Citrus CsMYB62 gene and application thereof in softening citrus branch thorns

Abstract

The invention discloses a citrus CsMYB62 gene and application thereof in softening citrus branch thorns, and belongs to the field of citrus breeding. The invention finds that the citrus CsMYB62 gene is a key gene for regulating and controlling citrus branch spike tip sclerosis, and the nucleotide sequence of the citrus CsMYB62 gene is as shown in SEQ ID NO: 1 or is a nucleotide sequence which is obtained by substituting, deleting or adding one or more nucleotides to the nucleotide sequence as shown in SEQ ID NO: 1 and has a coding equivalent active protein. The invention finds that the citrus branch thorns can become short and soft by knocking out the citrus CsMYB62 gene through gene editing, so that the gene can be used as an important candidate gene for cultivating citrus varieties with weakened branch thorns. The invention can provide important theoretical basis and gene resources for genetic improvement of citrus branch thorn characters.

Description

Technical Field

[0001] The invention belongs to the field of citrus breeding, and particularly relates to a citrus CsMYB62 gene and application thereof in softening citrus branch thorns. Background Art

[0002] Thorns are a physical defense strategy of plants against herbivores, a strategy that benefits from the hardening of the thorn tips. Citrus branch thorns are modified branches. Unlike the continuous growth of the branch tips, the cell division at the top of citrus branch thorns stops. After these cells have completed their elongation, the primary cell walls gradually deposit lignified secondary cell walls, causing the cell walls to thicken and harden, eventually forming hard, sharp thorn tips.

[0003] Citrus trees are rich and diverse, but most citrus varieties have thorns, especially some rootstock varieties. Citrus branch thorns bring great inconvenience to citrus grafting, pruning, fruit harvesting and other farming operations; citrus branch thorns are also easy to pierce fruits and leaves, and spread pests and diseases. However, the regulatory mechanism of thorn tip hardening has not yet been clarified. Therefore, cultivating citrus scion and rootstock varieties with weakened or thornless branch thorns is one of the important goals of citrus breeding.

[0004] In view of this, this application is hereby filed. Summary of the invention

[0005] The purpose of the present invention is to provide a citrus CsMYB62 gene and application thereof in softening citrus branch thorns.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A citrus CsMYB62 gene, the nucleotide sequence of the citrus CsMYB62 gene is shown in SEQ ID NO: 1 or the nucleotide sequence shown in SEQ ID NO: 1 is replaced, deleted or added with one or several nucleotides and has a nucleotide sequence encoding an equivalent active protein.

[0008] The present invention also provides an application of a citrus CsMYB62 gene in softening thorns in citrus branches, wherein the application is achieved by reducing or eliminating the activity of the citrus CsMYB62 gene. Furthermore, the application is achieved by knocking down or knocking out the citrus CsMYB62 gene.

[0009] The present invention also provides a method for softening thorns on citrus branches, which is to reduce or eliminate the activity of the citrus CsMYB62 gene.

[0010] Furthermore, the method for softening citrus branch thorns is to knock down or knock out the citrus CsMYB62 gene.

[0011] Furthermore, the method for softening citrus thorns comprises the following steps:

[0012] (1) Design the target sequence targeting the citrus CsMYB62 gene;

[0013] (2) Construction of a gene editing vector targeting the citrus CsMYB62 gene;

[0014] (3) The gene editing vector targeting the citrus CsMYB62 gene was used to transform citrus, and plants in which the citrus CsMYB62 gene was knocked out were obtained through screening, that is, citrus plants with short and soft thorns.

[0015] Further, in step (1), the targets of the citrus CsMYB62 gene are target 1 with a nucleotide sequence of SEQ ID NO: 2 and target 2 with a nucleotide sequence of SEQ ID NO: 3. The primers of gRNA1 targeting target 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NOs: 4 and 5, respectively, and the primers of gRNA2 targeting target 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NOs: 6 and 7, respectively.

[0016] Furthermore, step (2) includes: annealing the two target primers in step (1) and connecting them to a gene editing vector to obtain a gene editing vector targeting the citrus CsMYB62 gene. The gene editing vector is preferably pCAMBIA1300-pYAO-cas9.

[0017] Furthermore, step (3) includes: transforming the gene editing vector targeting the citrus CsMYB62 gene obtained in step (2) into Agrobacterium, preparing an Agrobacterium culture solution containing the gene editing vector, infecting the epicotyls of sterile citrus seedlings with the Agrobacterium culture solution, and obtaining csmyb62 plants in which the citrus CsMYB62 gene is knocked out through fluorescence screening and Hi-Tom detection, that is, obtaining citrus plants with short and soft branch thorns.

[0018] The present invention also provides the use of the citrus CsMYB62 gene in cultivating a citrus variety with weakened thorns. The citrus variety with weakened thorns is a citrus variety with reduced or inactivated CsMYB62 gene activity.

[0019] Advantages and beneficial effects of the present invention: The present invention finds that the citrus CsMYB62 gene is a key gene for regulating the hardening of the tip of citrus thorns. By knocking out the CsMYB62 gene through gene editing, the length and hardness of citrus thorns can be significantly reduced without affecting the normal growth of transgenic plants. Therefore, the gene can be used as an important candidate gene for breeding citrus varieties with weakened thorns. The present invention can provide an important theoretical basis and gene resources for the genetic improvement of citrus thorn traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1The expression pattern of citrus CsMYB62 gene; a: relative expression level of citrus CsMYB62 gene in various citrus tissues; b: in situ hybridization of citrus CsMYB62 gene in citrus apical buds (scale bar = 300 μm).

[0021] Figure 2 The phenotype of csmyb62 plants after gene editing of the citrus CsMYB62 gene; a: overall morphology of wild-type control (WT) and csmyb62 plants; b: comparison of leafless branches between WT and csmyb62 plants; c: Hi-Tom detection of gene editing in csmyb62 plants.

[0022] Figure 3 Results of the length and hardness measurement of branch thorns of csmyb62 plants after gene editing of the CsMYB62 gene in citrus; a: comparison of branch thorn length between WT and csmyb62 plants (scale bar = 1 cm); b: length measurement of 50 branch thorns of each WT and csmyb62 plants; c: measurement of branch thorn hardness of WT and csmyb62 plants; d: measurement of hardness of 9 branch thorns of each WT and csmyb62 plants.

[0023] Figure 4 Results of physiological index determination of branch thorns of csmyb62 plants after gene editing of citrus CsMYB62 gene; a: determination of lignin content in branch thorns of WT and csmyb62 plants; b: determination of cellulose content in branch thorns of WT and csmyb62 plants; c: determination of lignin monomer content in branch thorns of WT and csmyb62 plants.

[0024] Figure 5 Comparison of the secondary cell walls of branch thorns between csmyb62 plants and WT plants after gene editing of the citrus CsMYB62 gene; a: lignin staining of cross-section of branch thorns of WT plants; b: lignin staining of branch thorns of csmyb62 plants; c: transmission electron microscopy observation of thorn tips of WT and csmyb62 plants; d: statistical results of the secondary cell wall thickness of 50 cells at the thorn tips of WT and csmyb62 plants. DETAILED DESCRIPTION

[0025] In order to clearly and completely describe the purpose, technical solutions and advantages of the present invention, the details of the present invention are further described in detail below in conjunction with the embodiments. The described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0026] The citrus CsMYB62 gene in the present invention has a gene number of Cs2g_pb012390 according to the second-generation sweet orange reference genome, contains 2 introns and 3 exons, and encodes 316 amino acids.

[0027] The coding nucleotide sequence of the citrus CsMYB62 gene is as follows: ATGCACACAATGAGAGCAGCAAGGGCTG CTGGTACAAAGAGAGAGTGCAATTCCAGTGAAGAAGATCAACAAGAGCTGAGAAGAGGGCCATGGACTCTTGAAGAAGACACACTTCTTACTCATTACATACATCAACACGGCGAAGGTCGTTGGAATATGGTAGCTAAATGTGCAGGACTCAAAAGAACTGGAAAGAGTTGCAGATTGAGATGGCTAAATTATTTGAAACCCGACATTAAACGCGGGAACCTAACTCCACAGGAGCAGTTCTTGATTCTTGAACTCCATTCTAAGTGGGGTAACAGGTGGTCAAAAATTGCACAATGTCTGCCTGGAAGAACAGACAATGAAATCAAGAATTATTGGAGAACAAGGGTGCAGAAACAAGCTCGCCAGCTTAATATTGAGTCTAACAGTGAGACATTTTTCGAAGCTGTTCGATGTTATTGGATGCCAAGATTGCTGCAAAAGATGGAGCAGAATTCTGCTTCTCCTAATACTCTTTTGACAAATTCTAGTGCTCAATCATCCAACTTTTCTATTATCCCTTCTGTTTCGTCATCAACATTATCCCCTCTGCCAAGCACAATACTTTACAACTCAAATCAAACCATTAATGAAAACTCAAGTTCAGAGACTAGCCCTAACTTTTTCCCTGGAGATTTTTCAAAAATCTCACAGCTGCAGCAGCCTGGAATTACTCAACAGCCAACAAGTCCACATGCGTATGGCAACAATGTCTGCAGCAACCAAATAGTCCCAAACGACAGTTACTATGTGGACTGTTGTGGCTTTGACATGGAAGGTTACAGTCTAACTGATCCAATAGCAGAAATGAGCTCTTATGACATATCCTCGTCCGAATGCCAGATGGCGGAAGCTGATTGGATGTCCAATGACATGTCAGATGCTTTGTGGAACATGGATGACATATGGCAGCTTAGGGAGTAA(SEQ ID NO: 1).

[0028] Example 1: Analysis of the expression pattern of the citrus CsMYB62 gene

[0029] (1) In order to determine the expression position and expression pattern of the citrus CsMYB62 gene, qRT-PCR primers CsMYB62-RT-F (SEQ ID NO: 8) and CsMYB62-RT-R (SEQ ID NO: 9) were designed based on the specific region of the citrus CsMYB62 gene. The qRT-PCR reaction conditions were: 95℃ for 3 min; 95℃ for 10 s, 55℃ for 10 s, 72℃ for 20 s, 40 cycles; 72℃ for 10 min. -△△Ct The relative expression levels of the citrus CsMYB62 gene in six different tissues of Carrizo orange, including lateral buds, stem tips, roots, leaves, thorn tips, and thorn bases, were calculated by this method.

[0030] Primer CsMYB62-RT-F: CAGTTCTTGATTCTTGAACTCC (SEQ ID NO: 8);

[0031] Primer CsMYB62-RT-R: ATATTAAGCTGGCGAGCTTG (SEQ ID NO: 9).

[0032] The relative expression analysis of the citrus CsMYB62 gene in different tissues revealed that the citrus CsMYB62 gene was highly expressed only in the citrus thorn tips ( Figure 1 a).

[0033] (2) Based on the full length of the citrus CsMYB62 gene CDS, an in situ hybridization probe for the CsMYB62 gene was prepared, and primers CsMYB62-ISH-F (SEQ ID NO: 10) and CsMYB62-ISH-R (SEQ ID NO: 11) were designed. The primers were used to carry out PCR amplification with Carrizo orange cDNA as a template and Phanta enzyme in a 100 μL system. After the gel test was correct, the DNA was recovered and hydrated to 600 μL. An equal volume of chloroform was added and mixed. After centrifugation at 12000 r / min for 10 min, 500 μL of supernatant was taken, 50 μL of 3M NaAc and 1 mL of anhydrous ethanol were added, and after mixing, the supernatant was placed at -20°C. After 2 hours, the supernatant was discarded at 12000 r / min and 4°C for 10 min, and 1 mL of 75% ethanol was added to clean the DNA. The supernatant was discarded and the DNA was dried in a fume hood for 10 min at 12000 rpm and 4°C. Then 20 μL of DEPC-treated sterile water was added to fully dissolve the DNA, and the DNA was transferred to a new tube to determine the DNA concentration.

[0034] Prepare the in vitro transcription reaction in an RNase-free PCR tube:

[0035]

[0036] After reacting at 37℃ for 2h in the PCR instrument, aspirate 1μL gel for inspection, add 2μL DNase to the transcription system, react at 37℃ for 15min, aspirate 1μL gel for inspection again, if there are 1-2 bright bands, the gel inspection is correct. Transfer the remaining RNA to a 1.5mL centrifuge tube, add 1.6μL 0.5M EDTA to terminate the transcription reaction, and add DEPC H2O to 100μL. Purify RNA with Jianshi Bio RNA Purification Kit and measure RNA concentration at the same time.

[0037] Transfer the purified RNA to a PCR tube, add an equal volume of 2× hydrolysis solution (0.2M NaHCO3 pH=10.2), and hydrolyze at 60°C for 65 minutes in a PCR instrument. After the hydrolysis is completed, add 10 μL of 5% acetic acid to terminate the hydrolysis reaction. Purify the hydrolyzed RNA again using the Jianshi Bio RNA Purification Kit, collect the purified product in a new centrifuge tube, and add an equal volume of deionized formamide.

[0038] An RNA in situ hybridization probe for the citrus CsMYB62 gene was prepared. The probe sequence was ISH-CsMYB62 (SEQ ID NO: 12). RNA in situ hybridization experiments were performed on cross-sections and longitudinal sections of young apical buds of Citrus aurantium. Figure 1 As shown in b: The citrus CsMYB62 gene is highly expressed specifically at the tips of citrus thorns and is mainly expressed near the vascular bundles.

[0039] Primer CsMYB62-ISH-F: ATTTAGGTGACACTATAGAATGCACACAATGAGAGCAGCAA G (SEQ IDNO: 10;)

[0040] Primer CsMYB62-ISH-R: TGTAATACGACTCACTATAGGGCGATTACTCCCTAAGCTGCC ATATGTC (SEQ ID NO: 11).

[0041] ISH-CsMYB62: UUACUCCCUAAGCCUGCCAUAUGUCAUCCAUGUUCCACAAAGCAU (SEQ ID NO: 12).

[0042] Example 2: Obtaining citrus CsMYB62 gene-edited csmyb62 plants

[0043] (1) Construction of gene editing vector targeting citrus CsMYB62 gene: The target sequence of CsMYB62 gene was designed using the CRISPR-P 2.0 website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). A total of two targets were selected for gene editing, the nucleotide sequence of target 1 was: ATGAGAGCAGCAAGGGCTGC (SEQ ID NO: 2), and the nucleotide sequence of target 2 was: GATCAACAAGAGCTGAGAAG (SEQ ID NO: 3).

[0044] The method for constructing a gene editing vector targeting the citrus CsMYB62 gene is as follows:

[0045] The primers for target 1 were designed as gRNA1-F and gRNA1-R. The nucleotide sequence of gRNA1-F was: ATTGATGAGAGCAGCAAGGGCTGC (SEQ ID NO: 4), and the nucleotide sequence of gRNA1-R was: AAACGCAGCCCTTGCTGCTCTCAT (SEQ ID NO: 5).

[0046] The primers for target 2 were designed as gRNA2-F and gRNA2-R. The nucleotide sequence of gRNA2-F was ATTGGATCAACAAGAGCTGAGAAG (SEQ ID NO: 6), and the nucleotide sequence of gRNA2-R was AAACCTTCTCAGCTCTTGTTGATC (SEQ ID NO: 7).

[0047] The target primers were dissolved in water to a 10 μM stock solution, 10 μL of each was added to 80 μL of 0.5×TE (pH=8.0), and heated at 98°C for 3 min in a PCR instrument. The PCR tubes were immediately removed and naturally cooled to room temperature to allow the primers to anneal. After the two target primer annealing products were obtained, they were respectively connected to the pBlue vector cut with Bsa I, and transformed into Escherichia coli competent cells using T4 ligase, and the plasmids were extracted to obtain pBlue-gRNA1 and pBlue-gRNA2 vectors.

[0048] The pBlue-gRNA1 vector was double-digested with Nhe I and Spe I, and after electrophoresis, a fragment of about 650 bp was recovered and connected to the pCAMBIA1300-pYAO:Cas9 vector cut with Spe I using T4 ligase and transformed into E. coli competent cells, and the plasmid was extracted to obtain the pCAMBIA1300-pYAO:Cas9-gRNA1 vector. Similarly, the pBlue-gRNA2 vector was double-digested with Nhe I and Spe I, and after electrophoresis, a fragment of about 650 bp was recovered and connected to the pCAMBIA1300-pYAO:Cas9-gRNA1 vector cut with Spe I using T4 ligase and transformed into E. coli competent cells, and the plasmid was extracted to finally obtain the pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector.

[0049] (2) Genetic transformation of citrus: The obtained pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector was transformed into Agrobacterium. Before infection, Agrobacterium carrying the pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 gene editing vector was streaked twice on LB medium (tryptic peptone 10 g / L + yeast extract 5 g / L + sodium chloride 10 g / L (solid LB plus agar powder 15 g / L)) containing 50 mg / mL kanamycin to activate Agrobacterium. The activated Agrobacterium was scraped into the suspension medium (MT + malt extract 0.5 g / L + glutamine 1.5 g / L), 50 mg / mL acetosyringone was added to the suspension medium, and the bacterial solution concentration was adjusted to OD 600=0.6-0.8, incubate statically in a 28°C incubator for 1h. During infection, cut the epicotyls of sterile seedlings of citrus (Carrizo orange) into stem segments of about 1cm, place the stem segments in a suspension containing Agrobacterium, shake and infect for 10min, and let stand for 10min. Pour out the bacterial solution, and use sterile filter paper to absorb the bacterial solution on the surface of the stem segments. Then transfer the stem segments to co-culture medium (MT+BA0.5mg / L+KT 0.5mg / L+NAA 0.1mg / L+acetosyringone 50mg / mL) and co-culture in a 23°C incubator for 3d. After co-culture is completed, transfer the stem segments to the screening medium (MT+BA 0.5mg / L+KT 0.5mg / L+NAA 0.1mg / L+kanamycin50mg / mL) and culture in the dark in a 28°C incubator for 7d, and then transfer to light for culture. When the regenerated buds grow at least two leaves, positive plants with GFP fluorescence are screened according to fluorescence, and the positive buds can be cut off for further rooting culture or grafting. When the positive seedlings grow to a certain height, some leaves are taken to extract DNA for Hi-Tom detection to detect the gene editing of the target. The fully edited positive plants are selected as csmyb62 plants with the citrus CsMYB62 gene knocked out.

[0050] Example 3: Phenotypic evaluation of csmyb62 plants after CsMYB62 gene editing in citrus

[0051] A total of 10 positive plants were obtained, of which 6 csmyb62 plants had completely edited the citrus CsMYB62 gene. Figure 2 As shown, the thorns of citrus branches with complete knockout of the CsMYB62 gene became short and soft, while other parts of the plant developed normally, and the growth and development of other parts of the plant were not affected.

[0052] To further quantify the thorn phenotype of csmyb62 plants, the lengths of thorns of 50 csmyb62 plants from six independent transgenic lines and the corresponding WT plants were counted. Figure 3 As shown in a and b, the average length of 50 csmyb62 plant thorns was 6.28 mm, which was significantly shorter than the average length of WT thorns of 15.35 mm. At the same time, the hardness of csmyb62 plant thorns was measured using a texture analyzer, and a total of 9 thorns from 3 independent transgenic lines were counted. The average hardness of csmyb62 plant thorns was 1.06 N, which was significantly lower than the average hardness of WT thorns of 3.05 N ( Figure 3 c, d). The thorns of citrus branches with complete knockout of CsMYB62 gene became shorter and softer compared with WT.

[0053] Example 4: Determination of physiological indicators of branch thorns in csmyb62 plants after gene editing of citrus CsMYB62 gene

[0054] The thorns of 6-month-old csmyb62 plants and WT plants were taken, and the lignin and cellulose content of the thorns of WT plants and csmyb62 plants was detected using a lignin and cellulose assay kit. Figure 4 As shown in a and b, the content of lignin and cellulose in the branches of csmyb62 plants was significantly lower than that of their corresponding WT. At the same time, the content of lignin monomers in the branches of WT and csmyb62 plants was measured, and the results were ( Figure 4 c) shows that in csmyb62 plants, the content of H-lignin monomers is almost unchanged compared with WT, while the content of G- and S-lignin monomers is reduced by 4-5 times compared with WT, indicating that the reason why the branches of csmyb62 plants become soft is partly due to the decrease in the content of lignin and cellulose in the branches.

[0055] Example 5: Comparison of secondary cell walls of branch thorns between csmyb62 plants and WT plants after gene editing of the citrus CsMYB62 gene

[0056] The thorns of csmyb62 and WT plants with a length of 1-2 cm were cut into slices with a thickness of 50 μm using a vibrating microtome. The slices were placed in a 2% phloroglucinol solution (dissolved in 95% ethanol) for staining for 2 min and then observed under a microscope. Figure 5 As shown in a and b, the tip of the thorn of the WT plant accumulated a large amount of lignin, showing a distinct bright red color, while the base accumulated relatively less lignin. In the thorn of the csmyb62 plant, the accumulation of lignin was significantly reduced, the accumulation of lignin in the interfascicular fibers disappeared, and only some of the vessels accumulated lignin.

[0057] Further transmission electron microscopy observations were performed on the tips of the branch spines of csmyb62 plants and WT plants. More than 30 fields of view were photographed for each material, and 50 cell wall thicknesses were measured for each material. Figure 5 As shown in c and d, the secondary wall of the cell wall at the thorn tip of the WT plant is obviously thickened, and the average thickness of the cell wall is about 1.1 μm; while in the branch thorns of the csmyb62 plant, the thickness of the cell wall at the thorn tip is about 0.2 μm, which is significantly lower than that of the WT. This indicates that the softening of the branch thorns of the csmyb62 plant is caused by the reduction of the secondary wall thickening at the thorn tip.

[0058] In summary, the present invention uses gene editing to knock out the CsMYB62 gene, which can significantly reduce the length and hardness of citrus branch thorns, and does not affect the normal growth of transgenic plants. Therefore, this gene can be used as an important candidate gene for breeding citrus varieties with weakened branch thorns. The present invention can provide an important theoretical basis and gene resources for the genetic improvement of citrus branch thorn traits.

Claims

1. A citrus CsMYB62 gene, characterized in that: The nucleotide sequence of the citrus CsMYB62 gene is shown in SEQ ID NO: 1 or the nucleotide sequence shown in SEQ ID NO: 1 is replaced, deleted or added with one or several nucleotides and has a nucleotide sequence encoding an equivalent active protein.

2. Use of the citrus CsMYB62 gene according to claim 1 in softening citrus branch thorns.

3. The use according to claim 2, characterized in that: The application is achieved by reducing or eliminating the activity of the citrus CsMYB62 gene.

4. The use according to claim 2, characterized in that: The application is achieved by knocking down or knocking out the citrus CsMYB62 gene.

5. A method for softening citrus thorns, characterized in that: The method is to reduce or eliminate the activity of the citrus CsMYB62 gene described in claim 1.

6. The method for softening citrus thorns according to claim 5, characterized in that: The method described is to knock down or knock out the citrus CsMYB62 gene.

7. The method for softening citrus thorns according to claim 5, characterized in that: The method comprises the following steps: (1) Design the target sequence targeting the citrus CsMYB62 gene; (2) Construction of a gene editing vector targeting the citrus CsMYB62 gene; (3) The gene editing vector targeting the citrus CsMYB62 gene was used to transform citrus, and plants in which the citrus CsMYB62 gene was knocked out were obtained through screening.

8. The method according to claim 7, characterized in that: In step (1), the targets targeting the citrus CsMYB62 gene are target 1 with a nucleotide sequence of SEQ ID NO: 2 and target 2 with a nucleotide sequence of SEQ ID NO: 3; the primers of gRNA1 targeting target 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NOs: 4 and 5, respectively, and the primers of gRNA2 targeting target 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NOs: 6 and 7, respectively.

9. Use of the citrus CsMYB62 gene according to claim 1 in breeding citrus varieties with weakened branch thorns.

10. The use according to claim 9, characterized in that: The citrus variety with weakened branch thorns is a citrus variety with reduced or inactivated CsMYB62 gene activity.

Images