Method, molecular marker and primer for improving wheat scab resistance by using QFhb-2DL and QFhb-3BL

Abstract

The invention discloses a method, a molecular marker and a primer for improving wheat scab resistance by using QFhb-2DL and QFhb-3BL. The molecular marker comprises a dcaps marker of the QFhb-2DL and / or a KASP marker of the QFhb-3BL. According to the invention, a molecular marker closely linked with QFhb-2DL and a molecular marker closely linked with QFhb-3BL are developed for the first time, and molecular design breeding is realized by utilizing the developed new markers closely linked with sites on the premise of stabilizing the characteristics of stripe rust resistance, dwarf, large ear and multiple ears of wheat varieties at the upstream of Yangtze River; disease-resistant genotypes of QFhb-2DL and QFhb-3BL are rapidly introduced into wheat varieties at the upstream of Yangtze River to breed a gibberellic disease resistance strain with the yield remarkably improved compared with that of a control group, and the gibberellic disease resistance breakthrough at the upstream of Yangtze River is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat molecular breeding, and specifically relates to a method for QFhb-2DL and QFhb-3BL Methods, molecular markers and primers for improving wheat resistance to fusarium ergot. Background Art

[0002] The wheat-growing areas in the middle and lower reaches of the Yangtze River were the first regions in China to carry out genetic improvement work on wheat resistance to Fusarium head blight. In the 1860s and 1970s, the highly resistant variety Sumai No. 3 was bred. However, the plant height of Sumai No. 3 reached 130-150 cm, which was not suitable for large-scale promotion and application. Since then, China has carried out Fusarium head blight resistance breeding work with Sumai No. 3, Wangshuibai and wheat-related species as resistance sources. Although some germplasms with good resistance have been selected, the agronomic traits cannot meet the needs of large-scale promotion and have not been promoted and applied in production. Since then, the wheat-growing areas have focused on the comprehensive high-yield and mild Fusarium head blight traits of the parents. The offspring of the mating group mainly selects comprehensive high-yield, taking into account disease resistance and stress resistance. A number of large-scale high-yield wheat varieties with medium resistance to Fusarium head blight have been bred one after another, such as Yangmai 158 and Yangmai 16, which have significantly improved the overall level of Fusarium head blight resistance in the wheat-growing areas in the middle and lower reaches of the Yangtze River and even in China. Wheat stripe rust has broken out frequently in the wheat-growing areas in the upper reaches of the Yangtze River. Most wheat varieties have multiple stripe rust resistance genes and good stripe rust resistance. However, the breeding of wheat varieties for resistance to ergot started late in this area, and no requirements for ergot resistance were made in variety approval, resulting in poor resistance to ergot in wheat varieties, which have always been at a high susceptible-susceptible level. In recent years, due to the high temperature and high rainfall during the flowering period of wheat, ergot has also frequently occurred in the upper reaches of the Yangtze River, which has had a great impact on food security. After preliminary testing, it was found that most wheat varieties in the upper reaches of the Yangtze River do not carry any known ergot resistance genes / sites. Therefore, it is urgent to cultivate ergot-resistant varieties for wheat breeding in this wheat-growing area. Wheat resistance to Fusarium head blight is different from resistance to stripe rust, leaf rust and powdery mildew. It is one of the most complex quantitative traits of crops and is controlled by multiple genes. A large number of QTLs for resistance to Fusarium head blight have been located at home and abroad, but few have been verified. Fhb1 and Fhb7 The molecular regulatory network involved in wheat ergot resistance genes / QTLs is complex and is often lost during breeding due to linkage drag with agronomic traits. As a result, the utilization efficiency of known ergot resistance genes is not high, and even fewer can be applied to wheat breeding in the upper reaches of the Yangtze River.

[0003] In view of the above research background, there is an urgent need to explore and utilize new key loci for resistance to ergot, develop corresponding molecular markers, and apply them to the breeding of wheat for resistance to ergot in the upper reaches of the Yangtze River. Summary of the invention

[0004] In view of the poor resistance of wheat to scab in the upper reaches of the Yangtze River, the present invention provides a method for QFhb-2DL and QFhb-3BL Methods, molecular markers, primers for improving wheat fusarium head blight resistance, using QFhb-2DL and QFhb-3BL The linked markers can be used to develop wheat varieties (lines) with high resistance to ergot and high yield through molecular design and precise phenotypic identification of ergot resistance and yield-related traits, greatly improving breeding efficiency and the accuracy of trait improvement.

[0005] In order to achieve the above object, the present invention provides a molecular marker related to wheat scab resistance in the first aspect, the molecular marker comprises QFhb-2DL DCAPs marked and / or QFhb-3BL The KASP mark QFhb-2DL The dcaps marker has a flanking sequence as shown in SEQ ID NO.1, QFhb-3BL The KASP marker has a differential SNP flanking sequence in the coding region as shown in SEQ ID NO.4 and a differential SNP flanking sequence in the promoter region as shown in SEQ ID NO.8.

[0006] Furthermore, the differential SNP in the coding region is of G base type for disease-resistant varieties, and of A base type for susceptible varieties; the differential SNP in the promoter region is of T base type for disease-resistant varieties, and of C base type for susceptible varieties.

[0007] The second aspect of the present invention provides a primer set for use in the above-mentioned molecular marker, wherein QFhb-2DL The sequences of the primer sets used for the dcaps labeling are shown in SEQ ID NO.2 and SEQ ID NO.3; Said QFhb-3BL The primer set used for the KASP marker includes a KASP.3B.1 primer set or a KASP.3B.2 primer set. The sequence of the KASP.3B.1 primer set is shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the sequence of the KASP.3B.2 primer set is shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.11.

[0008] A third aspect of the present invention provides a method of utilizing QFhb-2DL and QFhb-3BL A method for improving wheat scab resistance comprises the following steps: Step S1, select the carrying site QFhb-2DL and QFhb-3BLThe wheat varieties or lines with disease-resistant alleles are used as donors, and the wheat varieties with short stems, large ears and multiple ears and resistance to stripe rust are used as recipients. The two parents are crossed to obtain F0, and the F0 is planted. When it blooms, it is crossed with the recipient to harvest BC1F1 seeds. Step S2, planting BC1F1, and extracting leaf DNA when seedlings emerge. QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F1 plants with both genes / locus positive (heterozygous or homozygous) were selected to harvest BC1F2; Step S3, select BC1F2 in planting, use QFhb-2DL and QFhb-3BL Linked marker detection was performed to select BC1F2 plants with both genes / locus positive (heterozygous or homozygous) for tillering, lodging resistance, stripe rust resistance, and fusarium head blight resistance, and the selected BC1F3 seeds were harvested; Step S4, planting BC1F3, using QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F3 plants with both genes / locus positive (heterozygous or homozygous) were selected. During the flowering period of wheat, spores of Fusarium fusogenum were sprayed on the plants, and the plants with Fusarium fusogenum diseased spikelet rate ≥ 25% and diseased spikelet rate greater than the control were eliminated. The plants with poor stem elasticity, easy lodging, and plant height greater than 90 cm were eliminated, and the seeds of BC1F4 plants were selected from the harvest. Step S5, planting BC1F4, extracting leaf DNA at the seedling stage, and using QFhb-2DL and QFhb-3BL The linked markers of BC1F4 were tested for mixed samples of plants and rows. For the plants and rows with heterozygous test results, the genes were further tested according to the individual plants to clarify the genotypes of the BC1F4 plants at the two genes / locus; the BC1F4 was inoculated with the fusarium spore pathogen by dripping in the single flowers during the flowering period. After 21 days of inoculation, the genotypes of the individual plants of BC1F4 and the results of fusarium spore resistance were comprehensively analyzed, and the plants or rows with the identification results of "high resistance-resistance" were retained. Then, the comprehensive agronomic traits of the selected plants and rows or plants were comprehensively examined, and the excellent plants and rows and plants were selected. After harvest, the grain weight and yield were identified, and the BC1F5 seeds with higher grain weight and yield levels than the control were selected; Step S6, planting BC1F5, growing into strains, and using QFhb-2DL and QFhb-3BL The lines of BC1F5 were mixed by using the linked marker test, and the lines with both genes being homozygous positive were selected. The lines were inoculated with the pathogen of Fusarium fusarium in single flowers during the flowering period, and the lines with the identification results of "high resistance-resistance" were retained. The comprehensive agronomic traits of the selected lines were comprehensively investigated, and the selected lines were mixed and harvested. After harvest, the grain weight and yield were identified, and the BC1F6 lines with grain weight and yield levels higher than the control were selected; Step S7, planting BC1F6 in plots, examining the comprehensive agronomic traits of the plot lines, and conducting yield identification after harvesting the excellent plots, selecting plots with a yield level 5% higher than the control, and entering the next generation of multi-point yield identification; in, QFhb-2DL The linkage marker is the one described in the first aspect of the present invention QFhb-2DL DCAPS markers, QFhb-3BL The linkage marker is the one described in the first aspect of the present invention QFhb-3BL The KASP marker is used, and the primer set used is the primer set described in the second aspect of the present invention.

[0009] Preferably, in step S1, the donor is Yangmai 16, Yangmai 17, Yangmai 14, Yangmai 14-197 or Yangmai 39, and the recipient parent is Chuanmai 98, Chuanmai 93, Chuanmai 42 or Chuanmai 104.

[0010] Specifically, in step S3, the screening method for disease resistance, tillering and lodging resistance of the BC1F2 generation is as follows: the disease resistance is based on Sichuan Agricultural University 32 as the standard, and the individual plants with worse disease resistance than Sichuan Agricultural University 32 are eliminated; the tillering is based on Sichuan Agricultural University 32 as the control, and the individual plants with less tillers per plant than Sichuan Agricultural University 32 are eliminated; the screening for lodging resistance is to examine the plant height, stem elasticity and lodging resistance, and eliminate individual plants that are prone to lodging, have poor elasticity and have a plant height greater than 90 cm.

[0011] Preferably, in step S4, the concentration of the spore solution of Fusarium fusiformis is 2×10 5 ~3×10 5 Spores / mL.

[0012] Specifically, in steps S5 and S6, the single flower of the listed plant row is inoculated with the pathogen of Fusarium fusae during the flowering period, and the plant row with the identification result of "high resistance-resistance" is retained as follows: 4×10 5 ~5×10 5 spore / mL, in the field, during the flowering period of wheat, the single flower drip method was used for inoculation, 20 ears were randomly selected from each row or strain, inoculated at the opened floret in the middle of each ear, and marked, and the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day after inoculation, and the wheat ears were evenly and fully sprayed for 10 minutes each time. The spraying was stopped immediately after the wheat bloomed for 20 days; 21 days after inoculation, the disease situation of the inoculated ears was investigated, the number of diseased spikelets per ear and the total number of spikelets were counted, and the rows or strains with fusarium fusarium severity PSS ≤ 15% and close to the "high resistance-resistance" level of Sumai No. 3 were retained, Sumai No. 3 and Annong 8455 were used as resistant and susceptible controls, respectively, Yangmai 25 was used as a moderately resistant control, and Yangmai 13 was used as a moderately susceptible control.

[0013] Specifically, in steps S5, S6 and S7, the comprehensive agronomic traits of the selected plant rows, plant lines and varieties are comprehensively investigated as follows: plant height less than 90 cm, good lodging resistance, number of ears per plant greater than or equal to 5, and number of grains per ear greater than or equal to 48.

[0014] Specifically, in steps S5, S6 and S7, the control is Sichuan Agricultural University 32.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: 1. The present invention is based on the use of genetic populations to locate the scab resistance loci and then fine-position them, further narrowing the physical interval of the target loci and eliminating the linkage drag caused by the large initial positioning interval. QFhb-2DL Tightly linked molecular markers QFhb-2D-dcaps and QFhb-3BL Tightly linked molecular markers KASP.3B.1 and KASP.3B.2 can accelerate the disease resistance locus QFhb-2DL and QFhb-3BL Application in wheat disease resistance breeding, and can also be used for QFhb- 2DL and QFhb-3BL Cloning of genes.

[0016] 2. The Fusarium scab resistance donor gene source used in the breeding method of the present invention QFhb-2DL and QFhb-3BL It is different from the known antibiotics such as Sumai No. 3 and Wangshuibai. Fhb1 , which comes from the donor varieties Yangmai No. 4 and Yangmai 16 with excellent agronomic traits. Studies have found that the aggregation of the resistance genotypes of the two can significantly improve the resistance to ergot. Therefore, the use of these two ergot resistance sites can effectively improve the ergot resistance of the recipient wheat varieties in the upper reaches of the Yangtze River.

[0017] 3. The present invention uses molecular marker-assisted selection to rapidly select scab resistance loci on the premise of stabilizing the characteristics of wheat varieties in the upper reaches of the Yangtze River, such as resistance to stripe rust, short stems, large spikes and multiple spikes. QFhb-2DL and QFhb-3BL The disease-resistant genotype of the wheat in the upper reaches of the Yangtze River was introduced. The molecular marker detection method is simple and fast, and can be identified at the seedling stage, which greatly reduces the workload in the field and improves the accuracy of the prediction of Fusarium head blight resistance.

[0018] The wheat varieties bred using the method of the present invention can achieve a breakthrough in resistance to fusarium scab in the upper reaches of the Yangtze River, and are expected to overcome the frequent occurrence of fusarium scab and prevent the recurrence of fusarium scab. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 In Example 1 of the present invention QFhb-2DLSchematic diagram of the amplification results of the closely linked molecular markers in the candidate parents and offspring, with the arrows pointing to the positive bands of the Fusarium resistance gene; Figure 2 In Example 2 of the present invention TaFhb-3B Expression in parents (Yangmai 16 and Zhongmai 85) and resistant and susceptible mixed pools without inoculation (0h), 24h, 48h and 72h after inoculation; Figure 3 In Example 2 of the present invention QFhb-3BL Schematic diagram of fine positioning results; Figure 4 In Example 2 QFhb-3BL Typing map of tightly linked molecular markers developed after fine mapping of loci; Figure 5 It is a flow chart of the breeding method in Example 3 of the present invention. DETAILED DESCRIPTION

[0020] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0021] Example 1 Molecular marker-assisted selection of scab resistance loci QFhb-2DL Method development The applicant used the Yangmai 4 / Yanzhan 1 and Yangmai 5 / Yanzhan 1 populations to discover fusarium resistance sites from both Yangmai 4 and Yangmai 5 QFhb-2DL The phenotypic contribution rate reached 11.14-37.39%. The whole genome sequencing results (BSA-seq) of the resistant and susceptible pools of the parents and RIL populations, and the 30× resequencing results of 130 wheat varieties with significant differences in resistance and sensitivity were used to mine QFhb-2DL The polymorphic sites in the interval were identified and new KASP markers were independently developed in the QTL interval based on the flanking sequences. Using Yangmai No. 4 as the donor and Yanzhan No. 1 as the recipient, the hybrid was backcrossed to BC3F3. Molecular marker screening was used to exclude the interference of other ergot resistance sites of the background varieties Yanzhan No. 1 and Yangmai No. 4, and a large fine-positioning population of 3409 individual plants was created. The new KASP marker was used to screen the fine-positioning large population homozygotes and key recombinants, and a total of 10 key recombinants were identified. Combined with the two-year ergot resistance expansion phenotype identification results, QFhb-2DL The 5 molecular markers 2D-8 to 2D-12 in the candidate interval were used to scan the Yangmai 4 / Yanzhan 1 RIL population, and combined with the phenotypic identification of fusarium head blight resistance in 6 environments, the results were re-analyzed. QFhb-2DLThe genetic linkage map was constructed and positioned, and a new fusarium resistant locus closer to the target gene was located. The flanking sequence of the locus-linked marker SEQ ID NO.1:TGGGTGGGGCTAAATGTGTAGAGTG[C / G]CTTTTCCAGGATCCACCGTGAGAATTAGCACTTTTTAGTGTCCGGACCAAAATAGTTGGTCTGGCCTTCTCTTTTTTTTTTCTTTGGATCCAACTCCCTCCGTCCCCTAAGGGCATGAGCAATGGGGGCAGCGGTAGCTGCCGCCCCCGATGCATCCAGCTAGGTATGGGAAAATTGATTTCT was analyzed to develop dcaps markers. After consulting the literature and comparing with the wheat reference genome, the newly developed QFhb- The 2D-dcaps marker is different from any previously reported molecular marker for resistance to Fusarium head blight. The sequence of the specific primer set of QFhb-2D-dcaps is shown in Table 1.

[0022] Table 1 QFhb-2D-dcaps marker primer sequence information

[0023] QFhb-2D-dcaps were detected by PCR amplification, wherein the PCR amplification system contained 5 μL pure water + 5 μL 2XTaq Mix + 0.2 μL upstream and downstream primers + 1 μL DNA. The first step of PCR amplification was as follows: (1) 94°C pre-denaturation for 3 min; (2) 94°C denaturation for 30 s, 60°C annealing for 45 s, 72°C extension for 30 s, for a total of 34 cycles; (3) 72°C extension for 10 min, and storage at 4°C. The second step was a 10 μL enzyme digestion system, which contained 7.8 μL pure water + 2 μL buffer + 0.2 μL enzyme, and reacted at 37°C for 30 min. The fourth step was agarose gel: 3% agarose gel + 500 bp marker + 200 voltage and 220 current for 30 minutes. The target genotype is the band that can be digested by enzymes, which is the same as Yangmai 16, Yangmai 17, Yangmai 14, Yang14-197, and Yangmai 39, and is the selected material. The susceptible genotype cannot be digested by enzymes, which is the same as the band of Chuanmai 98. The effectiveness of the QFhb-2D-dcaps marker was then verified. Table 2 shows the genotype results of the breeding materials of the biological breeding project detected by QFhb-2D-dcaps and the phenotypic identification results of the ergot resistance expansion in that year. Table 3 shows the t test results of the corresponding phenotypic values.

[0024] Table 2 Identification results of QFhb-2D-dcaps genotypes and phenotypic resistance to fusarium head blight of breeding materials

[0025] Note: R represents the disease-resistant genotype, i.e. Yangmai 4 genotype, and S represents the disease-susceptible genotype, i.e. Yanzhan 1 genotype.

[0026] Table 3 t-test results of QFhb-2D-dcaps corresponding phenotypic values

[0027] Note: R represents the disease-resistant genotype, i.e. Yangmai 4 genotype, and S represents the disease-susceptible genotype, i.e. Yanzhan 1 genotype.

[0028] As shown in Tables 2 and 3, after QFhb-2D-dcaps marker detection, 29 varieties (lines) did not carry disease resistance alleles, and 22 varieties (lines) carried disease resistance alleles. The average diseased spikelet rate of fusarium head blight in varieties (lines) carrying disease resistance alleles was 58.78% lower than that in varieties (lines) not carrying disease resistance alleles ( p <0.01), which can clearly distinguish disease-resistant and disease-susceptible materials. This indicates that the QFhb-2D-dcaps primer set and genotype detection system can be applied to molecular marker-assisted breeding of wheat resistance to Fusarium head blight, and can be further used for breeding material detection and screening.

[0029] The genomic DNA of the candidate parent materials, individual leaves or mixed leaves of plant rows involved in Example 3 was extracted by CTAB method, and a template solution with a DNA concentration of about 30 ng / μL was obtained by dilution to detect the wheat scab resistance loci. QFhb- 2D-DCAPs labeling.

[0030] Figure 1 for QFhb-2DL Schematic diagram of the amplification results of tightly linked molecular markers in parents and offspring. The arrows indicate the bands that can be cut by enzymes, indicating a disease-resistant genotype, while the bands that cannot be cut by enzymes are consistent with the Sichuan wheat 98 band and are susceptible genotypes.

[0031] Example 2: Using fine positioning to locate groups QFhb-3BL And verify The applicant used BSA-seq of the resistant and susceptible mixed pool of the RIL population of Yangmai 16 / Zhongmai 895, and the Call SNPs of BSR-seq without inoculation and 24h, 48h, and 72h after inoculation, combined with 120K SNPs of the RIL population and the resistance to ergot phenotypes of the three additional environments, to clarify the target interval of resistance to ergot to 708.26-767.22Mb. The molecular markers on both sides are SNP.708263716-SNP.767220336, with an LOD value of 5.9 and a phenotypic contribution rate of 11.50%. This physical location is inconsistent with the previously reported resistance to ergot sites and is a new resistance to ergot (as shown in Tables 4 and 5).

[0032] Table 4 QFhb-3BL Differentially expressed genes and SNP-enriched intervals

[0033] Table 5 QFhb-3BL Positioning results

[0034] Then, 30× resequencing of 56 wheat varieties and 660K SNPs of a natural population of 390 wheat varieties were used to mine QFhb-3BL Eleven polymorphic loci in the target interval. These 11 polymorphic loci were developed into new KASP markers, named 3B-1 to 3B-11. At the same time, Zhongmai 895 was used as the receptor and Yangmai 16 was used as the donor, and the hybrid backcross was obtained to BC2F2, and a large population of 4310 single plants with fine positioning was constructed. The 4310 single plants and their parents were planted in the Fusarium scaber identification nursery of Wanfu Experimental Base of Jiangsu Lixiahe Agricultural Science Research Institute (Yangzhou, Jiangsu). The wheat sowing date in Yangzhou was set on October 20 in the year of the experiment. The experiment adopted a randomized block design with 2 rows, 2 replications, 30 grains per row, 1.5 m row length, and 0.23 m row spacing. Field fertilization and management were based on local field cultivation production. The CTAB method was used to extract genomic DNA, and the large population with fine positioning was detected, and a total of 12 types of recombinants were obtained. During the flowering period of wheat, 12 types of recombinants and parents were inoculated with the pathogen of Fusarium fusae in single flowers. Five ears were inoculated per single plant. The inoculation was carried out at the opened floret in the middle of each ear and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day. The spraying was evenly sprayed on the wheat ears for 10 minutes each time. The spraying was stopped immediately after 20 days of wheat flowering. 21 days after inoculation, the disease situation of the inoculated ears was investigated, and the number of diseased spikelets per ear and the total number of spikelets were counted. The severity of Fusarium fusae PSS = number of diseased spikelets / total number of spikelets × 100%. The parents Yangmai 16 and Zhongmai 895 were used as disease-resistant and disease-susceptible controls. The results showed that QFhb- 3BLThe interval is narrowed to the interval 3B-8 to 3B-9, spanning physical locations 748.33 to 754.72 Mb (e.g. Figure 2 At 754.72 Mb, a gene with significantly increased expression after inoculation of Fusarium fusogenum was discovered through BSR-seq and RT verification of the DH population's resistant and susceptible mixed pool without inoculation and 24h, 48h, and 72h after inoculation. TaFhb-3B (like Figure 3 As shown in the figure, after resequencing 30×, BSR-seq Call SNP, PCR first-generation sequencing found that the resistant and susceptible varieties had differences in the promoter and coding regions of the gene. The differential SNP flanking sequence in the coding region is SEQ ID NO.4: CAAATTGTTGGCAGCAAAACTGTACGGTCGAAGCCCAGTT[G / A]AGGTAACAAGAAGACAACCCTTTTT (complementary sequence), the resistant variety is G base type, and the susceptible variety is A base type; the differential SNP flanking sequence in the promoter region is SEQ ID NO.8 CCCAATCCGTCACCGAAAAAAGAAGAGAAAACGGAGAAAC[T / C]AAGATAATCAGGTGAGTTGATCAGATAATTGTAGTCTGTAATTTTGGTCAACACTAAAAACGATTTTCTACCAAAGATTATCGTCCCATCAACT, the resistant variety is T base type, and the susceptible variety is C base type. Therefore, the KASP molecular marker primer set information of KASP.3B.1 and KASP.3B.2 was developed as shown in Table 6.

[0035] Table 6 QFhb-3BL KASP.3B.1 and KASP.3B.2 molecular markers

[0036] Note: The lowercase part is the linker sequence. SEQ ID NO.5 and SEQ ID NO.6 are two competitive forward primers of KASP.3B.1, and SEQ ID NO.7 is the reverse primer of KASP.3B.1. SEQ ID NO.9 and SEQ ID NO.10 are two competitive forward primers of KASP.3B.2, and SEQ ID NO.11 is the reverse primer of KASP.3B.2.

[0037] Preparation of KASP-labeled primer working solution: Take 30 μL (100 μM) of upstream primer and 12 μL (100 μM) of downstream primer respectively, add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0038] PCR amplification reaction system: 2.2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.06 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and add sterile ultrapure water to 5 μL; PCR reaction procedure: (1) 95°C pre-denaturation for 10 min; (2) 95°C denaturation for 20 s, 61-55°C (0.6°C decrease per cycle) for 45 s, for a total of 10 cycles; (3) 95°C denaturation for 20 s, 55°C annealing for 45 s, for 34 cycles; stored at 20°C. A blank control (NTC) without adding template DNA to the reaction system was also set up in the experiment, and one or more blank controls were set up for each plate.

[0039] Wheat seedlings were taken and the CTAB method was used to extract the genomic DNA of the wheat to be tested.

[0040] The wheat genomic DNA to be tested was used as a template, and PCR amplification was performed using the above KASP primer set and PCR reagents to obtain PCR amplification products. The PCR reaction was performed on an ABI Veriti 384 PCR instrument (Thermo Fisher), and the PCR amplification product was scanned and read with an Omega F SNP typing detector (LGC Genomics Ltd, KBS-0024-002). The FAM excitation wavelength was 485 nm and the emission wavelength was 520 nm; the VIC excitation wavelength was 535 nm and the emission wavelength was 556 nm, and the system reference fluorescence ROX excitation wavelength was 575 nm and the emission wavelength was 610 nm. Kluster CallerTM (KBioscience) was used for genotyping, and the results of the analysis were determined. QFhb-3BLGenotype of the locus. Part of the "DH line of Yangmai 16×Zhongmai 895" was amplified together with the two parents according to the above method. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered at the position close to the X-axis in the fluorescence signal coordinate system of the typing result (blue), which was the same as Yangmai 16, which proved that the genotype of these wheats at the 41st base (SNP site) of the KASP marker flanking nucleotide sequence (original flanking sequence SEQ ID NO.4 and original flanking sequence SEQ ID NO.8) was G (complementary) (SEQ ID NO.4) or T (SEQ ID NO.8); and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered at the position close to the Y-axis in the coordinate system (red), which was different from the typing of Yangmai 16, which proved that the genotypes of these families at the SNP site were A (complementary) or C. Subsequently, KASP.3B.1 and KASP.3B.2 markers were tested in 103 wheat varieties (lines), and the effectiveness of this fine mapping interval and the two developed markers were analyzed in combination with the extended ergot resistance phenotypes of the 103 wheat varieties (lines). The results are shown in Table 7.

[0041] Table 7 Genotype and Fusarium head blight resistance phenotype identification results of KASP.3B.1 and KASP.3B.2 of 103 wheat varieties (lines)

[0042] Note: R represents the disease-resistant genotype, i.e. Yangmai 16 genotype, and S represents the disease-susceptible genotype, i.e. Zhongmai 895 genotype.

[0043] Table 8 t-test results of phenotypic values ​​corresponding to different genotypes carrying KASP.3B.1 or KASP.3B.2

[0044] Note: R represents the disease-resistant genotype, i.e. Yangmai 16 genotype, and S represents the disease-susceptible genotype, i.e. Zhongmai 895 genotype.

[0045] As shown in Table 8, after detection of KASP.3B.1 or KASP.3B.2 markers, 65 varieties (lines) did not carry the disease resistance alleles of KASP.3B.1 or KASP.3B.2, and 38 varieties (lines) carried both the disease resistance alleles of KASP.3B.1 and KASP.3B.2. The results showed that KASP.3B.1 and KASP.3B.2 were highly linked, which was related to the fact that the two differential SNPs were located in the promoter region and coding region of the same gene. The varieties (lines) carrying both the disease resistance alleles of KASP.3B.1 and KASP.3B.2 had an average diseased spikelet rate of fusarium head blight that was 38.87% lower than that of the varieties (lines) not carrying the disease resistance alleles of KASP.3B.1 or KASP.3B.2 ( p <0.001). This indicates that the primer set and genotype detection system of KASP.3B.1 and KASP.3B.2 can be applied to molecular marker-assisted breeding of wheat resistance to Fusarium head blight, and can be further used for breeding material detection and screening.

[0046] Figure 4 for QFhb-3BL Typing map of KASP.3B.1 or KASP.3B.2 markers developed after fine mapping of the locus.

[0047] Example 3 Utilizing the main effect site of resistance to scab QFhb-2DL and QFhb-3BL Molecular breeding methods to improve resistance to Fusarium head blight in wheat varieties grown in the upper reaches of the Yangtze River according to Figure 5 The process shown includes the following steps: 1) Step S1, parents: 390 wheat varieties from all over the country were selected as research objects. DNA from seeds or seedling leaves was extracted using the CTAB method. Molecular markers were used to screen for loci that carry resistance to Fusarium head blight. QFhb-2DL and QFhb-3BL The wheat varieties (lines) with disease-resistant alleles are Yangmai 16 and Yangmai 14-197, and the short-stemmed, large-eared, multi-eared wheat variety Chuanmai 98 from the upper reaches of the Yangtze River that is resistant to stripe rust is selected. The selected parents are planted in an artificial climate chamber, hybridized and matched, and F0 hybrids are harvested; F0 hybrids are planted in an artificial climate chamber to harvest F1, which is then hybridized with Chuanmai 98 to harvest BC1F1 seeds; 2) Step S2, planting BC1F1 in a greenhouse in Pi County, Chengdu, Sichuan, and when the seedlings are young, hanging them, taking leaves, extracting DNA, and using QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F1 plants with both genes / locus positive (heterozygous or homozygous) were selected to harvest BC1F2; 3) Step S3, select BC1F2 in greenhouse cultivation in Pi County, Chengdu, Sichuan, and use QFhb-2DL and QFhb-3BL Linked marker detection was performed to select BC1F2 plants with both genes / locus positive (heterozygous or homozygous) for tillering, lodging resistance, stripe rust resistance, and fusarium head blight resistance, and the selected BC1F3 seeds were harvested; 4) Step S4, BC1F3 was planted in the field in Pi County, Chengdu, Sichuan, and planted in rows. Each single plant harvested in the previous generation was planted in 5 rows, with a row length of 1.6m, a row spacing of 0.23m, and 40 seeds per row. At the seedling stage, leaves of 10 single plants in each row were randomly selected and mixed, and DNA was extracted. QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F3 strains with both genes / locus positive (heterozygous or homozygous) were selected and marked. 5 ~3×10 5 Spores / mL, spray the marked individual plants with spores of Fusarium head blight during the flowering period of wheat to identify the resistance to Fusarium head blight infection. Screening for disease resistance, tillering and lodging resistance, specifically: using the control Chuannong 32 as the stripe rust control, eliminate the individual plants with worse stripe rust resistance than the control Chuannong 32 in the seedling stage; using Yangmai 25 as the control for Fusarium head blight, eliminate the individual plants with diseased ear rate ≥ 25% and diseased spikelet rate greater than Yangmai 25; eliminate the individual plants with less tillers per plant than the control Chuannong 32; examine the plant height, stem elasticity and lodging resistance, and eliminate the individual plants with a plant height higher than 90cm, poor elasticity and easy lodging. Select BC1F4 individual seeds during harvest; 5) Step S5, BC1F4 was planted in the field in Pi County, Chengdu, Sichuan, with each plant planted in 5 rows, with a row length of 1.6m, a row spacing of 0.23m, and 40 seeds per row. At the seedling stage, leaves of 10 plants in each row were randomly selected and mixed, and DNA was extracted. QFhb-2DL and QFhb-3BL The lines and strains of BC1F4 were mixed by using the linked marker test. The lines and strains with heterozygous results were further tested for genes by individual plants to clarify the genotypes of the BC1F4 individual plants at the two genes / locus. 5 ~5×10 5spores / mL, during the flowering period of wheat, BC1F4 was inoculated with the pathogen of ergot disease by dripping in single flowers during the flowering period. 20 ears were inoculated in each row of plants with homozygous genotypes, and 20 ears were inoculated in each genotype of plants with inconsistent genotypes in the rows. The inoculation was carried out at the opened floret in the middle of each ear and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were evenly sprayed for 10 minutes each time. The spraying was stopped immediately after 20 days of wheat flowering. 21 days after inoculation, the disease situation of the inoculated ears was investigated, and the number of diseased spikelets per ear and the total number of spikelets were counted. The severity of ergot disease PSS = number of diseased spikelets / total number of spikelets × 100%. Sumai No. 3 and Annong 8455 were used as disease-resistant and disease-susceptible controls, respectively. A comprehensive analysis was conducted on the single plant genotype and the results of ergot disease resistance and extension of BC1F4 to clarify the effect of the gene combination. QFhb-2DL and QFhb-3BL The disease resistance allele variation can reduce the average diseased spikelet rate by 34.88% ( p <0.01) and 34.01% ( p <0.01), and QFhb-2DL and QFhb- 3BL Disease resistance allele variation can reduce the average diseased spikelet rate by 57.54% ( p <0.01) (as shown in Tables 9 and 10). According to the identification of the plant rows, the individual plants or plant rows with the identification result of "resistant" (average disease spikelet rate ≤ 25%) were retained. Then, according to the breeding objectives, the comprehensive agronomic traits and disease resistance of the selected plant rows or individual plants were comprehensively examined. Among the yield factors, the number of spikelets per plant was greater than or equal to 5 and the number of grains per spikelet was greater than or equal to 48 as the excellent standards. The excellent plant rows (for the plant rows with high homozygosity, 5 to 6 individual plants with consistent traits) and individual plants were selected. After harvesting, the grain weight and yield were identified, and the BC1F5 seeds with higher grain weight and yield levels than the control Sichuan Agricultural University 32 were selected; Table 9 Genotype and phenotypic results of some strains of BC1F4

[0048] Note: R represents the resistant genotype, and S represents the susceptible genotype.

[0049] Table 10 Breeding materials QFhb-2DL and QFhb-3BL Effect on the resistance to the expansion of scab

[0050] Note: The lowercase letters after the average diseased spikelet rate indicate that a t test was performed between the sample values. Different lowercase letters indicate p It is significant at the <0.01 level.

[0051] 6) Step S6, planting BC1F5 in the field in Pi County, Chengdu, Sichuan, and growing into a strain, using QFhb-2DL and QFhb-3BL The lines of BC1F5 were mixed by linked marker detection, and the lines with both genes being homozygous positive were selected and marked. During the flowering period, the single flowers of the listed lines were inoculated with the pathogen of Fusarium fusarium. Each line was inoculated with 15 to 20 ears, and the lines with the identification result of "resistance" (average diseased spikelet rate ≤ 25%) were retained. The comprehensive agronomic traits and disease resistance of the selected lines were comprehensively investigated. Among the yield factors, the number of ears per plant greater than or equal to 5 and the number of grains per ear greater than or equal to 48 were taken as excellent standards. Three excellent lines were selected, and the selected lines were mixed harvested. After harvesting, the grain weight and yield were identified. One BC1F6 line with higher grain weight and yield than the control Sichuan Agricultural University 32 was selected; 7) Step S7, planting BC1F6 in 2 cm plots in the field, and comprehensively examining the comprehensive agronomic traits of the plot varieties according to the breeding objectives. The yield factors are set as the number of ears per plant greater than or equal to 5 and the number of grains per ear greater than or equal to 48 as the excellent standards. After harvesting the excellent plots, the yield is identified, and the variety with a yield level 5.5% higher than the control Sichuan Agricultural University 32 is selected and named Sichuan 23 Pin 3 to enter the next generation of multi-point yield identification.

[0052] Six replicates of single flower dripping resistance extension test were conducted on Sichuan 23pin3 in Yangzhou. The results showed that the average diseased spikelet rate of Sichuan wheat 98 was 63.9%, while the average diseased spikelet rate of Sichuan 23pin3 in six replicates was 21.77%, which was 18.68% lower than that of the control variety Yangmai 25 ( p <0.05), and the average diseased spikelet rate of Sichuan wheat 98 with fusarium head blight was reduced by 65.93% ( p <0.01) (Table 11).

[0053] The high-yield wheat variety Sichuan 23pin 3, which is highly resistant to ergot, was bred using the above method. It carries disease-resistant and yield-enhancing genes / locus, and its resistance to ergot has stably reached the "resistant" level, and its yield is significantly increased over the control. These varieties (lines) and breeding techniques can reduce the use of disease control agents in the production process, ensure the safety of raw grain production, and achieve green and efficient wheat production increases.

[0054] Table 11 Fusarium head blight resistance of the new line Chuan 23pin 3 in six replicates at the Yangzhou identification site

[0055] It can be seen that using QFhb-2DL and QFhb-3BL The linked markers can be used to develop wheat varieties (lines) with high resistance to ergot and high yield through molecular design and precise phenotypic identification of ergot resistance and yield-related traits, greatly improving breeding efficiency and the accuracy of trait improvement.

[0056] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0057] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0058] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A molecular marker associated with wheat fusarium head blight resistance, characterized in that: The molecular markers include QFhb-2DL DCAPs marked and / or QFhb-3BL The KASP mark QFhb-2DL The dcaps marker has a flanking sequence as shown in SEQ ID NO.1, QFhb-3BL The KASP marker has a differential SNP flanking sequence in the coding region as shown in SEQ ID NO.4 and a differential SNP flanking sequence in the promoter region as shown in SEQ ID NO.

8.

2. The molecular marker according to claim 1, characterized in that The differential SNP in the coding region is of G base type for disease-resistant varieties, and of A base type for susceptible varieties; the differential SNP in the promoter region is of T base type for disease-resistant varieties, and of C base type for susceptible varieties.

3. The primer set for molecular marker according to claim 1 or 2, characterized in that: Said QFhb-2DL The sequences of the primer sets used for the dcaps labeling are shown in SEQ ID NO.2 and SEQ ID NO.3; Said QFhb-3BL The primer set used for the KASP marker includes a KASP.3B.1 primer set or a KASP.3B.2 primer set. The sequence of the KASP.3B.1 primer set is shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the sequence of the KASP.3B.2 primer set is shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.

11.

4. A kind of utilization QFhb-2DL and QFhb-3BL A method for improving wheat fusarium head blight resistance, characterized in that: The steps include: Step S1, select the carrying site QFhb-2DL and QFhb-3BL The wheat varieties or lines with disease-resistant alleles are used as donors, and the wheat varieties with short stems, large ears and multiple ears and resistance to stripe rust are used as recipients. The two parents are crossed to obtain F0, and the F0 is planted. When it blooms, it is crossed with the recipient to harvest BC1F1 seeds. Step S2, planting BC1F1, and extracting leaf DNA when seedlings emerge. QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F1 plants with both genes / locus positive (heterozygous or homozygous) were selected to harvest BC1F2; Step S3, select BC1F2 in planting, use QFhb-2DL and QFhb-3BL Linked marker detection was performed to select BC1F2 plants with both genes / locus positive (heterozygous or homozygous) for tillering, lodging resistance, stripe rust resistance, and fusarium head blight resistance, and the selected BC1F3 seeds were harvested; Step S4, planting BC1F3, using QFhb-2DL and QFhb-3BL Linked marker detection was performed, and BC1F3 plants with both genes / locus positive (heterozygous or homozygous) were selected. During the flowering period of wheat, spores of Fusarium fusogenum were sprayed on the plants, and the plants with Fusarium fusogenum diseased spikelet rate ≥ 25% and diseased spikelet rate greater than the control were eliminated. The plants with poor stem elasticity, easy lodging, and plant height greater than 90 cm were eliminated, and the seeds of BC1F4 plants were selected from the harvest. Step S5, planting BC1F4, extracting leaf DNA at the seedling stage, and using QFhb-2DL and QFhb-3BL The linked markers of BC1F4 were tested for mixed samples of plants and rows. For the plants and rows with heterozygous test results, the genes were further tested according to the individual plants to clarify the genotypes of the BC1F4 plants at the two genes / locus; the BC1F4 was inoculated with the fusarium spore pathogen by dripping in the single flowers during the flowering period. After 21 days of inoculation, the genotypes of the individual plants of BC1F4 and the results of fusarium spore resistance were comprehensively analyzed, and the plants or rows with the identification results of "high resistance-resistance" were retained. Then, the comprehensive agronomic traits of the selected plants and rows or plants were comprehensively examined, and the excellent plants and rows and plants were selected. After harvest, the grain weight and yield were identified, and the BC1F5 seeds with higher grain weight and yield levels than the control were selected; Step S6, planting BC1F5, growing into strains, and using QFhb-2DL and QFhb-3BL The lines of BC1F5 were mixed by using the linked marker test, and the lines with both genes being homozygous positive were selected. The lines were inoculated with the pathogen of Fusarium fusarium in single flowers during the flowering period, and the lines with the identification results of "high resistance-resistance" were retained. The comprehensive agronomic traits of the selected lines were comprehensively investigated, and the selected lines were mixed and harvested. After harvest, the grain weight and yield were identified, and the BC1F6 lines with grain weight and yield levels higher than the control were selected; Step S7, planting BC1F6 in plots, examining the comprehensive agronomic traits of the plot lines, and conducting yield identification after harvesting the excellent plots, selecting plots with a yield level 5% higher than the control, and entering the next generation of multi-point yield identification; in, QFhb-2DL The linked marker is as described in claim 1 or 2 QFhb-2DL DCAPS markers, QFhb-3BL The linked marker is as described in claim 1 or 2 QFhb-3BL The KASP marker is used, and the primer set used is the primer set described in claim 3.

5. The method according to claim 4, characterized in that In step S1, the donor is Yangmai 16, Yangmai 17, Yangmai 14, Yangmai 14-197 or Yangmai 39, and the recipient parent is Chuanmai 98, Chuanmai 93, Chuanmai 42 or Chuanmai 104.

6. The method according to claim 4, characterized in that In step S3, the screening method for disease resistance, tillering and lodging resistance of the BC1F2 generation is as follows: the disease resistance is based on Sichuan Agricultural University 32 as the standard, and the individual plants with worse disease resistance than Sichuan Agricultural University 32 are eliminated; the tillering is based on Sichuan Agricultural University 32 as the control, and the individual plants with less tillers per plant than Sichuan Agricultural University 32 are eliminated; the screening for lodging resistance is to examine the plant height, stem elasticity and lodging resistance, and eliminate individual plants that are easy to lodging, have poor elasticity and have a plant height greater than 90 cm.

7. The method according to claim 4, characterized in that In step S4, the concentration of the spore solution of Fusarium fusiformis is 2×10 5 ~3×10 5 Spores / mL.

8. The method according to claim 4, characterized in that In steps S5 and S6, the single flower of the listed plant row is inoculated with the pathogen of Fusarium fusae during the flowering period, and the plant row with the identification result of "high resistance-resistance" is retained. Specifically, 4×10 spore suspension of Fusarium fusae is prepared. 5 ~5×10 5 spores / mL. In the field, during the flowering period of wheat, single flower drip inoculation was used. 20 ears were randomly selected from each row or strain, and inoculated at the opened floret in the middle of each ear, and marked. After inoculation, the inoculated ears were sprayed with water every 2 hours from 8:30 to 17:30 every day, and the wheat ears were sprayed evenly and fully for 10 minutes each time. The spraying was stopped immediately after 20 days of wheat flowering. 21 days after inoculation, the disease situation of the inoculated ears was investigated, and the number of diseased spikelets per ear and the total number of spikelets were counted. The rows or strains with fusarium fusarium severity PSS ≤ 15% and close to the "high resistance-resistance" level of Sumai No. 3 were retained. Sumai No. 3 and Annong 8455 were used as resistant and susceptible controls, respectively, Yangmai 25 was used as a moderately resistant control, and Yangmai 13 was used as a moderately susceptible control.

9. The method according to claim 4, characterized in that In steps S5, S6 and S7, the comprehensive agronomic traits of the selected plant rows, plant lines and varieties are comprehensively examined, specifically: plant height less than 90 cm, good lodging resistance, number of ears per plant greater than or equal to 5, and number of grains per ear greater than or equal to 48.

10. The method according to claim 4, characterized in that In steps S5, S6 and S7, the control is Sichuan Agricultural University 32.

Images