Application of Cotton GhDRP2 Gene in Negatively Regulating Cotton Drought Resistance
By cloning and studying the GhDRP2 gene in cotton, using gene silencing and editing technology, the problem of insufficient drought resistance in cotton was solved, significantly improving the drought resistance and survival rate of cotton, and providing a new method for drought resistance breeding in cotton.
Patent Information
- Application Number
- CN202510450786.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-04-11
AI Technical Summary
Cotton is limited in growth and development under drought stress, affecting yield and quality. It is difficult for the existing technology to effectively improve the drought resistance of cotton.
By cloning and studying the cotton GhDRP2 gene, it was found that it was negatively correlated with cotton drought resistance. Virus-induced gene silencing technology (VIGS) and CRISPR/Cas9 technology were used to silen or knock out the GhDRP2 gene respectively, thereby improving the drought resistance of cotton.
By silencing or knocking out the GhDRP2 gene, drought resistance and survival of cotton are significantly enhanced, providing a new method to cultivate new cotton varieties with strong drought resistance.
Smart Images

Figure CN119955848B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of cotton GhDRP2 genes in negatively regulating cotton drought resistance. Background Art
[0002] Drought stress seriously affects the growth and development of plants. Plants respond to drought stress by improving root architecture and regulating stomatal closure. As an important cash crop, cotton occupies an important position in agricultural production. However, drought stress seriously affects the growth, development, yield, and quality of cotton. Exploring the drought resistance of cotton is of great significance for increasing yield, optimizing water resource utilization, enhancing environmental adaptability, reducing production costs, promoting sustainable development, ensuring food security, and driving scientific and technological progress.
[0003] Ubiquitin (Ub) is a small molecule protein composed of 76 amino acids with a molecular weight of approximately 8.5 kDa. It is widely present in all eukaryotic cells and has a highly conserved sequence, differing by only 3 amino acids from yeast to humans (Trenner et al., 2022). Ubiquitination is a common post-translational modification in cells that determines the specific degradation of substrate proteins via the 26S proteasome, or changes the intracellular localization, protein activity, and interaction with other proteins, thereby promoting or inhibiting the cascade reactions of corresponding signaling pathways. There are thousands of genes encoding ubiquitin ligases in Arabidopsis thaliana. As a class of U-box type ubiquitin ligases, some members of PUBs have been reported to play functions in plant responses to drought stress, cold stress, etc. (Chen et al., 2021; Wang et al., 2023; Cho et al., 2008), but GhDRP2 reports on cotton genes related to drought resistance have not been seen yet. Summary of the Invention
[0004] The purpose of the present invention is to provide the application of cotton GhDRP2 genes in negatively regulating cotton drought resistance.
[0005] To achieve the above purpose, the technical solution of the present invention is as follows:
[0006] The present invention finds a cotton GhDRP2A gene, whose gene sequence number (Sequence ID) in the cotton genome database Cotton MD (https: / / yanglab.hzau.edu.cn / CottonMD) is Gh_D02G2292, its CDS sequence is as shown in SEQ ID NO.1, the coding sequence length is 1923 bp, including 640 amino acids, and the amino acid sequence is as shown in SEQ ID NO.2.
[0007] Through the cloning and preliminary research of the cotton GhDRP2 gene, the inventors found that GhDRP2 the gene has a certain relationship with the drought resistance of cotton. Further research found that after silencing or knocking out the GhDRP2 gene, the drought resistance of cotton plants is enhanced, that is, the GhDRP2 gene is negatively correlated with the drought resistance of cotton. It can lay a certain genetic resource foundation for the cultivation of new cotton varieties with drought resistance.
[0008] The function of the gene protected by the present invention not only includes the above GhDRP2 gene, but also includes the function of homologous genes with high homology (homology up to more than 85%) with the GhDRP2 gene in response to drought in their corresponding plants.
[0009] The present invention also provides a method for improving the drought resistance of cotton. The method is to obtain plants with stronger drought resistance than the target plant by inhibiting or reducing the expression of the GhDRP2 gene in cotton. The nucleotide sequence of the GhDRP2 gene is as shown in SEQ ID NO.1, and the target plant is cotton.
[0010] The way to inhibit or reduce the expression of the GhDRP2 gene in cotton is to silence or knock out the GhDRP2 gene. Silencing the GhDRP2 gene can use virus-induced gene silencing (VIGS) technology, and knocking out the GhDRP2 gene can use CRISPR / Cas9 technology.
[0011] In addition, in order to improve the excellent traits of cotton, a new cotton breeding method is also provided. The method is: silence or knock out the GhDRP2 gene in cotton to obtain cotton plants with enhanced drought resistance.
[0012] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants described can be (but not limited to): dicotyledonous plants, monocotyledonous plants or gymnosperms.
[0013] As a preferred embodiment, the "plant" includes, but is not limited to: cotton, especially Gossypium hirsutum ( Gossypium hirsutum ), and any plant having this gene or a homologous gene thereto is applicable.
[0014] The "plant" referred to in the present invention includes the whole plant, its parental and progeny plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and the target gene or nucleic acid is present in these different parts. The "plant" mentioned herein also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores. Similarly, each of the foregoing objects contains the target gene / nucleic acid.
[0015] The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and their propagules. This patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the progeny exhibit the same genotype or phenotypic characteristics, and the progeny characteristics obtained using the methods in this patent are the same.
[0016] The present invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It further relates to other derivatives after the plants are harvested, such as dry granules or powders, oils, fats and fatty acids, starches or proteins.
[0017] Advantages of the present invention:
[0018] In the present invention, the gene in cotton is interfered by virus-induced gene silencing (VIGS) technology, and after interfering with the GhDRP2 gene, the drought resistance of cotton is significantly enhanced and the survival rate of cotton is increased. In addition, the CRISPR / Cas9 technology is also used to create GhDRP2 gene-edited materials. The results show that GhDRP2 the gene-edited materials ( GhDRP2 mutant plants) have improved drought resistance compared to the wild type. It can be seen that ghdrp2 the GhDRP2 gene is negatively correlated with the drought resistance of cotton. Therefore, new cotton drought-resistant varieties can be cultivated by silencing or knocking out the GhDRP2 gene, providing a new method for cotton drought-resistant breeding and having great application value.
[0019] The present invention first reveals the important role of the GhDRP2 gene in plant drought resistance, providing a new theoretical basis for in-depth study of the molecular mechanism of plant drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 : GhDRP2 Expression patterns of genes in two cotton varieties, ZY007 (drought-tolerant) and ZY168 (sensitive), under drought treatment conditions (the left black bar graph represents normal leaves; the right gray bar graph represents drought-stressed leaves. ns: no significant difference; *: significant difference; **: extremely significant difference).
[0021] Figure 2 : Panel a is TRV:GhDRP2 Agrobacterium detection nucleic acid gel electrophoresis map; Panel b is the RT-PCR acid gel electrophoresis map for interference efficiency detection; Panel c is the bar graph of the QRT-PCR results for interference efficiency detection ( TRV:00 : The left black bar graph, TRV: GhDRP2 : The right gray bar graph, ***: extremely significant difference).
[0022] Figure 3 : Panel a shows the growth status of control plants TRV:00 and silenced plants TRV:GhDRP2 under conditions of sufficient water, 10 days of drought, and 12 hours of rewatering; Panel b is the positive control, TRV:CLA where the interfered plants (CLA is the key enzyme for chlorophyll synthesis) show albino; Panel c is the bar graph of the statistical results of plant height and survival rate of control plants TRV:00 and silenced plants TRV:GhDRP2 . ( TRV:00 : The left black bar graph, TRV:GhDRP2 : The right gray bar graph. ns: no significant difference; ***: extremely significant difference)
[0023] Figure 4 : Panel a shows the growth status of wild-type plants WT and ghdrp2 mutants under conditions of sufficient water, 10 days of drought, and 12 hours of rewatering; Panel b is the bar graph of the statistical results of plant height and survival rate of wild-type plants WT and 、 mutants. (WT: The left black bar graph, ghdrp2 : The right gray bar graph. ns: no significant difference; ***: extremely significant difference). ghdrp2 : The right gray bar graph. ns: no significant difference; ***: extremely significant difference). Detailed implementation manners
[0024] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the specific experimental methods involved in the following embodiments are all conventional methods or are implemented according to the conditions recommended by the manufacturer's instructions unless otherwise specified.
[0025] Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art. The test methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained by purchasing from the market.
[0026] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred methods and materials described herein are for illustrative purposes only.
[0027] Unless otherwise stated, the implementation of the present invention will use conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. In addition, for the methods such as DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and obtaining gene-edited plants used in the present invention, except for the methods used in the following examples, the methods already disclosed in the existing literature can be used to achieve them.
[0028] As used herein, the terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" mean isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences in non-coding regions, but are not limited thereto. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in the genomic sequence, and / or include the coding sequence in cDNA, and / or include cDNA and its regulatory sequences. In a particular embodiment, for example, regarding an isolated nucleic acid sequence, it is preferably defaulted to be cDNA.
[0029] Through the cloning and preliminary study of the cotton GhDRP2 gene, the inventors found that GhDRP2 the gene has a certain relationship with the drought resistance of cotton. The inventors further confirmed the relationship between the GhDRP2 gene and the drought resistance of cotton by silencing or knocking out the GhDRP2 gene, as follows:
[0030] Example 1: Using VIGS technology to silence the GhDRP2 gene to verify its relationship with the drought resistance of cotton
[0031] I. Construction of TRV: GhDRP2 virus interference vector and VIGS-mediated transformation
[0032] Construction of the VIGS expression vector. According to GhDRP2 the nucleotide sequence of the gene, the following primers were designed, and the primer sequences are shown below:
[0033] Forward primer: GhDRP2-VIGS-F (5’- GCAAAGAGGCGAACAGATACAC-3’)
[0034] Reverse primer: GhDRP2-VIGS-R (5’- TCGATGGTTCGAGTTTAGCCAC-3’).
[0035] Reaction system: 2×Phanta Max Buffer 10 μL, dNTP (10 mM) 0.4 μL, GhDRP2 -VIGS-F 30 mM, GhDRP2 -VIGS-R 30 mM, template (CDNA) 5 μL, Phanta Max Super-Fidelity DNA Polymerase (5 U / μL) 0.1 μL ddH 2 O was made up to 20 μL;
[0036] Amplification program: (95℃, 5 min; 95℃, 30 s; 58℃, 15 s; 72℃, 10 s; 38 cycles; 12℃, 10 min Clone TRV: GhDRP2 gene fragment), the pTRV2 plasmid was double digested with restriction endonucleases Bam H1 and Kpn 1 (purchased from NEB, China) (reaction system: 10×Cutsmart Buffer 5 μL, Bam H1 1 μL, Kpn 1 1 μL, pTRV2 plasmid 2 μg, ddH 2 O was made up to 50 μL; reaction program: 37℃ 3 h).
[0037] The one-step cloning method was used to ligate the PCR product with the digested pTRV2 plasmid fragment:
[0038] (reaction system: 5×CE II Buffer 2 μL, TRV: GhDRP2 gene fragment 100 ng, pTRV2 plasmid digested product 50 ng, Exnase II 1 μL, ddH 2 O was made up to 10 μL; reaction program: 37℃ 30 min);
[0039] The ligation product, i.e., the TRV: GhDRP2 vector, was subjected to heat shock transformation and transferred into Escherichia coli DH5α (purchased from Tiangen Biochemical Technology Co., Ltd.). Single colonies were picked and positive detection was carried out using the primers GhDRP2 -VIGS-F and GhDRP2 -VIGS-R. The positive clones detected were sent to the company for sequencing. After the sequence alignment was correct, the positive clones were propagated and the plasmids were extracted, and then transferred into Agrobacterium tumefaciens GV3101 (purchased from Tiangen Biochemical Technology Co., Ltd.). The positive bacterial liquid was stored at -80 °C for later use after detection.
[0040] For TRV: GhDRP2 Agrobacterium tumefaciens GV3101, the strain was inoculated into LB medium (1 g of peptone, 0.5 g of yeast extract, 0.5 g of NaCl in 100 mL of ultrapure water) at a ratio of 1:10 for activation, at 180 rpm for 10 - 12 h. When the OD of the bacterial liquid 600 reached 1.0 - 1.2, the bacterial liquid was collected into an EP tube and the cells were suspended with a resuspension solution (1 mL of 1 M MES, 1 mL of 1 M MgCl 2 1, 200 μL of 0.1 M AS in 100 mL of sterile water), and adjusted to OD 600 at 0.8 - 1.0. Cotton with cotyledons flattened after growing for about one week under 16 h of light / 8 h of darkness at 23 °C was taken. The pTRV2 bacterial liquid, pTRV: GhDRP2 and pTRV1 bacterial liquid were respectively mixed evenly at a ratio of 1:1 and injected on the back of the cotton cotyledons. The injection area should reach more than 95%. After injection, it was treated in the dark for 12 h and then cultured under normal light.
[0041] II. Detection of the interference efficiency of TRV: GhDRP2
[0042] According to the gene sequence of the TRV: GhDRP2 vector, the primers for its fluorescence quantitative PCR were designed as:
[0043] GhDRP2-qRT-F: ACGAGAACTCTTCGGAGGTGTC;
[0044] GhDRP2-qRT-R: TCGTAGGTCTGTCCAGTTGCC.
[0045] Three biological replicates of true leaves of TRV:00 and TRV:GhDRP2 cotton at the two-leaf and one-heart stage were taken, and cotton RNA was extracted according to the steps and reagents provided by the Polysaccharide and Polyphenol Total Plant RNA Extraction Kit (DP441) of Tiangen Biotech Co., Ltd. The synthesis of cDNA was carried out using total RNA as a template and reverse transcription was performed using ReverTra Ace qPCR RT Kit (Toyobo, Japan). The cDNA samples obtained after reverse transcription were diluted 50-fold for RT-PCR and qRT-PCR reactions, and the gene encoding ubiquitin protein GhUBQ7 was used as an internal reference. The PCR amplification products were detected by 1.2% gel electrophoresis ([[]] Figure 2 a, b). The qRT-PCR experiment was carried out on a Roche LightCycler 96 real-time fluorescence quantitative PCR system. Similarly, [[[]] GhUBQ7 was used as the reference gene and three replicates were set for each reaction. The 2[[[]] −∆Ct method was used to calculate the relative gene expression level ([[]] Figure 2 c). It can be seen that the expression level of the [[[]] GhDRP2 gene in the leaves of the TRV:GhDRP2 interference plants was only 28% of that of the [[[]] GhDRP2 gene in the control TRV:00 plants.
[0046] III. Determination of drought resistance of TRV:GhDRP2 interference materials
[0047] Observing the control TRV:00 and TRV:GhDRP2 interference plants, there was no significant difference in plant height at the two-leaf and one-heart stage. Among them, TRV:CLA is a commonly used positive control in VIGS experiments to verify the effectiveness of the silencing system. The appearance of a typical photobleaching phenotype ([[]] Figure 3 b) indicated that the TRV vector successfully invaded and triggered gene silencing. When the soil water content was 80%, water deficit treatment was carried out. After 10 days of continuous water deficit, the degree of leaf wilting of TRV:GhDRP2 was lighter than that of the control TRV:00 plants. The results showed that the survival rate of the TRV:GhDRP2 interference plants was about twice that of the control TRV:00 plants after drought treatment and rewatering for 24 h ([[]] Figure 3 c). The above results showed that the TRV:GhDRP2 plants showed stronger drought tolerance than the control TRV:00 plants ([[]] Figure 3 a), indicating that [[[]] GhDRP2 negatively regulated cotton drought resistance.
[0048] Example 2 Use of gene editing technology to knockout [[[]] GhDRP2 gene to verify its relationship with cotton drought resistance
[0049] I. GhDRP2 Creation of CRISPR / Cas9 materials for [[[]]
[0050] First, design the target sites containing GhDRP2 gene-specific sequences, namely sgRNAs:
[0051] sgRNA1: GAACTCAAATCCGTCGGAAT;
[0052] sgRNA2: TTTGGGAGACTGTGAAGTGG;
[0053] Primers:
[0054] GhDRP2 -SgRNA1-F: AACTCAAATCCGTCGGAATGTTTTAGAGCTAGAAAT;
[0055] GhDRP2 -SgRNA1-R: ATTCCGACGGATTTGAGTTCAATCTCTTAGTCGACT;
[0056] GhDRP2 -SgRNA2-F: TTTGGGAGACTGTGAAGTGGGTTTTAGAGCTAGAAAT;
[0057] GhDRP2 -SgRNA2-R: CCACTTCACAGTCTCCCAAATGACCAATGTTGCTCC;
[0058] U-F: CTCCGTTTTACCTGTGGAATCG;
[0059] gR-R: CGGAGGAAAATTCCATCCAC.
[0060] The amplification program is: 98°C, 10 s; 68°C, 5 s; 42 cycles; 12°C, 10 min. Clone the gene products containing the pYLgRNA-AtU3b and pYLgRNA-AtU6-29 promoters and sgRNA fragments, and detect them by 1% agarose gel electrophoresis. The second-round PCR amplification uses the first-round PCR product as the template: 20 μL reaction system: 10 μL of 2×KOD Buffer, 20 - 50 ng of the first-round PCR mixed product, 30 / 30 mM of primers Pps-GGL / Pgs-GG2, 30 / 30 mM of Pps-GG2 / Pgs-GGR, and make up to 20 μL with ddH 2 O, mix gently; the primer sequences involved are:
[0061] Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG;
[0062] Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC;
[0063] Pps-GG2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG;
[0064] Pgs-GGR: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC.
[0065] The amplification program was: 98°C, 10 s; 68°C, 5 s; 42 cycles; 12°C, 10 min to clone the complete sgRNA1 / 2 expression cassette. The second-round PCR products were purified and recovered, and the size and concentration of the amplified products were detected by agarose gel electrophoresis. The Cas9 gene and the sgRNA1 / 2 expression cassette were tandemly assembled onto the modified cotton CRISPR / Cas9 vector by the Golden Gate method. 15 μL reaction system: 1.5 μL of 10×CutSmart Buffer, 1.5 μL of 10 mM ATP, 80 - 150 ng of CRISPR / Cas9-P35-N (the gene editing vector was kindly provided by Professor Liu Yaoguang of South China Agricultural University), 20 - 50 ng of the sgRNA expression cassette mixture, Bsa 0.5 μL (10 U) of Ⅰ-HF, 0.2 μL (80 U) of T4DNA Ligase were gently mixed and transformed into Escherichia coli DH5α by heat shock. Screening was carried out using kanamycin resistance. The grown colonies were positively identified with the vector primers SP-L2 (GTCGTGCTCCACATGTTGACCG) and SP-R (CCGACATAGATGCAATAACTTC) for monoclonal colonies. Finally, the monoclonal plasmids with correct sequencing were transformed into Agrobacterium tumefaciens LBA4404, and the hypocotyls of cotton etiolated seedlings were transformed by the Agrobacterium-mediated cotton genetic transformation method. Through a series of processes such as cell dedifferentiation, redifferentiation, and plant regeneration, finally GhDRP2 gene-edited plants were obtained, that is ghdrp2 mutant plants.
[0066] II. ghdrp2 Drought resistance test of mutant plants
[0067] The wild-type WT and ghdrp2 mutant plants at the two-leaf and one-heart stage were subjected to drought treatment, and the results were asFigure 4 As shown: There is no significant difference in plant height between the wild type WT and ghdrp2 the mutant plants. After 10 days of continuous water shortage, the leaves of the wild type plants showed severe wilting, while ghdrp2 the mutant plants grew well and no wilting phenotype was observed in the true leaves. ghdrp2 The survival rate of the mutant plants was about 1.8 times that of the wild type after 24 hours of rewatering.
[0068] It shows that GhDRP2 it negatively regulates the drought resistance of cotton.
[0069] In summary, in the present invention, through virus-induced gene silencing technology (VIGS), the GhDRP2 gene in cotton was interfered, and after the GhDRP2 gene was interfered, the drought resistance of cotton was significantly enhanced and the survival rate of cotton was increased. In addition, CRISPR / Cas9 technology was used to create GhDRP2 gene-edited materials. The results showed that GhDRP2 the gene-edited materials ( ghdrp2 mutant plants) had improved drought resistance compared to the wild type. It can be seen that GhDRP2 the gene is negatively correlated with the drought resistance of cotton. Therefore, new cotton drought-resistant varieties can be cultivated by silencing or knocking out the GhDRP2 gene, providing a new method for cotton drought-resistant breeding.
[0070] The above-described embodiments are only preferred embodiments of the present invention, which are merely used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, of course, other implementation methods can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. Cotton GhDRP2 The application of the gene in negatively regulating drought resistance of cotton is characterized in that: Said GhDRP2 The nucleotide sequence of the gene is shown in SEQ ID NO.
1. GhDRP2 Gene silencing or knockout to enhance drought resistance in cotton plants.
2. The use according to claim 1, characterized in that: silence GhDRP2 Gene knockout using VIGS technology GhDRP2 The gene was modified using CRISPR / Cas9 technology.
3. A method for improving drought resistance of cotton, characterized in that: The method is to silence or knock out the GhDRP2 Gene to obtain cotton plants with enhanced drought resistance; GhDRP2 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
4. A cotton breeding method, characterized in that: The method comprises: GhDRP2 Gene silencing or knockout to obtain cotton plants with enhanced drought resistance, the GhDRP2 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Application of cotton GhTRX134 gene to improving plant drought stress tolerance
CN109825512A
Application of cotton GhRPL2 gene to improving drought stress tolerance of plants
CN109913474A