A method for constructing a dwarfism mouse model and its application

Abstract

The present invention provides a method for constructing a dwarfism mouse model and its application. The method for constructing the dwarfism mouse model provided by the present invention comprises: specifically knocking out the RPS29 gene in mouse chondrocytes, thereby reducing or inhibiting the expression of the RPS29 gene in the mouse chondrocytes, thereby obtaining a dwarfism mouse model. The dwarfism mouse model constructed by the present invention provides a foundation for studying the pathogenesis of dwarfism and for developing, screening, and preparing drugs that alleviate and treat dwarfism.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a construction method and application of a dwarfism mouse model. Background Art

[0002] Achondroplasia is a congenital genetic disease caused by defects in endochondral bone formation. It is also known as fetal chondrodystrophy and chondrodystrophy dwarfism. It is the most common form of human dwarfism. Clinical manifestations include short stature, short limbs, macrocephaly with prominent forehead, and shortening of tubular bones throughout the body. Most children with the disease die in utero or in the neonatal period, or have difficulty surviving after birth. Even if they survive, they will suffer from respiratory disorders, hearing loss, spinal involvement, limb joint deformities and other problems. Patients need lifelong treatment and rehabilitation. Achondroplasia is a rare disease worldwide. Due to the lack of sufficient epidemiological data and clinical research, its diagnostic and treatment methods and effective drugs are extremely limited. Its genetic mechanisms, therapeutic targets and strategies, as well as drug development, are in urgent need of exploration.

[0003] Animal models are important tools for studying disease mechanisms, prevention, and treatment options, as well as identifying potential therapeutic targets and biomarkers. They play a crucial role in studying disease mechanisms and drug development. Therefore, developing an animal model for achondroplasia is a hot topic for those skilled in the art. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a dwarfism mouse model, in particular a method for constructing an achondroplasia dwarfism mouse model.

[0005] In a first aspect, the present invention provides a method for constructing a dwarfism mouse model, comprising: specifically knocking out the RPS29 gene in mouse chondrocytes, reducing or inhibiting the expression level of the RPS29 gene in mouse chondrocytes, and obtaining a dwarfism mouse model.

[0006] In the above method, RPS29 (Ribosomal protein S29) is a ribosomal protein molecule. When the mouse is of C57BL / 6J genetic background, the amino acid sequence of the mouse RPS29 protein is GenBank Accession No. NP_033119.1 (Update Date 2024-01-13). The RPS29 gene (wild-type allele, Rps29 +The genomic sequence is the complement of nucleotides 69204495-69205891 of GenBank ACCESSION No. NC_000078.7 (Update Date 2024-02-07). Nucleotide 69205891 is designated as nucleotide 1 of the RPS29 gene, and nucleotide 69204495 is designated as nucleotide 1397 of the RPS29 gene. This constitutes the DNA fragment with the nucleotide sequence of SEQ ID NO: 1. In the nucleotide sequence of SEQ ID NO: 1, positions 1-121 constitute the first exon sequence, positions 358-457 constitute the second exon sequence, and positions 1297-1397 constitute the third exon sequence.

[0007] Furthermore, the specific knockout of the RPS29 gene in mouse chondrocytes is the specific knockout of the first exon and the second exon in the RPS29 gene in mouse chondrocytes.

[0008] In the above-mentioned method, the specific knockout refers to genetically eliminating the expression of a specific gene at a certain stage of mouse development or in a specific tissue, organ, or cell, while maintaining normal expression of the gene at other stages of mouse development or in other tissues, organs, or cells. For example, chondrocyte-specific knockout of the RPS29 gene only achieves RPS29 gene knockout and protein suppression in chondrocytes, without affecting RPS29 gene expression in other cells. Mouse chondrocyte-specific knockout of the RPS29 gene can be achieved using gene targeting techniques using embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology (TALENs), Cre / loxP technology, and Flp / Frt technology. Furthermore, the mouse chondrocyte-specific knockout of the RPS29 gene is achieved using Cre / loxP technology.

[0009] Furthermore, the method for constructing the dwarfism mouse model includes:

[0010] Step 1: RPS29 conditional gene-targeted mice were mated with mice expressing Cre recombinase specifically in cartilage tissue to obtain F1 generation, and Col2a1-Cre; Rps29 were screened from the F1 generation. fl / + mouse.

[0011] Among them, RPS29 conditional gene targeting mice can be obtained by inserting LoxP sequences upstream and downstream of the RPS29 gene of wild-type mice with a C57BL / 6J genetic background using a targeting vector, and named Rps29 fl / flFurthermore, the mouse is obtained by inserting LoxP sequences upstream of the first exon and downstream of the second exon of the RPS29 gene. fl / fl Rps29 in wild-type mice + The nucleotide segment between the 5'-homology arm (positions 1-1729 in SEQ ID NO: 2) and the 3'-homology arm (positions 3458-5230 in SEQ ID NO: 2) of the allele was replaced with the segment shown in positions 1730-3457 in SEQ ID NO: 2 (as shown by the underlined segment in SEQ ID NO: 2), thereby inserting two LoxP sequences in the same direction into Rps29, respectively. + The conditional gene targeting mouse, Rps29, was obtained by PCR with the front end of 942 bp upstream of the first exon and the back end of 194 bp downstream of the second exon. fl / fl The expression of mouse Rps29 gene is not affected by LoxP sequence.

[0012] The mice that specifically express Cre recombinase in cartilage tissue are Col2a1-Cre transgenic mice. Furthermore, Col2a1-Cre transgenic mice carry the Cre recombinase gene and the promoter region of the mouse type II collagen gene (Col2a1). The Col2a1 gene promoter can activate the Cre recombinase gene to specifically express Cre recombinase in mouse chondrocytes.

[0013] wherein the Col2a1-Cre; Rps29 fl / + One chromosome of the mouse carries the wild-type Rps29 gene Rps29 + , the other chromosome carries Rps29 fl allele, and the Col2a1-Cre; Rps29 fl / + Cre recombinase is specifically expressed in mouse chondrocytes;

[0014] The Rps29 fl The allele changes Rps29 in wild-type mice + The nucleotide segment between the 5'-homologous arm and the 3'-homologous arm of the allele is replaced with the segment shown in positions 1730-3457 in SEQ ID NO: 2, the nucleotide sequence of the 5'-homologous arm is positions 1-1729 in SEQ ID NO: 2, and the nucleotide sequence of the 3'-homologous arm is positions 3458-5230 in SEQ ID NO: 2.

[0015] Step 2: The Col2a1-Cre; Rps29 obtained from the F1 generation fl / +The mice were mated with the RPS29 conditional gene-targeted mice to obtain an F2 generation, and chondrocyte-specific RPS29 gene knockout mice were screened from the F2 generation to obtain a dwarfism mouse model.

[0016] The method as described above further comprises identifying and screening the genotype and phenotype of chondrocyte-specific RPS29 gene knockout mice.

[0017] Furthermore, the method includes identifying the genotype of chondrocyte-specific RPS29 gene knockout mice, specifically designing and identifying PCR amplification primers for Cre recombinase and the RPS29 gene, performing a PCR reaction on the mouse tail genome, and determining the mouse genotype based on the band size of the PCR amplification product.

[0018] Furthermore, the primers used to identify the Col2a1-Cre recombinase gene include a first primer having a nucleotide sequence of SEQ ID NO: 3 and a second primer having a nucleotide sequence of SEQ ID NO: 4:

[0019] SEQ ID NO: 3: 5'-GAGGGTCCAGCCCGAGCTACTT-3';

[0020] SEQ ID NO: 4: 5'-GCATCGACCGGTAATGCAGGC-3'.

[0021] The primers used to identify the RPS29 gene include a third primer having a nucleotide sequence of SEQ ID NO: 5 and a fourth primer having a nucleotide sequence of SEQ ID NO: 6.

[0022] SEQ ID NO: 5'-GGCAGGGCTTTGTGCAATTTTAG-3';

[0023] SEQ ID NO: 6: 5'-CCCAAGACTCTCATTTTGCCCATAAT-3'.

[0024] When the primers used to identify the Col2a1-Cre recombinase gene are used to amplify the genomic DNA of the mouse tail, if a 234bp fragment can be specifically amplified, it is Col2a1-Cre positive, otherwise it is Col2a1-Cre negative; when the primers used to identify the RPS29 gene are used to amplify the genomic DNA of the mouse, if a 323bp fragment can be specifically amplified, it is Rps29 fl / fl Homozygotes, if the 323bp fragment and the 255bp fragment can be specifically amplified, are Rps29 fl / +If a 255 bp fragment can be specifically amplified in a heterozygote, it is Rps29. + / + wild type.

[0025] Furthermore, the method also includes screening the phenotype of chondrocyte-specific RPS29 gene knockout mice. The phenotype of the chondrocyte-specific RPS29 gene knockout mice should be consistent with the phenotype of clinical dwarfism patients; specifically, the method includes measuring the body length of individual chondrocyte-specific RPS29 gene knockout mice and performing skeleton staining, and selecting chondrocyte-specific RPS29 gene knockout mice with short individual lengths and short skeletons and limbs as dwarfism mouse models. The skeleton staining can be Alcian blue-alizarin red staining. If the individual body length of the mouse is short, and the length of the overall skeleton and limbs, especially the long bones of the limbs, is significantly shortened, it is a dwarfism mouse.

[0026] The method as described above, wherein the dwarfism is achondroplasia dwarfism.

[0027] Furthermore, the phenotype of the chondrocyte-specific RPS29 knockout mice should be consistent with the phenotype of clinical achondroplasia dwarfism patients; specifically, the chondrocyte-specific RPS29 knockout mice are measured for body length, skeletal staining, and pathological staining of their bone tissue. Chondrocyte-specific RPS29 knockout mice with short stature, short skeletons and limbs, typical achondroplasia features in the skull, occipital bone, ribs, vertebrae, and long bones, shortened cartilage thickness, and abnormal tissue structure and cell morphology in different regions of the cartilage, such as the resting zone, proliferative zone, and hypertrophic zone, are selected as achondroplasia dwarfism mouse models. The individual body length measurement and skeletal staining are the same as those used in the screening of dwarfism mouse models. The pathological staining is specifically H&E staining and Safranin Fast Green staining. If the forehead, parietal and occipital bones in the skeleton are prominent, the ribs are abnormally curved, and the ossification of the vertebrae in the cervical and lumbar vertebrae and the long bones of the limbs is hindered; the length of the growth plate cartilage is shortened, the arrangement of chondrocytes is abnormal, and the typical chondrocyte column structure disappears; the proliferation zone and hypertrophy zone are narrowed, the morphology is abnormal, and the arrangement is disordered, then it is judged to be a mouse model of achondroplasia dwarfism.

[0028] Furthermore, the screening method for the achondroplasia dwarfism mouse model also includes detecting the proliferation and apoptosis levels of chondrocytes in RPS29 gene knockout mice. If the chondrocytes are disorderly arranged and the proliferation and apoptosis levels are abnormal, the mouse is an achondroplasia dwarfism mouse model.

[0029] In a second aspect, the present invention provides a method for constructing a genetically modified mouse, comprising: specifically knocking out the RPS29 gene in mouse chondrocytes, reducing or inhibiting the expression level of the RPS29 gene in mouse chondrocytes, and obtaining a genetically modified mouse.

[0030] In a third aspect, the present invention provides Col2a1-Cre; Rps29 fl / + The method for constructing mice comprises: mating RPS29 conditional gene targeted mice with mice expressing Cre recombinase specifically in cartilage tissue to obtain F1 generation, and screening Col2a1-Cre from the F1 generation; Rps29 fl / + mouse; Col2a1-Cre; Rps29 fl / + One chromosome of the mouse carries the wild-type Rps29 gene Rps29 + , the other chromosome carries Rps29 fl allele, and the Col2a1-Cre; Rps29 fl / + The mice express Cre recombinase specifically in chondrocytes;

[0031] The Rps29 fl Rps29 in recipient mice + The nucleotide segment between the 5'-homologous arm and the 3'-homologous arm of the allele is replaced with the segment shown in positions 1730-3457 in SEQ ID NO: 2, the nucleotide sequence of the 5'-homologous arm is positions 1-1729 in SEQ ID NO: 2, and the nucleotide sequence of the 3'-homologous arm is positions 3458-5230 in SEQ ID NO: 2.

[0032] The methods for constructing the mice provided in the second and third aspects of the present invention may refer to the methods for constructing the dwarfism mouse model provided in the first aspect of the present invention.

[0033] In a fourth aspect, the present invention provides a method for developing and / or screening and / or preparing a drug for preventing and / or alleviating and / or treating dwarfism, comprising using a dwarfism mouse model constructed according to any of the above methods, or a genetically modified mouse constructed according to the above method, or a Col2a1-Cre; Rps29 constructed according to the above method. fl / + Mice or the steps of RPS29 conditional gene targeting mice involved in the above method.

[0034] In the method described above, the dwarfism may be achondroplasia dwarfism.

[0035] The present invention constructs a dwarfism mouse model by specifically knocking out the RPS29 gene in mouse chondrocytes, reducing or inhibiting the expression of the RPS29 gene in mouse chondrocytes; the constructed dwarfism mouse model conforms to the clinical dwarfism phenotype, providing a basis for the study of the pathogenesis of dwarfism and the development, screening and preparation of drugs to alleviate and treat dwarfism. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of RPS29 gene knockout; Rps29 + The allele is the Rps29 genomic locus in C57BL / 6J background mice, Exon1 is the first exon, Exon2 is the second exon, and Exon3 is the third exon; Rps29 fl The allele is the Rps29 gene locus after targeting, and the Rps29 knockout allele is the gene locus after the first and second exons of Rps29 are knocked out after the Cre recombinase works. Cre represents the Cre recombinase, which can mediate the knockout of the sequence between LoxP.

[0037] Figure 2 Schematic diagram of hybrid construction and genotype identification of chondrocyte-specific Rps29 gene knockout mice; A is a schematic diagram of mouse hybridization; B is a diagram of gene identification results, where 1-6 are mouse samples and 7 is a blank control;

[0038] Figure 3 Figure 2 shows the evaluation of Rps29 knockout efficiency in chondrocyte-specific Rps29 knockout mice; A shows the statistical results of the relative mRNA expression of RPS29 (n=4, ** indicates P<0.01, t-test); B shows the results of the protein expression of RPS29;

[0039] Figure 4 Survival curve analysis and individual appearance images of chondrocyte-specific Rps29 gene knockout mice; A is a survival curve analysis of control mice and chondrocyte-specific Rps29 gene knockout mice (n=12, *** indicates P<0.001, Log-rank test); B is an individual appearance image of control mice and chondrocyte-specific Rps29 gene knockout mice (scale bar, 5 mm); C is a statistical graph of body length of control mice and chondrocyte-specific Rps29 gene knockout mice (n=8, *** indicates P<0.001, t-test);

[0040] Figure 5 Figure 3 shows the results of Alcian blue-alizarin red staining of the skeleton of chondrocyte-specific Rps29 knockout mice. A is a whole-body Alcian blue-alizarin red-stained image of the skeleton of control mice and chondrocyte-specific Rps29 knockout mice (scale bar, 5 mm); C is a local image corresponding to A (scale bar, 1 mm); B is a statistical diagram of the lengths of the humerus, ulna, radius, femur, and tibia of control mice and chondrocyte-specific Rps29 knockout mice (n=5, *** indicates P<0.001, t-test).

[0041] Figure 6Figures 2 and 3 show H&E pathological analysis and Safranin & Fast Green staining analysis of bone tissue from chondrocyte-specific Rps29 knockout mice. Figure A shows H&E staining (upper row) and Safranin & Fast Green staining (lower row) of femur and tibia tissue sections from control mice and chondrocyte-specific Rps29 knockout mice (scale bar, 200 μm). Figure B shows magnified Safranin & Fast Green staining of different regions of femoral and tibial growth plate cartilage from control mice and chondrocyte-specific Rps29 knockout mice (scale bar, 100 μm).

[0042] Figure 7 The results of chondrocyte proliferation level detection in chondrocyte-specific Rps29 gene knockout mice; A is the results of immunohistochemical staining of proliferation marker molecule BrdU in femoral tissue sections of control mice and chondrocyte-specific Rps29 gene knockout mice, as well as BrdU + Cell count results; B is the results of immunohistochemical staining of BrdU, a proliferation marker, in tibial tissue sections of control mice and chondrocyte-specific Rps29 gene knockout mice, as well as BrdU + Cell count results; the part enclosed by the red dotted circle is the growth plate cartilage, scale bar is 200 μm, n=3, ** indicates P < 0.01, *** indicates P < 0.001, t test;

[0043] Figure 8 The results of chondrocyte apoptosis detection in chondrocyte-specific Rps29 gene knockout mice; A is the TUNEL staining result of femoral tissue sections of control mice and chondrocyte-specific Rps29 gene knockout mice; B is the statistical result corresponding to A; C is the TUNEL staining result of tibia tissue sections of control mice and chondrocyte-specific Rps29 gene knockout mice; D is the statistical result corresponding to C; green fluorescence indicates TUNEL-positive signal, blue indicates cell nucleus, scale bar is 200 μm; in B and D, n=3, * indicates P < 0.05, *** indicates P < 0.001, t test. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0045] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0046] All mice used in the following examples were maintained in a specific pathogen-free (SPF) barrier facility accredited by the China National Accreditation Service for Conformity Assessment (CNAS). All animal experiments were approved by the Institutional Animal Care and Ethics Committee (IACUC) of the Laboratory Animal Center of the Academy of Military Medical Sciences. All mice were of C57BL / 6J background.

[0047] The Col2a1-Cre transgenic mice used in the following examples are cartilage-specific Cre recombinase-expressing transgenic mice and were kindly provided by Yang Xiao's laboratory at the Military Medical Research Institute, Academy of Military Sciences, Chinese People's Liberation Army. The Col2a1-Cre transgenic mice and their specific construction methods are described in the literature "Hao Zhenming, Yang Xiao, Cheng Xuan, et al. Development and characterization of cartilage-specific Cre recombinase-expressing transgenic mice [J]. Acta Genetica Sinica, 2002, 29(5): 424-429."

[0048] The Rps29 gene (wild-type allele, Rps29) of mice with a C57BL / 6J background + The genomic sequence is the complementary sequence of nucleotides 69204495-69205891 of GenBank ACCESSION No. NC_000078.7 (Update Date 2024-02-07). The nucleotide 69205891 is designated as the first nucleotide of the Rps29 gene, and the complementary nucleotide corresponding to nucleotide 69204495 is designated as the 1397th nucleotide of the Rps29 gene. This constitutes the DNA fragment with the nucleotide sequence of SEQ ID NO: 1. In the nucleotide sequence of SEQ ID NO: 1, positions 1-121 constitute the first exon sequence, positions 358-457 constitute the second exon sequence, and positions 1297-1397 constitute the third exon sequence.

[0049] The RPS29 conditional gene targeting mice used in the following examples (named Rps29 fl / fl Mice) were purchased from Saiye (Suzhou) Biotechnology Co., Ltd., and the strain name is C57BL / 6JCya- Rps29 em1flox / Cya, strain number CKOCMP-20090-Rps29-B6J-VA, product number S-CKO-04862. This mouse is a cross between Rps29 in wild-type mice with a C57BL / 6J background.+ The nucleotide segment between the 5′-homologous arm (positions 1-1729 in SEQ ID NO: 2) and the 3′-homologous arm (positions 3458-5230 in SEQ ID NO: 2) of the allele was replaced with the segment shown in positions 1730-3457 in SEQ ID NO: 2 (as shown by the underlined segment in SEQ ID NO: 2), thereby inserting two LoxP sequences (ataacttcgtatagcatacattatacgaagttat) in the same direction into Rps29, respectively. + The conditional gene targeting mouse, Rps29, was obtained by PCR with the front end of 942 bp upstream of the first exon and the back end of 194 bp downstream of the second exon. fl / fl The expression of mouse Rps29 gene is not affected by LoxP sequence.

[0050] SEQ ID NO: 1 is specifically as follows:

[0051]

[0052] SEQ ID NO: 2 is specifically as follows:

[0053] agtactca attgacgtaaacggccacaagttcgaataacttcgtatagcatacattatacgaagttattggtggcacaagcaag cccattattagaggctgagacattaggatagggagtgtgagtctattatgggcaaaatgagagtcttgggccagtc ttgtctacacaaaaacaaatgaaaagtaaatgtaggcgattatatttaggtatcaagggtggtatactcacatata cgtaagaccctattttccatccatggaatgatgtggatttctttttggagtatatgaggtcaaaagatttaataag aggcccctatcgttgactcttactcattacacttgatttaagttgtcatataatttcacgccagtaggtgtcagta gtgagtaaaggaaaaaaaaaatcacgtttgtaagcgaacgtttgtgttaagacaatgtaaaaaattaaggttgaaa tgtattatatgagaaaagggtgaattaaaaagaaagtgagaataatgttaatattattaagtgtccaaaaagagac ggggtctcgctatgttgcccaggctggagtgcagtggctattcacaggcgcgatcccactactgatcagcacggga gttttgacctgctccgtttccgacctgggccggttcacccctccttaggcaacctggtggtcccccgctcccggga ggtcaccatattgatgccgaacttagtgcggacacccgatcggcatagcgcactacagcccagaactcctggactc aagcgatcctcctgtctcagcctcccgagtagctgggactacaggcgtgcgccaccgcgcccggcgagcgctgaga gcgacggggagatactagagctgcggcgggccgtgacgtcactcactgtgcccgcccagccagccttagaaatgtc actcagagcacgcggaccaatgttgtcgcacggcgtacgcgtcacgtcttagcgttgtattctgggtagcgtgtag ctccaaaaaactttgaagagcgcctgcgcgagccgactcgttcctttctcctcgttgggcgtctgaaggcaagatg ggtcaccagcagctctactggagtcacccacggaagttcggccagggttcccgctcttggtgaggagcgggttgtg gagaccgcggttagagggaagggccattgttggtgactgggtgtcggaaattcaaggcccgcgggcggcgcgcagg gcgttcggtgctgccgtcgccattacgggcttagctaggccgggccgggcgggccctgctgcgggtggtggggaag ctgaggagtgctgtaccttactgtggcggctccattaaggccatctccttgtccttcctcctcccagccgcgtctg ctccaaccgccacggtctgatccgcaaatacgggctgaacatgtgccgccagtgcttccggcagtacgcgaaggac ataggcttcattaaggtacgcgcggttggtcgctgccgtccacgatgcacacagcggagggttttaagagttccag aagggaagggtgaagggtttaatgcctggtcagatttaggtgtcaggtgggtaggaggtggtgcagtttctacata gtaactgaatattcctaacccaatacgtgtcttaaatttctggcccaggatgtttgaataacttcgtatagcatac attatacgaagttatgtcagactggtccgaatccacagtactgatatc

[0054] Example 1. Construction and identification of chondrocyte-specific Rps29 gene knockout mice

[0055] like Figure 2 As shown in A, Col2a1-Cre transgenic mice were crossed with Rps29 fl / fl Mice were mated to obtain F1 generation mice, and Col2a1-Cre; Rps29 were selected from the F1 generation mice by PCR identification. fl / + Col2a1-Cre; Rps29 mice fl / + One chromosome of the mouse carries the wild-type Rps29 gene Rps29 + , the other chromosome carries Rps29 fl allele, and the Col2a1-Cre; Rps29 fl / + Mice express Cre recombinase specifically in chondrocytes. That is, by transfecting Col2a1-Cre; Rps29 fl / + PCR verification was performed on the genomic DNA of mouse tail. Using primers that identify the Col2a1-Cre recombinase gene, a 234 bp band was amplified. Using primers that identify the Rps29 gene, a 323 bp fragment and a 255 bp fragment were simultaneously amplified.

[0056] Col2a1-Cre;Rps29 fl / + Mice and Rps29 fl / fl Mice were mated to obtain F2 mice, and Col2a1-Cre; Rps29 were selected from the F2 mice by PCR identification. fl / fl The mice are chondrocyte-specific Rps29 gene knockout mice. The chondrocyte-specific Rps29 gene knockout mice express Cre recombinase specifically in chondrocytes, and the wild-type allele Rps29 on both chromosomes of the mice is not expressed. + All replaced by allele Rps29 fl , and Rps29 on two chromosomes in the mouse chondrocytes fl The first and second exons of the allele were knocked out by the Cre / loxP system, which is called the Rps29 knockout allele. fl / fl PCR verification was performed on the genomic DNA of mouse tail. The primers for identifying the Col2a1-Cre recombinase gene could amplify a 234 bp band, while the primers for identifying the Rps29 gene could only amplify a 323 bp fragment.

[0057] The principle of RPS29 gene knockout involved in the present invention is as follows Figure 1 As shown, Rps29+ The allele is the Rps29 genomic locus in the chondrocytes of C57BL / 6J background mice, Exon1 is the first exon, Exon2 is the second exon, and Exon3 is the third exon; the Rps29 targeting vector is used to target the Rps29 + LoxP sequence was inserted between the 5' homology arm and the 3' homology arm of the allele to obtain Rps29 fl allele; after the Cre recombinase acts, it can mediate the knockout of the sequence between LoxP to achieve specific Rps29 gene knockout.

[0058] The mouse genome constructed using the above method was verified by PCR. The specific steps include: (I) Preparation of mouse genomic DNA: 1. Cut a 2 mm section of the tail tip of a 15-day-old mouse and place it in a 1.5 mL centrifuge tube. 2. Add 400 μL of mouse tail lysis buffer (0.5% SDS, 0.1 M NaCl, 0.05 M EDTA, 0.01 M Tris-Cl buffer (pH 8.0), 200 μg / mL proteinase K) to each tube and incubate in a 55°C water bath overnight. 3. Add 200 μL of saturated NaCl solution to each tube and shake vigorously by inverting 200 times. 4. Place the centrifuge tube on ice for 10 minutes, then centrifuge at 12,000 rpm at room temperature for 10 minutes. 5. Transfer 500 μL of the supernatant to a fresh 1.5 mL centrifuge tube and add 800 μL of anhydrous ethanol to each tube to mix thoroughly. 6. Centrifuge at 12,000 rpm at room temperature for 10 minutes and discard the supernatant. 7. Add 500 μL of 75% ethanol solution to each centrifuge tube and centrifuge at 12,000 rpm for 5 minutes at room temperature. Discard the supernatant. 8. Pour off the 75% ethanol from the tubes and air dry at room temperature. 9. Add 100 μL of ddH2O to each tube and incubate at 37°C until the DNA is completely dissolved. (II) Mouse Genotyping: Using mouse tail DNA as a template, mix 1 μL of the mouse tail DNA solution, 1 μL of each upstream and downstream primer, 10 μL of 2× TaqMix, and 7 μL of ddH2O to prepare a PCR reaction system. Perform a PCR reaction using the following protocol: pre-denaturation at 98°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, extension at 72°C for 10 minutes, and storage at 4°C. Perform 30 cycles of denaturation, annealing, and extension. After the PCR amplification reaction is completed, the PCR products are subjected to electrophoresis (140V constant voltage, 20min) on a 2% agarose gel, and the genotype of the mice is determined based on the electrophoresis results.

[0059] The primers used to identify the Col2a1-Cre recombinase gene include a first primer with a nucleotide sequence of SEQ ID NO: 3 and a second primer with a nucleotide sequence of SEQ ID NO: 4.

[0060] SEQ ID NO: 3: 5'-GAGGGTCCAGCCCGAGCTACTT-3';

[0061] SEQ ID NO: 4: 5'-GCATCGACCGGTAATGCAGGC-3'.

[0062] The primers used to identify the Rps29 gene include a third primer having a nucleotide sequence of SEQ ID NO: 5 and a fourth primer having a nucleotide sequence of SEQ ID NO: 6.

[0063] SEQ ID NO: 5'-GGCAGGGCTTTGTGCAATTTTAG-3';

[0064] SEQ ID NO: 6: 5'-CCCAAGACTCTCATTTTGCCCATAAT-3'.

[0065] The genotyping results of mice are shown in Figure 2 As shown in B, the first 1-6 lanes in the figure represent 6 mouse samples, and lane 7 is a blank control. The upper figure shows the electrophoresis results of the amplification product using the Col2a1-Cre primer. If a 234bp fragment can be specifically amplified, it is Col2a1-Cre positive; the lower figure shows the electrophoresis results of the amplification product using the Rps29 primer. If a 323bp fragment can be specifically amplified, it is Rps29 positive. fl / fl Homozygotes, if the 323bp fragment and the 255bp fragment can be specifically amplified, are Rps29 fl / + Heterozygotes, if a 255bp fragment is specifically amplified, are Rps29 + / + Wild type. According to the above identification criteria, the genotype of sample 1 is Col2a1-Cre; Rps29 fl / fl The genotype of sample 2 is Col2a1-Cre; Rps29 fl / + , the genotype of sample 3 is Rps29 fl / fl , the genotype of sample 4 is Rps29 fl / + The genotype of sample 5 is Col2a1-Cre; Rps29 fl / + The genotype of sample 6 is Col2a1-Cre; Rps29 fl / + Therefore, sample 1 is the required chondrocyte-specific Rps29 gene knockout mouse, named Col2a1-Cre; Rps29 fl / fl Mouse, that is, the Rps29 gene in both chromosomes of the mouse genome is replaced by Rps29 flAllele, Rps29 protein is not expressed in chondrocytes after the action of Col2a1-Cre recombinase. Sample 3 was used as a control mouse and named Rps29 fl / fl Mouse, that is, the Rps29 gene in two chromosomes of the mouse genome is replaced by Rps29 fl Allele, without the function of Col2a1-Cre recombinase, can express Rps29 protein.

[0066] Example 2: Detection of Rps29 gene knockout efficiency in chondrocyte-specific Rps29 gene knockout mice

[0067] 1. mRNA level detection

[0068] Col2a1-Cre; Rps29 fl / fl Mice and Rps29 fl / fl Place cartilage tissue from mouse limbs and ribs into a 1.5ml RNase-free centrifuge tube, add 1ml of Trizol reagent, homogenize, and then add 0.2ml of chloroform. Cover the tube, shake to mix thoroughly, and let it sit for 2-3 minutes. Then, centrifuge at 12,000g for 15 minutes at 4°C. After centrifugation, aspirate the upper aqueous phase and transfer it to a new RNase-free centrifuge tube. Add 0.5ml of isopropanol, mix thoroughly, let it sit at room temperature for 10 minutes, and centrifuge at 12,000g for 15 minutes at 4°C. Discard the supernatant, wash with 1ml of 75% ethanol, centrifuge, discard the supernatant, and air dry at room temperature for 5-10 minutes. Add 500μl of RNase-free water, repeatedly pipette to dissolve the RNA, measure the RNA concentration, and store at -80°C until needed.

[0069] The extracted RNA was reverse transcribed using a reverse transcription kit (TOYOBO, FSQ-301) to obtain cDNA. Real-time fluorescence quantitative PCR was performed using a reverse transcription kit (TOYOBO-SYBR Green Realtime PCR Master Mix-QPK-201) according to the following system and procedure to detect the relative mRNA expression level of the Rps29 gene in mouse cartilage tissue.

[0070] Reaction system: Mix 4 μl, cDNA template 1 μl, upstream and downstream primers 0.5 μl each, RNase-free water 4 μl.

[0071] Reaction procedure: ①50°C for 20 s, ②95°C for 1 min, ③95°C for 15 s, ④60°C for 15 s, ⑤72°C for 45 s, ⑥4°C +∞. (Starting from the second cycle, 40 cycles of steps ③-⑤, plus melting curve analysis).

[0072] The above detection process used hprt as the internal control, the hprt primers were 5'-ATGCCGAGGATTTGGAAAAAGTGTTT-3' and 5'-TGTCCCCCGTTGACTGATCATTACAG-3', and the Rps29 primers were 5'-AGCCGACTCGTTCCTTTC-3' and 5'-TGTTCAGCCCGTATTTGC-3'.

[0073] Test results such as Figure 3 As shown in A, compared with Rps29 fl / fl Mouse, Col2a1-Cre;Rps29 fl / fl The mRNA expression level of Rps29 in mouse cartilage tissue was significantly decreased.

[0074] 2. Protein level detection

[0075] Col2a1-Cre; Rps29 fl / fl Mice and Rps29 fl / fl Cartilage tissue from mouse limbs and ribs was diluted with 200 μl of RIPA lysis buffer (100 mM Tris-HCl, 300 mM NaCl, 2% Tween-20, 0.4% NP-40, 20% glycerol) containing the phosphatase inhibitor PPI (Roche, 04906837001) and the protease inhibitor PI (Roche, 04693159001). The mixture was homogenized and placed on ice for 20 minutes. The supernatant was collected after sonication and centrifugation. Protein concentration was quantified using Pierce BCA Protein Assay Reagent (Thermo Fisher, 23225). Water and 6X loading were added to dilute the protein to the same concentration according to the protein concentration, and the protein was fully denatured by boiling for 5 minutes. The quantified protein was stored in aliquots at -20°C. The protein samples were subjected to Western blot analysis to detect the expression level of Rps29 protein in mouse cartilage tissue. β-actin was used as an internal reference, and the dilution concentration of the β-actin primary antibody (Abcam, ab8227) was 1:2000; the dilution concentration of the Rps29 primary antibody (Proteintech, 17374-1-AP) was 1:2000.

[0076] Test results such as Figure 3 As shown in B, compared with Rps29 fl / fl Mouse, Col2a1-Cre;Rps29 fl / fl The Rps29 protein level in mouse cartilage tissue was significantly decreased.

[0077] The above results showed that compared with the control Rps29 fl / flCompared with mice, Col2a1-Cre; Rps29 fl / fl RPS29 was effectively knocked out in mouse chondrocytes.

[0078] Example 3: Phenotypic Identification of Achondroplasia Dwarfism in Chondrocyte-Specific Rps29 Knockout Mice

[0079] 1. Statistical analysis of survival time

[0080] Twelve F2 generation chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and 12 control mice (Rps29 fl / fl The results showed that all mice were born, but Col2a1-Cre; Rps29 fl / fl Mice died on the first day of birth. Survival curve analysis was performed using GraphPad Prism software. Figure 4 As shown in middle A, Col2a1-Cre; Rps29 fl / fl The survival time of mice was significantly shortened compared with control mice, which could survive for more than 300 days. fl / fl All mice died on the day of birth, which is consistent with the characteristic that most patients with clinical achondroplasia dwarfism die in utero or in the neonatal period.

[0081] 2. Morphological analysis of chondrocyte-specific Rps29 gene knockout mice

[0082] In the newly formed chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and control mice (Rps29 fl / fl Mice) were observed for appearance and morphology. Figure 4 As shown in B, it can be seen that compared with the control mice in the same littermate, Col2a1-Cre; Rps29 fl / fl Newborn mice are short, with severely shortened limbs and protruding abdomens.

[0083] In the newly formed chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and control mice (Rps29 fl / fl The body length of mice was statistically analyzed, and the results were as follows Figure 4 As shown in middle C, it can be seen that the newly generated Col2a1-Cre; Rps29 fl / fl The body length of mice was significantly shortened, and Rps29 gene knockout mice showed a dwarfism phenotype.

[0084] 3. Alcian Blue-Alizarin Red Staining Analysis of Skeletons in Chondrocyte-Specific Rps29 Knockout Mice

[0085] The F2 generation of newly formed chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and control mice (Rps29 fl / fl After killing mice, the skin and internal organs were removed and fixed in 95% ethanol for 72 hours. Then they were transferred to acetone and soaked for 48 hours to remove fat and make the skeleton stronger. The skeleton was placed in Alcian blue and Alizarin red S staining solution at room temperature for 48 hours. The floating color on the skeleton was rinsed off with distilled water, placed at room temperature, and 1% KOH solution was used to remove the soft tissue around the bones. Every three days, fresh 1% KOH solution was used until most of the soft tissue around the bones was removed. Use gradient glycerol / KOH solution (20%, 30%, 50%, 80% glycerol) to gradually clean the skeleton. The gradient glycerol / KOH solution was replaced one by one every 24 hours. Finally, the skeleton was immersed in 100% glycerol for preservation, and the skeleton was stained with Alcian blue-Alizarin red and observed and analyzed. The results are shown as follows. Figure 5 shown.

[0086] according to Figure 5 It can be seen that compared with the control mice, Col2a1-Cre; Rps29 fl / fl The overall size of the mice's skeleton was significantly shortened, and their forehead, parietal bones, and occipital bones were prominent, their ribs were abnormally curved, and the ossification of the vertebrae in the cervical and lumbar regions and the long bones of the limbs was hindered. Statistical analysis of the length of the humerus, ulna, radius, femur, and tibia, the results showed that compared with the control mice, the Col2a1-Cre; Rps29 fl / fl The length of the long bones in the mice's limbs was significantly reduced. These results indicate that the bones of chondrocyte-specific Rps29 knockout mice exhibit typical characteristics of achondroplasia, consistent with the phenotype of clinical achondroplasia dwarfism patients.

[0087] 4. Histological Analysis of Chondrocyte-Specific Rps29 Knockout Mice

[0088] 4.1. Analysis of bone tissue H&E staining and Safranin & Fast Green staining in chondrocyte-specific Rps29 knockout mice

[0089] The F2 generation of newly formed chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and control mice (Rps29 fl / flAfter killing mice, the femur and tibia were removed, and attached muscle tissue and other debris were removed as much as possible. The bones were washed with 0.01M PBS and fixed in 4% PFA overnight at 4°C. Two hours before sacrifice, mice were weighed and intraperitoneally injected with 100μg of BrdU (B5002, Sigma Aldrich) per gram of body weight for subsequent BrdU immunohistochemical staining to detect cell proliferation. The 4% PFA fixative was discarded, and 0.5M EDTA decalcification solution was added. The tissue was decalcified on a rotator for one day. The decalcified bone tissue was washed three times with PBS for 30 minutes each. The bone tissue was dehydrated using various concentrations of ethanol and xylene. The dehydrated tissue was then placed in melted paraffin wax and paraffin-permeabilized in a 60°C incubator, with the wax replaced every 30 minutes for a total of four changes. Place the tissue into a preheated embedding tank on an embedding machine, position the bone, then place the embedding frame in place and add fresh wax. Cool on a cooling table to solidify the paraffin. Trim the wax block to the desired size, adjust the angle on a rotary microtome, and slice to a thickness of 5 μm according to experimental requirements. Bone tissue sections are stained with H&E and Safranin & Fast Green.

[0090] The staining results are as follows Figure 6 As shown in middle A, it can be seen that Col2a1-Cre; Rps29 fl / fl The length of growth plate cartilage in the femur and tibia of mice was significantly shortened, and the staining of cartilage extracellular matrix became weaker. Figure 6 As shown in middle B, the chondrocytes of Rps29 gene knockout mice are abnormally arranged, the typical chondrocyte column structure disappears, the proliferative and hypertrophic zones are narrowed, the morphology is abnormal, and the arrangement is disordered.

[0091] The above results further illustrate that Rps29 gene knockout mice show characteristics of achondroplasia.

[0092] 4.2. Detection of chondrocyte proliferation levels in chondrocyte-specific Rps29 gene knockout mice.

[0093] The F2 generation of newly born chondrocyte-specific Rps29 knockout mice (Col2a1-Cre; Rps29 fl / fl mice) and control mice (Rps29 fl / fl Paraffin tissue sections of the femur and tibia of mice were baked in a 60°C incubator for about 2 hours, and immunohistochemical staining of the proliferation marker molecule BrdU was performed. The results are as follows: Figure 7 shown.

[0094] according to Figure 7 It can be seen that Col2a1-Cre; Rps29 fl / flThe proliferation of chondrocytes in the femur and tibia of mice was reduced compared with that in control mice. + The cell numbers were statistically analyzed and the results showed that the BrdU + The cell numbers were significantly reduced, indicating that chondrocyte proliferation was abnormal in chondrocyte-specific Rps29 gene knockout mice.

[0095] 4.3. Detection of Chondrocyte Apoptosis in Chondrocyte-Specific Rps29 Knockout Mice

[0096] Neonatal cartilage degradation (i.e., chondrocyte apoptosis) is also crucial for growth plate cartilage development and homeostasis maintenance, new bone formation, etc. The newborn chondrocyte-specific Rps29 gene knockout mice (Col2a1-Cre; Rps29) of the F2 generation in 4.1 were injected into the mouse model. fl / fl mice) and control mice (Rps29 fl / fl TUNEL staining was performed on paraffin tissue sections of the femur and tibia of mice. Figure 8 shown.

[0097] according to Figure 8 As shown in A and C, Col2a1-Cre; Rps29 fl / fl TUNEL in mouse femur and tibia tissue sections + The number of cells increased significantly, indicating that cell apoptosis increased compared with the control mice. Further TUNEL analysis of the resting area, proliferative area, and hypertrophic area of ​​the femur and tibia was performed. + The cell numbers were statistically analyzed, and the results were as follows Figure 8 As shown in B and D, it can be seen that the TUNEL expression in the resting area, proliferative area and hypertrophic area of ​​both femur and tibia is + The number of cells increased significantly, indicating that chondrocyte apoptosis was also abnormal in chondrocyte-specific Rps29 gene knockout mice.

[0098] In summary, the chondrocyte-specific Rps29 gene knockout mice provided by the present invention can be used as a mouse model of achondroplasia dwarfism to facilitate the study of the genetic mechanism of achondroplasia dwarfism or the screening, development and preparation of drugs for the prevention, alleviation and treatment of achondroplasia dwarfism.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for constructing a dwarfism mouse model, characterized in that: include: Specifically knocking out the RPS29 gene in mouse chondrocytes, reducing or inhibiting the expression of the RPS29 gene in mouse chondrocytes, and obtaining a dwarfism mouse model; The dwarfism is achondroplasia dwarfism.

2. The method according to claim 1, characterized in that The specific knockout of the RPS29 gene in the mouse chondrocytes is to specifically knock out the first exon and the second exon of the RPS29 gene in the mouse chondrocytes.

3. The method according to any one of claims 1-2, characterized in that The specific knockout of the RPS29 gene in the mouse cartilage cells includes using the Cre / loxP system to specifically knock out the RPS29 gene in the mouse cartilage cells.

4. The method according to claim 3, characterized in that The method for constructing the dwarfism mouse model comprises: RPS29 conditional gene targeting mice were mated with mice expressing Cre recombinase specifically in cartilage tissue to obtain F1 generation, and Col2a1-Cre; Rps29 fl / + mice; Col2a1-Cre;Rps29 fl / + One chromosome of the mouse carries the wild-type Rps29 gene Rps29 + , the other chromosome carries Rps29 fl allele, and the Col2a1-Cre; Rps29 fl / + Cre recombinase is specifically expressed in mouse chondrocytes; The Rps29 fl The allele changes Rps29 in wild-type mice + The nucleotide segment between the 5'-homologous arm and the 3'-homologous arm of the allele is replaced with the segment shown in positions 1730-3457 of SEQ ID NO: 2, the nucleotide sequence of the 5'-homologous arm is positions 1-1729 of SEQ ID NO: 2, and the nucleotide sequence of the 3'-homologous arm is positions 3458-5230 of SEQ ID NO: 2; The Col2a1-Cre; Rps29 fl / + The mice were mated with the RPS29 conditional gene-targeted mice to obtain an F2 generation, and chondrocyte-specific RPS29 gene knockout mice were screened from the F2 generation to obtain a dwarfism mouse model.

5. The method according to claim 4, characterized in that The RPS29 conditional gene targeting mice have a C57BL / 6J genetic background.

6. A method for screening drugs for alleviating and / or treating dwarfism, characterized in that: The method comprises the steps of constructing a dwarfism mouse model using the method according to any one of claims 1 to 5; the dwarfism is achondroplasia dwarfism.

Images