An industrial hemp bipartite virus gene and its application

Abstract

The present invention belongs to the technical field of plant virus detection, and specifically relates to an industrial hemp bipartite virus gene and its application. The virus gene has two dsRNAs. The sequence of dsRNA1 is shown in SEQ ID NO:1, and the sequence of dsRNA2 is shown in SEQ ID NO:2. The present invention provides the industrial hemp bipartite virus gene sequence. By using the sequence provided by the present invention and adopting existing technical means, primers, kits or antibody proteins prepared for detecting the virus can be used in multiple scenarios such as cultivating virus-free industrial hemp seedlings, detecting high-quality industrial hemp seeds, and detecting industrial hemp diseases, for rapid diagnosis and timely prevention and control of the disease.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant virus detection, and particularly relates to an industrial hemp bipartite virus gene and its application. Background Art

[0002] Industrial Hemp refers to a type of hemp variety in which the content of tetrahydrocannabinol (THC) in the dry matter of the hemp plant is less than 0.3%. Industrial Hemp is "treasure" all over. Its stems can be made into plant fibers, its flowers and leaves can extract CBD, its seeds can be refined into edible oil and protein powder, and it can be made into Chinese herbal medicine and used in cosmetics. The extensive applications of Industrial Hemp in multiple fields are gradually being recognized, developed and utilized by people. Yunnan is one of the two provinces in China that allows the cultivation of Industrial Hemp. Under the supervision of the public security, it can be legally promoted and utilized. The cultivation of Industrial Hemp spreads across 38 counties in 13 states. During the cultivation, it is found that Industrial Hemp shows symptoms such as mosaic yellowing, leaf chlorosis, vein clearing and small leaves, leaf dwarfing, and plant death, which has brought certain losses to the quality and yield of Industrial Hemp. After research, it is found that the cause of the disease is a bipartite virus.

[0003] Partitiviridae is a type of virus with a double-stranded RNA (dsRNA) genome. The genome fragment length is about 1.3 - 2.5 kb. Each of the two dsRNAs has and only has 1 open reading frame. dsRNA1 is responsible for encoding RNA-dependent RNA polymerase (RdRp), while dsRNA2 is mainly responsible for encoding coat protein (cp). Partitiviridae has been proven to infect a wide range of hosts, including plants, fungi and protozoa. The yield and quality of the infected plants and crops will decline. Partitiviridae vertically transmits the virus from the mother to the offspring, and it exists in both asexual and sexual reproduction. In asexual reproduction, the roots, stems, leaves, callus, etc. of the mother plant contain the virus. After culturing with roots, stems, leaves, and callus, the newly generated plants will carry the virus. Most higher plants reproduce sexually. During this process, if the mother plant carries the virus, the virus will be transmitted along with the seeds. The prevention and control of the virus are extremely difficult, and there is still no completely effective method so far. Therefore, isolating and identifying the industrial hemp bipartite virus and its genome is an important means for rapid diagnosis of this disease, strengthening the early detection of the virus, cultivating virus-free industrial hemp seedlings, and preventing and controlling industrial hemp virus diseases. Summary of the Invention

[0004] The purpose of the present invention is to provide an industrial hemp bipartite virus gene and to provide the application of this industrial hemp bipartite virus gene. Specifically, the present invention provides the following technical solutions:

[0005] On the one hand, the present invention provides an industrial hemp bipartite virus gene, which has two dsRNAs. The sequence of dsRNA1 is as shown in SEQ ID NO:1, and the sequence of dsRNA2 is as shown in SEQ ID NO:2.

[0006] Furthermore, the present invention provides a product for detecting the bipartite virus gene, which has two dsRNAs. The sequence of dsRNA1 is as shown in SEQ ID NO:1, and the sequence of dsRNA2 is as shown in SEQ ID NO:2.

[0007] Furthermore, the product is a specific primer. It should be understood that those skilled in the art can design primers that conform to the detection principle by using online tools such as Primer3, SnapGene, Benchling, etc. according to the virus gene sequences provided by the present invention and corresponding detection methods.

[0008] The full-length genomic sequence or its fragment of the present invention can generally be obtained by PCR amplification, recombination or artificial synthesis methods. For the PCR amplification method, primers can be designed according to the nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and a cDNA library prepared by conventional methods known to those skilled in the art can be used as a template for amplification to obtain the relevant sequences. When the sequence is relatively long, it is often necessary to perform PCR amplification twice or multiple times, and then splice the fragments amplified each time together in the correct order.

[0009] In a specific embodiment, in the product, the specific primer sequences for detecting dsRNA1 are as shown in SEQ ID NO:3, 4, 9 or 11; the specific primer sequences for detecting dsRNA2 are as shown in SEQ ID NO:5, 6, 7, 8, 10, or 12.

[0010] Furthermore, the product is a kit. The kit contains any one of the primer sequences shown in SEQ ID NO:3 to 12. In a specific embodiment, the kit is an RT reaction kit, including reagents such as primers, reverse transcriptase, RT reaction buffer and substrates. In another specific embodiment, the kit is a PCR reaction kit, including reagents such as primers, Tag DNA polymerase, PCR reaction buffer and substrates.

[0011] Furthermore, the present invention provides the application of the product in cultivating virus-free industrial hemp seedlings, detecting high-quality industrial hemp seeds or detecting industrial hemp diseases.

[0012] Furthermore, the present invention provides the use of the bipartite virus gene in the preparation of primers, probes or kits for detecting the industrial hemp bipartite virus, or for expression vector construction, gene editing, or for the preparation of antibodies against the industrial hemp bipartite virus. The virus gene has two dsRNAs. The sequence of dsRNA1 is as shown in SEQ ID NO:1, and the sequence of dsRNA2 is as shown in SEQ ID NO:2. In some specific embodiments, the industrial hemp bipartite virus gene provided by the present invention, namely the viral antigen or its antigenic fragment, can be used in immunoassays to detect antibody levels (or conversely, antiviral antibodies can be used to detect antigen levels). According to well-defined immunoassays, recombinant antigens can be developed to replace invasive diagnostic methods. Antibodies against viral proteins or their fragments in industrial hemp samples can be detected. The design of immunoassays can vary widely, and various protocols are known in the art. The protocols of immunoassays can be based on, for example, competitive, direct reaction or sandwich-type assays. The protocols can also employ, for example, solid supports, or immunoprecipitation methods can be used. Most assays involve the use of labeled antibodies or polypeptides; the label can be, for example, a fluorescent label, a chemiluminescent label, a radioactivity label or a dye molecule. Assays for amplifying probe signals are also known; examples are assays using biotin and avidin, enzyme-labeled and mediated immunoassays such as ELISA assays.

[0013] Furthermore, the present invention provides a method for detecting an industrial hemp bipartite virus gene, comprising the following steps:

[0014] (1) Extracting the total RNA of the sample to be tested;

[0015] (2) Using reverse transcriptase to reverse transcribe the extracted RNA into cDNA; continuing to use the cDNA as a template, and performing PCR amplification cloning and sequencing under the action of DNA polymerase to obtain a specific fragment;

[0016] (3) Analyzing the PCR product by electrophoresis to observe whether a band corresponding to the expected size appears, thereby determining whether the target viral RNA is contained in the sample; or using qRT-PCR, that is, adding a fluorescent probe or dye during the PCR process, and determining the presence and relative amount of viral RNA in the sample by analyzing the change of the fluorescent signal.

[0017] The virus gene sequence is as shown in SEQ ID NO:1 and / or as shown in SEQ ID NO:2.

[0018] Furthermore, the present invention provides an isolated nucleic acid molecule, which is cDNA obtained by reverse transcribing the virus gene, and the virus gene sequence is as shown in SEQ ID NO:1 and / or as shown in SEQ ID NO:2.

[0019] The technical effects achieved by the present invention:

[0020] The industrial hemp virus causes symptoms such as yellowing of industrial hemp flowers, chlorosis of leaves, leaf dwarfing, and poor development of mosaic leaves, resulting in the death of industrial hemp, which has brought serious economic losses to industrial hemp planting enterprises. Through the macro-genome sequencing of diseased plants and the comparative analysis of genomic sequences, the invention identified and isolated the bipartite virus of industrial hemp that causes industrial hemp diseases. This virus was first isolated from diseased industrial hemp by the inventor, and the genomic sequence information and functional genes of this virus have not been reported at home and abroad. The acquisition of the genomic sequence of this virus is of great significance for understanding the virus source, evolution process, and molecular epidemiology. At the same time, it also lays a foundation for the differential diagnosis of this disease and the development of disease-resistant genes, with huge economic and social benefits.

[0021] The invention provides the gene sequence of the bipartite virus of industrial hemp. Using the sequence provided by the invention and adopting existing technical means, primers, kits, or antibody proteins for detecting this virus can be prepared, which can be used in multiple scenarios such as cultivating virus-free industrial hemp seedlings, detecting high-quality industrial hemp seeds, and detecting industrial hemp diseases, for rapid diagnosis and timely prevention and control of this disease. Brief Description of the Drawings

[0022] Figure 1 It is a diagram of the traits of industrial hemp plants infected with the bipartite virus collected from the planting field in the present invention;

[0023] Figure 2 It is a diagram of the traits of industrial hemp plants after inoculating the bipartite virus in the laboratory in the present invention. Detailed Embodiments

[0024] The following further illustrates the present invention with reference to embodiments, but the present invention is not limited in any way. Any transformation or substitution based on the teachings of the present invention falls within the protection scope of the present invention.

[0025] The industrial hemp bipartite virus gene sequence provided by the present invention consists of two dsRNAs. The dsRNA1 sequence is as shown in SEQ ID NO:1, and the dsRNA2 sequence is as shown in SEQ ID NO:2. According to the results of high-throughput sequencing analysis, contigs sequences related to each virus are obtained. These contigs are subjected to BLAST alignment using NCBI, and the homologous virus with the highest sequence identity is selected from the results as the reference sequence. Several pairs of specific primers are designed using the software Premier 5 based on the viral contigs genomic sequence to amplify the industrial hemp bipartite virus and verify the correctness of the de novo assembled virus sequence (Table 1). According to the virus gene sequence and primers of the present invention, techniques such as reverse transcription polymerase chain reaction (RT-PCR) and multiplex real-time fluorescence quantitative PCR (RT-qPCR) can be selectively used to detect the industrial hemp samples to be tested.

[0026] The following further illustrates the present invention with specific examples: Example 1

[0027] Detection and verification of industrial hemp bipartite virus

[0028] 1. Materials

[0029] Two hemp samples were collected from the Xiaoshao base in Yunnan Province. One showed leaf chlorosis, vein clearing, small leaves, and dwarfing; the other showed mosaic yellowing and chlorosis ( Figure 1 ).

[0030] 2. RT-PCR, RACE and sequencing

[0031] 2.1 RT-PCR

[0032] (1) Total RNA extraction and reverse transcription of industrial hemp samples

[0033] The total RNA of industrial hemp samples was extracted using the Eastep® Super Total RNA Extraction Kit (Promega, Shanghai), and reverse cDNA was synthesized using the Hifair® III Ist Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen, Shanghai, China).

[0034] (2) PCR reaction

[0035] PCR reaction system (50uL):

[0036] 2×Hiffer® Robust PCR master Mix (Yeasen, Shanghai, China) 25uL,

[0037] 1 μL each of VCV-RNA1F / VCV-RNA2-1F / VCV-RNA2-2F (10 pmol / L)

[0038] 1 μL each of VCV-RNA1R / VCV-RNA2-1R / VCV-RNA2-2R (10 mol / L)

[0039] 5 μL of cDNA template

[0040] ddH 2 0 18 μL.

[0041] Amplification conditions: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, 33 cycles; extension at 72°C for 5 min. After the amplified products were detected by 1% agarose gel electrophoresis, they were purified and recovered, and sent to the Kunming Branch of Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The sequenced returned sequences were processed, analyzed and assembled using DNAMAN 5.0, and thus 2 industrial hemp bipartite virus dsRNA1 sequences as shown in SEQ ID NO:1 and dsRNA2 sequences as shown in SEQ ID NO:2 were obtained.

[0042] 2.2 RACE verification

[0043] According to the manufacturer's instructions, the SMARTer RACE 5′ / 3′ kit (Accurate Biotechnology, Hunan, China) was used to amplify the 5' and 3' terminal sequences of the industrial hemp bipartite virus according to the designed 5′RACE specific primers (SEQ ID NO:11 or 12) and 3′RACE specific primers (SEQ ID NO:9 or 10), and the specific sequences are shown in Table 1.

[0044] First, use the kit Evo M-MLV RTase for RACE from Aikrui Bioengineering (Hunan) Co., Ltd. to reverse transcribe and synthesize the first-strand cDNA. Convert the total RNA into cDNA. The reaction system for 20 μL of 3′RACE cDNA includes 2 μL of total RNA, 1 μL of 3’RACE RT Primer, and 8.5 μL of Nuclease free water; the reaction system for 20 μL of 5′RACE cDNA includes 2 μL of total RNA, 1 μL of 5’RACE RT Primer, and 7.5 μL of Nuclease free water. Subsequently, incubate at 72 °C for 3 min and let it stand on ice for two minutes. Add 4 μL of 5X RACE RT Buffer, 2 μL of dNTP Mix, 0.5 μL of RNase Inhibitor, and 2 μL of Evo M-MLV RTase for RACE to 11.5 μL of 3′RACE cDNA and 10.5 μL of 5′RACE cDNA systems respectively. Additionally, add 1 μL of Template Switching Oligo to the 5′RACE cDNA system to form a 20 μL system, and incubate at 42 °C for 90 min and 72 °C for 15 min.

[0045] Subsequently, use the cDNA and the dual-virus of industrial hemp to design 5′ and 3′ specific primers for PCR. The 50 μL reaction contains 3 μL of cDNA, 1 μL of Universal Short Primer, 1 μL of 5′ specific primer (SEQ ID NO:11 or 12) and 3′ specific primer (SEQ ID NO:9 or 10), 20 μL of 5X L-Exp Taq PCR Buffer, 0.5 μL of L-Exp Taq HS DNA Polymerase, 2 μL of dNTP Mix, 20.5 μL of ddH 2 0.

[0046] Amplification conditions: pre-denaturation at 94°C for 1 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 3 min, 30 cycles; extension at 72°C for 5 min. After the amplified products were detected by 1% agarose gel electrophoresis, they were purified and recovered, and then ligated to the pMD18-T cloning vector (TaKaRa), and then heat-shock transformed into Escherichia coli DH5α (TaKaRa). After screening on MacConkey medium containing ampicillin, it was sent to the Kunming Branch of Beijing Tsingke Biotechnology Co., Ltd. for sequencing. DNAMAN 5.0 was used for sequence processing and analysis to obtain the complete 5' and 3' sequences. Through sequence alignment and analysis, the results showed that the sequences of SEQ ID NO:1 and SEQ ID NO:2 provided by the present invention were correct.

[0047] Table 1 Primers for RT-PCR amplification of bipartite virus of industrial hemp

[0048] Serial number Primer name Primer sequence (5′ to 3′) Primer start position SEQ ID NO:3 VCV-RNA1F TGTTATAGACGTTGAGAACGGGT 447 SEQ ID NO:4 VCV-RNA1R GATGTTCGTCCAAGGAAACTGAT 1342 SEQ ID NO:5 VCV-RNA2-1F AACAGCAGACCCGCACAGGAATC 222 SEQ ID NO:6 VCV-RNA2-1R TCGGCCAGTGTAGCTTGAGGAAA 816 SEQ ID NO:7 VCV-RNA2-2F TAACAGCAATGAAACACCTCAAAGT 774 SEQ ID NO:8 VCV-RNA2-2R CTTCCTTAACGAAGATGAACTGTG 1646 SEQ ID NO:9 3′RACEVCV-RNA1F TCCCGAATACCCTGTCGAAAC 1419 SEQ ID NO:10 3′RACEVCV-RNA2F ACAGACATTCACACCCAGTCAGCCT 1412 SEQ ID NO:11 5′RACEVCV-RNA1R ACCTCCTTTAGGTCCTTTCTCG 567 SEQ ID NO:12 5′RACEVCV-RNA2R CATGTCGAGACGTAGATTCTAGCCG 465 Universal Short Primer, 3’RACE RT Primer, 5’RACE RT Primer Provided by the kit Example 2

[0049] Detection method for bipartite virus of industrial hemp

[0050] A detection method for the gene of bipartite virus of industrial hemp, comprising the following steps:

[0051] (1) Extract total RNA of the sample to be tested: Use the Eastep® Super total RNA extraction kit (Promega, Shanghai) to extract the total RNA of industrial hemp samples.

[0052] (2) Use reverse transcriptase to reverse transcribe the extracted RNA into cDNA, and use Hifair® III Ist Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen, Shanghai, China) to reverse transcribe cDNA;

[0053] Continue to use cDNA as a template, and perform PCR amplification cloning and sequencing under the action of DNA polymerase to obtain a specific fragment;

[0054] PCR reaction system (50 μL):

[0055] 2×Hiffer® Robust PCR master Mix (Yeasen, Shanghai, China) 25 μL,

[0056] VCV-RNA1F / VCV-RNA2-2F each (10 pmol / L) 1 μL,

[0057] 1 μL each of VCV-RNA1R and VCV-RNA2-2R (10 mol / L respectively),

[0058] 5 μL of cDNA template,

[0059] ddH 2 0 18 μL.

[0060] Amplification conditions: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, 33 cycles; extension at 72°C for 5 min.

[0061] (3) Analyze the PCR products by 1% agarose gel electrophoresis to observe whether there are bands corresponding to the expected size, so as to judge whether the target virus RNA is contained in the sample.

[0062] Using the above method, by detecting 20 samples of industrial hemp inoculated with the virus ( Figure 2 ), the detection results are all consistent with the expectations, indicating that the established RT-PCR detection technology system can be used for virus detection of industrial hemp field samples.

[0063] The above-described embodiments are only a preferred solution of the present invention, but they are not intended to limit the present invention. Those skilled in the relevant art can still make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, all technical solutions obtained by means of equivalent replacement or equivalent transformation fall within the protection scope of the present invention.

Claims

1. An industrial hemp bipartite virus gene, wherein the virus gene has two dsRNAs, the dsRNA1 sequence is shown in SEQ ID NO: 1, and the dsRNA2 sequence is shown in SEQ ID NO:

2.

2. A product for detecting bipartite virus genes, characterized in that: The viral gene has two dsRNAs, the dsRNA1 sequence is shown in SEQ ID NO:1, and the dsRNA2 sequence is shown in SEQ ID NO:

2.

3. The product according to claim 2, characterized in that The product is a specific primer.

4. The product according to claim 3, characterized in that The specific primer sequence for detecting dsRNA1 is shown in SEQ ID NO: 3, 4, 9 or 11; the specific primer sequence for detecting dsRNA2 is shown in SEQ ID NO: 5, 6, 7, 8, 10 or 12.

5. The product according to claim 2, characterized in that The product is a test kit.

6. The product according to claim 5, characterized in that The kit contains any one of the primer sequences shown in SEQ ID NOs: 3 to 12.

7. Use of the product according to any one of claims 2 to 6 in the detection of industrial hemp dipartite virus infection.

8. Use of the bipartite virus gene in preparing primers, probes or kits for detecting industrial hemp bipartite virus, or in constructing expression vectors, gene editing, or in preparing antibodies against industrial hemp bipartite virus, characterized in that: The viral gene has two dsRNAs, the dsRNA1 sequence is shown in SEQ ID NO:1, and the dsRNA2 sequence is shown in SEQ ID NO:

2.

9. A method for detecting industrial hemp bipartite virus genes, characterized in that: The following steps are involved: (1) Extracting total RNA from the sample to be tested; (2) Using reverse transcriptase to reverse transcribe the extracted RNA into cDNA; using cDNA as a template, PCR amplification, cloning, and sequencing are performed under the action of DNA polymerase to obtain specific fragments; (3) Analyze PCR products by electrophoresis or add fluorescent probes or dyes during the PCR process to determine the presence and relative amount of viral RNA in the sample by analyzing the changes in the fluorescent signal; The viral gene sequence is shown in SEQ ID NO: 1 and / or SEQ ID NO:

2.

10. An isolated nucleic acid molecule, characterized in that The nucleic acid molecule is cDNA obtained by reverse transcription of viral genes, and the viral gene sequence is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

Images