 4 × 10⁶ HCT116 cells stably overexpressing circASCC3, shcircASCC3, or the control vector were resuspended in serum-free medium and subcutaneously injected into the lateral region of the mice. Tumor growth was monitored every other day using digital calipers. Tumor volume was calculated using the formula: Volume = Length × Width² × 0.5². When the tumor reached an appropriate volume, it was harvested, weighed, and photographed. Animal protocols complied with ethical guidelines and were approved by the Animal Welfare Committee of Shanghai Cancer Center, Fudan University.

[0120] Whole transcriptome microarray: CAL51 cells were treated with DMSO, Nutlin-3, 5-fluorouracil, or cisplatin for 48 hours. Total RNA was extracted using RNAiso Plus (Takara, Japan). Microarray analysis was provided by Shanghai Biotechnology Co., Ltd. (Shanghai, China).

[0121] Colorectal cancer specimens: A total of 80 colorectal cancer tissue samples and 15 matched adjacent normal tissue samples were used to construct a cDNA microarray (Shanghai Outdo Biotechnology, Shanghai, China). This microarray was analyzed for circASCC3 expression by qPCR. This application has been approved by the Human Research Ethics Committee of Shanghai Cancer Center, Fudan University.

[0122] Statistical Analysis: All in vitro experiments were biologically replicated. Differences between two or more groups were analyzed using Student's t-test or one-way ANOVA. Statistical analysis was performed using GraphPad Prism 8.0, and results are expressed as mean ± standard deviation (SD). Kaplan-Meier plots and log-rank tests were used to analyze significant differences in patient survival. Asterisks indicate statistical significance: *p<0.05; **p<0.01; ***p<0.001.

[0123] Example 1: Identification of circASCC3 as a p53-induced circular RNA

[0124] To identify circular RNAs responsive to DNA damage and p53 activation, whole transcriptome microarray analysis was performed on CAL51 cells treated with the chemotherapy drugs Nutlin-3, 5-fluorouracil (5-FU), or cisplatin. Figure 1 A). The results are reliable because many known p53-induced protein-coding genes are upregulated after treatment. This was achieved by combining analyses of fold change, p-value, and the length and expression of circular RNA (A). Figure 1 B and 1C) identified a circular RNA, hsa_circ_0077495, with high baseline expression levels (determined by microarray data and cycle threshold (Ct) values ​​from RT-qPCR), which was consistently upregulated by Nutlin-3 and DNA damage inducers. This circular RNA was named circASCC3 because it consists of exons 5 through 8 of the host gene ASCC3, and was verified by Sanger sequencing. Figure 1 D). The circular structure of circASCC3 was further confirmed by PCR analysis using convergent and divergent primers as described above. Figure 1 D). The results showed that the PCR product from the ligation site could be amplified from cDNA but not from genomic DNA, indicating the presence of a reverse splicing event at this site using divergent primers. Figure 1 E). CircNSUN2 is used as a reference for comparison. Furthermore, circASCC3 is more stable than the linear transcripts of ASCC3 and CDKN1A (commonly referred to as p21) because it exhibits a prolonged half-life in cancer cells whose transcription is blocked by actinomycin D. Figure 1 F), and is resistant to RNase R digestion (F). Figure 1 G). Finally, the subcellular localization of circASCC3 was determined, revealing that this circular RNA is mainly distributed in the cytoplasm of cancer cells. Figure 1 These results indicate that circASCC3 is a circular RNA whose expression levels are elevated in response to DNA damage and p53 activation.

[0125] Example 2: p53 transcriptional activation of circASCC3 expression

[0126] To investigate whether p53 regulates circASCC3 expression, a series of RT-qPCR analyses were performed on cancer cells treated with p53 inducers such as Nutlin-3, cisplatin, and 5-FU. These drugs significantly induced the expression of circASCC3 and its host gene ASCC3 in a group of wild-type p53-carrying cancer cells, as well as the expression of p53 target genes p21, including CAL51, MCF7, HCT116, RKO, and A549. Figure 2 A-2D;). In contrast, p53 knockdown significantly reduced the expression of circASCC3 and ASCC3 in cancer cells treated with cisplatin or Nutlin-3. Figure 2 E-2G). Whether wild-type p53 requires this regulation was also tested using cancer cells lacking p53 or expressing mutant p53, including HCT116 p53- / -, H1299, TOV112D, OVCA420, and ES-2 cells. Treatment of these cells with cisplatin or Nutlin-3 did not affect the expression of circASCC3 and ASCC3 (E-2G). Figure 2 H-2K). Furthermore, knockdown of mutant p53 had no significant effect on the expression of circASCC3 and ASCC3 (H-2K). Figure 2 L and 2M). Consistently, overexpression of wild-type p53, but not some p53 mutants, significantly induced the expression of circASCC3 (L and 2M). Figure 2 These results suggest that increased circASCC3 expression may be associated with the transcriptional activity of wild-type p53. To test this hypothesis, the p53MH algorithm was used to search for potential p53-responsive elements (p53-REs) in the ASCC3 promoter sequence. Three possible p53-REs were identified at positions -1511 to -1536, -1281 to -1307, and +3303 to +3327. Figure 2 ChIP analysis showed that p53 strongly binds to p53-RE-1 and moderately binds to p53-RE-2, but does not bind to p53-RE-3. Figure 2 Furthermore, overexpression of p53 significantly induced luciferase activity driven by an ASCC3 promoter fragment containing p53-RE-1 and -2 (P). Figure 2 Q). In summary, these results indicate that p53 induces circASCC3 expression by transcribedly activating its host gene ASCC3.

[0127] Example 3: RNA-binding protein SFPQ participates in p53-mediated upregulation of circASCC3.

[0128] The recycling of circular RNA via backsplicing is catalyzed by the spliceosome mechanism and regulated by intron complement sequences (ICSs) and RNA-binding proteins (RBPs). By searching the RBP map, several RBPs were identified that may be responsible for recycling by binding to the flanking intron regions of circASCC3. To test this hypothesis, RNAi screening of RBPs that could regulate circASCC3 expression was performed in CAL51 and HCT116 cells. The results confirmed that SFPQ ablation significantly induced circASCC3 expression in both cell lines. Figure 3 A and 3B). To validate these results, two independent siRNAs were used to knock down SFPQ expression, and both consistently showed that SFPQ depletion significantly increased circASCC3 expression levels but decreased ASCC3 mRNA levels (A and B). Figure 3 (C and 3D). These results suggest that SFPQ may play a role in inhibiting the circASCC3 recycling process, thereby increasing the production of ASCC3 linear transcripts. Repeat elements are known to be major ICSs, contributing to backsplicing and circular RNA formation. It is speculated that SFPQ may bind to these repeat elements to prevent the recycling of circASCC3. Indeed, several potential SFPQ binding sites were predicted on repeat elements in flanking intron regions (C and 3D). Figure 3 E). RIP analysis was then performed to confirm that SFPQ could bind to four of the six potential binding sites on exons 5 through 8 in the two flanking regions. Figure 3 F). DNA damage inducers and Nutlin-3 can induce circASCC3 expression more significantly than ASCC3 mRNA. Figure 2 These results suggest that p53 may also play a role in promoting circASCC3 cycling. Reanalysis of the microarray data revealed that p53 activation reduced SFPQ expression. RT-qPCR analysis confirmed that cisplatin and Nutlin-3 inhibited SFPQ expression, which could be partially reversed by p53 depletion. Figure 3 In summary, these results suggest that p53 may promote circASCC3 recycling by inhibiting SFPQ expression.

[0129] Example 4: Overexpression of circASCC3 promotes tumor resistance to genotoxic stress.

[0130] To investigate the biological function of circASCC3, plasmids encoding circASCC3 were ectopically overexpressed in various cancer cells. First, cell viability assays and flow cytometry analysis revealed that circASCC3 overexpression had almost no effect on cell proliferation or apoptosis. It was hypothesized that circASCC3 might play a role under DNA damage stress. To test this hypothesis, cancer cells were pulsed with the strong DNA damage inducer methyl methanesulfonate (MMS), along with cisplatin and etoposide, a treatment very similar to chemotherapy but minimizing widespread cell death. Unexpectedly, circASCC3 overexpression significantly promoted the growth of cancer cells treated with these drugs, as evidenced by cell viability assays. Figure 4 A-4D). Furthermore, ectopic circASCC3 inhibited apoptosis under genotoxic stress in various cancer cells, as indicated by flow cytometry analysis. Figure 4 E-4H) and the level of cleaved PARP ( Figure 4 I and 4J). Consistently, circASCC3 overexpression leads to resistance of cancer cells to MMS and cisplatin (I and 4J). Figure 4 K and 4L). Furthermore, the results indicated that circASCC3 overexpression supported the growth of xenografts treated with cisplatin, which was attributed to an increased tumor growth rate (K and 4L). Figure 4 M), weight ( Figure 4 N) and size ( Figure 4 The results (O) indicate that the potential adverse events from the treatment were tolerable, as the average body weight of the mice was not affected. Figure 4 In summary, these results indicate that ectopic circASCC3 promotes cancer cell survival under genotoxic stress both in vitro and in vivo.

[0131] Example 5: Knocking out circASCC3 increases tumor sensitivity to genotoxic stress.

[0132] We designed siRNA targeting the circASCC3 gene and tested its knockdown efficiency and effectiveness.

[0133] siRNA knockdown efficiency screening:

[0134] After the designed siRNA was synthesized, cellular RNA was extracted after transfection into cells, and after reverse transcription, the knockdown efficiency of the circASCC3 gene was detected by qPCR.

[0135] The following are some representative siRNAs designed:

[0136] Table 1

[0137]

[0138]

[0139] Based on the initial screening results, 10 siRNAs that showed knockdown effects on the circASCC3 gene were re-screened.

[0140] Based on the results of the rescreening, the siRNAs with the best knockdown effects, 01 and 02, were named sicircASCC3-1 (SEQ ID NO.2) and sicircASCC3-2 (SEQ ID NO.3) respectively for subsequent experiments.

[0141] To examine the role of endogenous circASCC3, its expression was depleted in various cancer cells using two independent siRNAs (sicircASCC3-1 and sicircASCC3-2), while ASCC3 expression remained unchanged. Knockout of circASCC3 had little effect on cell growth or apoptosis in unstressed cancer cells. However, depletion of circASCC3 significantly inhibited cell growth in cancer cells treated with genotoxic drugs. Figure 5 A-5C) and promoted apoptosis ( Figure 5 D-5G). Consistent with these cell-based experiments, depletion of circASCC3 inhibited the growth rate of xenografts treated with cisplatin (D-5G). Figure 5 H), weight ( Figure 5 I) and size ( Figure 5 J), without affecting the average body weight of mice (J), Figure 5 These results indicate that knocking out circASCC3 enhances genotoxic stress-induced cancer cell death.

[0142] ASCC3 has been reported to collaborate with ALKBH3 to repair DNA alkylation damage in prostate and lung cancer cells that highly express ALKBH3. Therefore, this study investigated whether endogenous ASCC3 is involved in cell survival under genotoxic stress. Knockdown of ASCC3 with two different siRNAs under both stress-free and genotoxic conditions did not affect cell growth or apoptosis. These findings suggest that the role of circASCC3 in triggering resistance to genotoxic stress is independent of the host gene ASCC3 in these cells.

[0143] Example 6: CircASCC3 interacts with DDX5 and stabilizes DDX5.

[0144] To understand the potential mechanisms by which circASCC3 supports cell survival under DNA damage stress, two strategies were used for RNA-pull-down assays combined with mass spectrometry (MS) analysis. Biotin-labeled reverse splicing ligation (BSJ) probes were used to pull down endogenous circASCC3-related proteins (…). Figure 6 A), and the linear circASCC3 transcript labeled with biotin ( Figure 6 B). Protein complexes extracted using two strategies were analyzed by MS to identify several proteins that may bind to circASCC3. RIP assays were then performed to verify the strong binding of circASCC3 to DDX5, as shown in gel electrophoresis and RT-qPCR analysis. Figure 6 C and 6D). However, although these proteins were present in the MS results, no interaction with NONO, RUVBL1, or EIF4A3 was observed. Figure 6 C and 6D). DDX5 has been shown to maintain genome integrity and promote DNA damage repair by resolving R loops. Therefore, circASCC3 may promote chemoresistance by regulating DDX5. Unexpectedly, knocking out circASCC3 was found to reduce DDX5 protein levels ( Figure 6 E and 6F), while their mRNA expression remained unchanged ( Figure 6 G and 6H). This reduction can be completely reversed in cancer cells treated with the proteasome inhibitor MG132 (G and 6H). Figure 6 I and 6J). Conversely, overexpression of circASCC3 prolonged the half-life of the DDX5 protein (I and 6J). Figure 6 K and 6L). Furthermore, the results showed that knocking out DDX5 could partially reverse the effect of circASCC3 overexpression on cancer cell growth (K and 6L). Figure 6 M) and apoptosis (M) Figure 6 The effects of N). In summary, these results suggest that circASCC3 may trigger chemoresistance by stabilizing DDX5, thereby eliminating the R loop.

[0145] Example 7: CircASCC3 suppresses R-loop accumulation via DDX5

[0146] Since DDX5 restricts R-loops to maintain genome stability, this study examined whether circASCC3 functions to resolve R-loops under DNA damage conditions via DDX5. R-loops accumulate at transcriptional pausing sites, a key element in transcriptional termination. The human ACTB gene has G-enriched pausing elements, which can serve as an indicator of R-loop formation. DRIP-qPCR was performed using an S9.6 antibody that specifically captures R-loops. The results showed that circASCC3 overexpression significantly reduced the level of R-loops forming at ACTB pausing sites. Figure 7 A), while the depletion of circASCC3 increases the formation of R-rings ( Figure 7 B). These findings were further confirmed by DRIP-qPCR assay at another R-loop site at RPS23. Figure 7A and 7B). DRIP-qPCR results are reliable because the R loop can be almost eliminated by RNase H ( Figure 7 RNase H (A and 7B) is an endonuclease that specifically recognizes and resolves R loops. The R-ChIP method has previously been developed for detecting R loops using catalytically inactivated RNASEH1. An R-ChIP assay was then performed to test whether circASCC3 prevented R loop accumulation. The D210N mutant of RNASEH1 was shown to bind R loops without breaking them down. The results indicated that circASCC3 overexpression significantly reduced the level of R loops bound to RNASEH1-D210N (A and 7B). Figure 7 C). WKKD mutants (W43A, K59A, K60A, and D210N) lost their catalytic and binding activities and could be used as negative controls for comparison. Furthermore, IF staining assays using S9.6 antibody were used to verify the function of circASCC3 in regulating the R loop. Cisplatin-induced DNA damage increased R loop levels ( Figure 7 D). Notably, knockout of p53 or circASCC3 further promotes R-loop accumulation, while overexpression of DDX5 partially restores R-loop levels. Figure 7 D). Finally, the clinical significance of circASCC3 in colorectal cancer samples was evaluated. Results showed that circASCC3 expression levels were lower in cancer tissues compared to normal tissues. Figure 7 E). This may be because p53 is typically inactivated or mutated in tumor cells. Consistent with its role in triggering tumor resistance to chemotherapy, high levels of circASCC3 in tumors are associated with poorer prognosis. Figure 7 (F and 7G). However, the correlation was not statistically significant, and more colorectal cancer samples may be needed. Overall, the p53-circASCC3 cascade maintains genomic stability by increasing DDX5-mediated R-loop resolution.

[0147] p53 maintains genomic stability and suppresses cancer by regulating the transcription of numerous protein-coding and non-coding genes. p53 has been found to control circRNA expression by activating the transcription of host genes. Circ-MDM2 was the first circRNA identified as being regulated by p53 because it originates from the MDM2 gene locus. Like MDM2, this circRNA promotes tumor cell growth by downregulating p53 protein levels. IRSense is another p53-induced circRNA that contributes to radiotherapy resistance in lung cancer. This application discloses circASCC3 as a p53-induced circRNA and reveals the mechanism by which p53 regulates circASCC3 expression. circRNA expression involves the transcription of its host gene and subsequent backsplicing or cyclication. This application finds that p53 activates the transcription of the host gene ASCC3 of circASCC3 under DNA damage stress. Figure 2 Furthermore, although the RNA-binding protein SFPQ binds to the flanking regions of circASCC3 to reduce its expression, p53 can inhibit SFPQ expression, thereby potentially promoting circASCC3 recycling and expression. Figure 3 These findings suggest that p53 activates circASCC3 expression at both the transcriptional and post-transcriptional levels.

[0148] Activation of p53 can inhibit cancer development, but it may also lead to resistance to chemotherapy by enhancing DNA damage repair. Surprisingly, the results of this application show that overexpression or depletion of circASCC3 has no effect on the growth and apoptosis of cancer cells cultured under normal conditions. However, overexpression of circASCC3 inhibited apoptosis in cancer cells treated with DNA damage inducers and promoted their growth. Figure 4 Conversely, knockout of circASCC3 increased apoptosis and inhibited cancer cell growth under DNA damage conditions. Figure 5 These findings suggest that circASCC3 plays a role in regulating DNA damage repair in colorectal and breast cancer. Mechanistically, the results of this application show that circASCC3 interacts with and stabilizes DDX5. Figure 6 circASCC3 is an RNA / DNA helicase that resolves R-loops. While this application demonstrates that circASCC3 prevents proteasomal degradation of DDX5, further research is needed to determine whether any E3 ubiquitin ligases are involved in this process. Interestingly, a recent study showed that circASCC3 promotes lung cancer cell growth even under normal growth conditions, suggesting that the regulatory mechanism of circASCC3 may vary depending on the cancer context. Finally, using various experimental methods, this application demonstrates that circASCC3 prevents R-loop accumulation under DNA damage stress via DDX5. Figure 7 A-7D). This application found that cisplatin-induced DNA damage significantly promoted the accumulation of R loops (A-7D). Figure 7 (D) This is consistent with previous studies, while the baseline level of R-loops in cancer cells is relatively low. This result may explain why circASCC3 has little effect on cancer cell growth and apoptosis under normal growth conditions. Analysis of matched colorectal cancer samples revealed that circASCC3 expression levels were higher in normal tissues compared to cancerous tissues. Figure 7 This suggests that circASCC3 may prevent cancer formation by maintaining genomic stability in normal cells. Furthermore, high levels of circASCC3 in tumors predict a poorer prognosis. Figure 7 F and 7G), possibly due to their role in resolving R loops and conferring chemoresistance. In summary, these findings reveal the crucial role of circASCC3 in p53-mediated R loop resolution and maintaining genome stability.

[0149] The results of this application reveal that the protein-coding gene ASCC3 is a true target gene of p53. This is because DNA damage inducers or Nutlin-3 increase the expression of ASCC3, while knockdown of p53 decreases its expression. Figure 2 A-2G). Furthermore, the ChIP and luciferase reporter gene assays in this application verified that p53 can bind to the ASCC3 gene promoter to activate transcription (A-2G). Figure 2 The study found that p53 transcriptional induction of ASCC3 expression reveals a different mechanism by which p53 promotes DNA damage repair. ASCC3 encodes a 3'-5' DNA helicase that works synergistically with ALKBH3 to remove DNA alkylation adducts. ASCC3 conferred resistance to alkylation damage in PC3, LNCap, and H23 cells with high ALKBH3 expression, but had no effect in WiDr, U2OS, and HTB-1 cells with low ALKBH3 expression. Therefore, p53 may be involved in the repair of alkylation damage in cancer cells with high ALKBH3 levels.

[0150] In summary, this application identifies a p53-induced circular RNA, circASCC3. Overexpression of circASCC3 under DNA damage stress increases cancer cell survival and growth, while depletion of circASCC3 inhibits their survival and growth. Mechanistically, circASCC3 interacts with DDX5 and prevents its proteasomal degradation, thereby resolving the R-loop and subsequently generating resistance to DNA damage. Figure 8 This application reveals an important mechanism by which p53 maintains genome integrity.

[0151] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of a siRNA targeting circASCC3, or its precursor shRNA, or an exosome loaded with the siRNA or its precursor shRNA, characterized in that, Used for: preparing a drug for treating tumors, wherein the tumor is colorectal cancer or breast cancer; The siRNA is selected from the following group: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), or siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

2. The use as described in claim 1, characterized in that, The siRNA is: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2).

3. The use as described in claim 1, characterized in that, The tumor is a chemotherapy-resistant tumor.

4. The use as described in claim 1, characterized in that, The 5' to 3' ends of the precursor shRNA sequentially include: a first sequence unit, a stem-loop sequence unit, and a second sequence unit. The first and second sequence units are complementary, causing the precursor shRNA to form a hairpin structure. The first sequence unit is selected from the following group: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), or siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

5. A method for inhibiting tumor cells in vitro without therapeutic effect, characterized in that, The steps include: culturing tumor cells, which are colorectal cancer cells or breast cancer cells, in the presence of an inhibitor of circASCC3 to inhibit the tumor cells. The inhibitor of circASCC3 is a siRNA targeting circASCC3, or its precursor shRNA, or an exosome loaded with the siRNA or its precursor shRNA. Furthermore, the siRNA is selected from the following group: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), or siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

6. The method as described in claim 5, characterized in that, The 5' to 3' ends of the precursor shRNA sequentially include: a first sequence unit, a stem-loop sequence unit, and a second sequence unit. The first and second sequence units are complementary, causing the precursor shRNA to form a hairpin structure. The first sequence unit is selected from the following group: siRNA-1: 5'-AAGACTTAGATGAGCTATT-3' (SEQ ID NO. 2), or siRNA-2: 5'-CTTAGATGAGCTATTTGAA-3' (SEQ ID NO. 3).

7. The method as described in claim 5, characterized in that, The inhibition of tumor cells refers to the inhibition of tumor cell growth.

8. The method as described in claim 7, characterized in that, The aforementioned inhibition of tumor cells refers to the inhibition of tumor cell formation.

9. The method as described in claim 5, characterized in that, The tumor cells are either human breast cancer CAL51 cell line or human breast cancer MCF7 cell line.

10. The method as described in claim 5, characterized in that, The tumor cells are the human rectal cancer HCT116 cell line.

Citation Information

Patent Citations

  • Application of circular RNA circ-PTGR1

    CN107663539A

  • SiRNA for targeted silencing of cZNF292 gene and application of siRNA

    CN111019944A