Molecular marker closely linked with male fertility of pepper core and application of molecular marker

Abstract

The invention discloses molecular markers closely linked with pepper nuclear male sterility, the molecular markers are respectively named as Ind-Sc1 and Ind-Vc21, the marker Ind-Sc1 is composed of a nucleotide fragment as shown in a sequence SEQ ID NO.1 and a nucleotide fragment as shown in a sequence SEQ ID NO.2, the fragment as shown in the sequence SEQ ID NO.1 is closely linked with a pepper nuclear male sterility gene Msc-5, and the fragment as shown in the sequence SEQ ID NO.2 is closely linked with a pepper nuclear male sterility gene msc-5; the marker Ind-Vc21 is composed of a nucleotide fragment as shown in a sequence SEQ ID NO.3 and a nucleotide fragment as shown in a sequence SEQ ID NO.4, the fragment as shown in the sequence SEQ ID NO.3 is closely linked with a pepper nuclear male sterility gene Msc-5, and the fragment as shown in the sequence SEQ ID NO.4 is closely linked with a pepper nuclear male sterility gene msc-5. The molecular marker and the primer pair have the beneficial effects that the molecular marker closely linked with the pepper nuclear male fertility and the corresponding primer pair are provided.

Description

Technical Field

[0001] The invention relates to the field of plant genetic breeding and molecular biology, and in particular to a molecular marker closely linked to the male fertility of pepper kernels and an application thereof. Background Art

[0002] Pepper is an important vegetable crop in my country. In recent years, the planting area has remained stable at more than 2.1 million hectares, making it the largest vegetable crop in terms of planting area. Because pepper is a cross-pollination crop, it has outstanding hybrid vigor. More than 90% of the pepper varieties currently promoted and applied in China are F1 hybrids.

[0003] At present, pepper hybrid seed production includes two methods: artificial emasculation and male sterile hybrid seed production. However, artificial emasculation is slow, time-consuming, and incomplete, resulting in high seed production costs, unstable yields, and hybrid purity that is difficult to guarantee. The discovery and application of pepper male sterility traits can not only solve the problem of artificial emasculation and reduce production costs, but also improve the purity and yield of the first generation of hybrids, while also effectively protecting independent intellectual property rights.

[0004] From the perspective of genotype composition, heritable plant male sterility can be divided into two types: nuclear male sterility (or nuclear male sterility, i.e. NMS) and nuclear-cytoplasmic male sterility (or cytoplasmic male sterility, i.e. CMS). Pepper is one of the few crops that has both NMS and CMS systems. At present, both systems have been widely used in the production of pepper hybrid seeds in China.

[0005] In pepper, nuclear male sterility has its own advantages compared to cytoplasmic male sterility. First, most nuclear male sterility traits are controlled by a pair of recessive genes, and the inheritance pattern is simple and stable, which is easy to transfer. In addition, nuclear male sterility is completely sterile and not easily affected by the environment, so it can adapt to a wider area. Finally, nuclear male sterility has a wide range of restoration sources, and there are fewer limiting factors in the breeding of hybrids, which overcomes the problem of lack of restoration sources in sweet peppers and large-fruited peppers.

[0006] Compared with model plants and other crops, molecular research on nuclear male sterility in pepper started relatively late. Although more than 20 nuclear male sterility genes have been identified, only three have been precisely located or cloned, namely msc-1, msc-2 (ms1 and msw are the same gene) and msc-3, and even less is known about the molecular mechanism of nuclear male sterility in pepper.

[0007] Therefore, the discovery and cloning of pepper nuclear male sterility genes is not only of great significance to pepper seed production and other production practices, but also can provide theoretical support for clarifying the molecular mechanism of pepper nuclear male sterility, which is of great scientific significance. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a molecular marker closely linked to the male fertility of pepper kernels and a corresponding primer pair.

[0009] Another object of the present invention is to provide the use of the molecular marker tightly linked to the male fertility of pepper kernels in molecular marker-assisted breeding.

[0010] The technical solution adopted by the present invention is:

[0011] The molecular markers tightly linked to male fertility of pepper nuclear are named Ind-Sc1 and Ind-Vc21, respectively. The marker Ind-Sc1 is composed of the nucleotide fragment shown in the sequence SEQ ID NO.1 and the nucleotide fragment shown in SEQ ID NO.2. The fragment shown in SEQ ID NO.1 is tightly linked to the male fertility gene Msc-5 of pepper nuclear, and the fragment shown in SEQ ID NO.2 is tightly linked to the male sterility gene msc-5 of pepper nuclear.

[0012] The marker Ind-Vc21 consists of a nucleotide fragment shown in SEQ ID NO.3 and a nucleotide fragment shown in SEQ ID NO.4, wherein the fragment shown in SEQ ID NO.3 is tightly linked to the pepper nuclear male fertility gene Msc-5, and the fragment shown in SEQ ID NO.4 is tightly linked to the pepper nuclear male sterility gene msc-5.

[0013] A primer can amplify the molecular markers Ind-Sc1 and Ind-Vc21 which are closely linked to the male fertility of pepper kernels.

[0014] Furthermore, the primers shown in SEQ ID NO.5 and SEQ ID NO.6 can amplify the molecular marker Ind-Sc1 which is closely linked to the male fertility of pepper kernels.

[0015] Furthermore, the primers shown in SEQ ID NO.7 and SEQ ID NO.8 can amplify the molecular marker Ind-Vc21 which is closely linked to the male fertility of pepper kernels.

[0016] Application of molecular markers Ind-Sc1 and Ind-Vc21 tightly linked to male fertility in pepper kernels in assisted breeding.

[0017] An assisted breeding method uses molecular markers Ind-Sc1 and (or) Ind-Vc21 that are closely linked to the nuclear male fertility of pepper, comprising the following steps: taking annual pepper as the breeding object, amplifying the DNA of the plant to be tested at the seedling stage, if the fragments shown by SEQ ID NO.1 and (or) SEQ ID NO.3 exist in the amplified product or exist at the same time, it indicates that the plant is nuclear male fertile, and if only the fragments shown by SEQ ID NO.2 and (or) SEQ ID NO.4 exist in the amplified product, it indicates that the plant is nuclear male sterile.

[0018] Furthermore, the primers shown in SEQ ID NO.5 and SEQ ID NO.6 are used to amplify the DNA of the plant to be tested. If the fragment shown in SEQ ID NO.1 exists in the amplified product, it indicates that the plant is nuclear male fertile. If only the fragment shown in SEQ ID NO.2 exists in the amplified product, it indicates that the plant is nuclear male sterile.

[0019] Furthermore, the primers shown in SEQ ID NO.7 and SEQ ID NO.8 are used to amplify the DNA of the plant to be tested. If the fragment shown in SEQ ID NO.3 exists in the amplified product, it indicates that the plant is nuclear male fertile. If only the fragment shown in SEQ ID NO.4 exists in the amplified product, it indicates that the plant is nuclear male sterile.

[0020] The invention discloses an auxiliary breeding kit, which contains reagents for detecting molecular markers Ind-Sc1 and Ind-Vc21 which are closely linked to the male fertility of pepper kernels.

[0021] The beneficial effects of the present invention are:

[0022] The invention discloses two tightly linked molecular markers Ind-Sc1 and Ind-Vc21 of a new nuclear male fertility gene of pepper. The two markers locate the new nuclear male fertility gene within a range of about 1.71 Mb between 131056324-132768069 bp on chromosome 1 of pepper, thereby realizing the fine positioning of the nuclear male fertility gene of pepper.

[0023] The molecular markers closely linked to pepper nuclear male fertility in the present invention lay the foundation for the final cloning of pepper nuclear male fertility genes and the establishment of a molecular marker-assisted breeding system; the molecular markers of the present invention can be simply, quickly and high-throughput applied to pepper seed production and breeding practices. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is a schematic diagram of BSA-seq association analysis.

[0025] Figure 2It is the physical map of pepper nuclear male sterility gene msc-5.

[0026] Figure 3 This is a genotype analysis of the 3076AB dual-purpose line population (part) using two markers.

[0027] Figure 4 It is a genotype analysis of the F2 population (part) using two markers. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with the accompanying drawings.

[0029] Wherein SEQ ID NO.1:

[0030] TGAGTCTAAGCCACACTTTTCCTACTTAAATGTAAAGCTTTTTTTAAGTTCTGGACGTGTGACGTGAATCTAATTCACACGGTCTTACTACTTGACTAAAGCCTAAGAGGTCGTTAGTACATAGGGATTT

[0031] SEQ ID NO.2:

[0032] TGAGTCTAAGCCACACTTTTCCTACTTAAATGTAAAGCTTTTTTTAAGTTCTGGACGTGTGACGTGAATCTAATTCACACATCATGTGTTAGGGTCTTACTACTTGACTAAAGCCTAAGAGGTCGTTAGTACATAGGGATTT

[0033] SEQ ID NO.3:

[0034] CCTTGTTCCTTTTCAGGCATTACGGCATGAAAACTCTCTTTGACAAGAGGTGGTAGTAGAGCACGAGGAAGTGGAGAGTCAGCTAAGAGTGAGAAGGCACCTGTCTTCAATACTCAACAATGAGATAGGTCAATCCTTCCTGTCTTCAATACTCAACAATGAGATAGGTCAATCCTTACACTCTCCAAGTCTGAAAAGAAGAGTGAGAGAAACACTAGTAGTACCAGTTCGAGCCCAGATGAGGAAGGGGTCAACACATCTAACCCCAACCCCATTGACGCGGAAACTGGCTATGCTGAGACAAAAACCAAGGAAGAAACTGTGG

[0035] SEQ ID NO.4:

[0036] CCTTGTTCCTTTTCAGGCATTACGGCATGAAAACTCTCTTTGACAAGAGGTGGTAGTAGAGCACGAGGAAGTGGAGAGTCAGCTAAGAGTGAGAAGGCACCTGTCTTCAATACTCAACAATGAGATAGGTCAATCCTTACACTCTCCAAGTCTGAAAAGAAGAGTGAGAGAAACACTAGTAGTACCAGTTCGAGCCCAGATGAGGAAGGGGTCAACACATCTAACCCCAACCCCATTGACGCGGAAACTGGCTATGCTGAGACAAAAACCAAGGAAGAAACTGTGG

[0037] SEQ ID NO.5:

[0038] TGAGTCTAAGCCACACTTTTCTCTAC

[0039] SEQ ID NO.6:

[0040] AAATCCCTATGTACTAACGACCTCTT

[0041] SEQ ID NO.7:

[0042] CCTTGTTCCTTTTCAGGCATTAC

[0043] SEQ ID NO.8:

[0044] CCACAGTTTCTTCCTTGGTTTTT

[0045] 3076AB is a dual-purpose sweet pepper nuclear male sterile line, with the 3076A sterile line as the female parent and the 3076B maintainer line (fertile) as the male parent. BC1 and F2 segregation populations were constructed through sister backcrossing and selfing, respectively. The genetic pattern survey showed that the male sterility trait of 3076A was controlled by a pair of recessive genes, so it was named msc-5.

[0046] Based on the clear inheritance pattern, 2 Thirty fertile and thirty sterile plants were randomly selected from the segregating population, and DNA was extracted to construct fertile and sterile DNA pools, respectively. The msc-5 nuclear sterile gene was preliminarily located in the approximately 13.20 Mb interval on pepper chromosome 1 using BSA-seq technology ( Figure 1 Next, we increased the segregation population (about 3,500 strains) and developed polymorphic InDel molecular markers within the initial positioning interval, further finely positioning the msc-5 nuclear sterility gene within a range of about 1.71 Mb between markers Ind-Sc1 and Ind-Vc21 ( Figure 2 ), 15 genes were annotated in this region.

[0047] Ind-Sc1 is composed of the nucleotide fragment shown in the sequence SEQ ID NO.1 and the nucleotide fragment shown in the sequence SEQ ID NO.2, wherein the fragment shown in SEQ ID NO.1 is tightly linked to the pepper nuclear male fertility gene Msc-5, and the fragment shown in SEQ ID NO.2 is tightly linked to the pepper nuclear male sterility gene msc-5; Ind-Sc1 is amplified by the upstream primer sequence SEQ ID NO.5 and the downstream primer sequence SEQ ID NO.6.

[0048] Ind-Vc21 is composed of the nucleotide fragment shown in the sequence SEQ ID NO.3 and the nucleotide fragment shown in the sequence SEQ ID NO.4, wherein the fragment shown in SEQ ID NO.3 is closely linked to the pepper nuclear male fertility gene Msc-5, and the fragment shown in SEQ ID NO.4 is closely linked to the pepper nuclear male sterility gene msc-5; Ind-Vc21 is amplified by the upstream primer sequence SEQ ID NO.7 and the downstream primer sequence SEQ ID NO.8.

[0049] The molecular biology experimental techniques used in the above implementation process include DNA extraction, PCR amplification, PAGE gel electrophoresis and other experiments. Unless otherwise specified, they are usually operated according to conventional methods or the conditions recommended by the manufacturer. The BSA-seq experiment was commissioned by Beijing Biomarker Biotechnology Co., Ltd.

[0050] The application of the above-mentioned molecular markers closely linked to the nuclear male fertility of pepper in molecular marker-assisted breeding of pepper is to take annual pepper as the breeding object, and use the upstream primer sequence SEQ ID NO.5 and the downstream primer sequence SEQ ID NO.6 or the upstream primer sequence SEQ ID NO.7 and the downstream primer sequence SEQ ID NO.8 to PCR amplify the DNA of the plant to be tested at the seedling stage. If the fragments shown by SEQ ID NO.1 and (or) SEQ ID NO.3 are present in the amplified product, it indicates that the plant is nuclear male fertile. If only the fragments shown by SEQ ID NO.2 and (or) SEQ ID NO.4 are present in the amplified product, it indicates that the plant is nuclear male sterile.

[0051] Field trial verification

[0052] The molecular biology experimental techniques used in the following experiments include DNA extraction, PCR amplification, PAGE gel electrophoresis and other experiments. Unless otherwise specified, they are usually operated according to conventional methods or the conditions recommended by the manufacturer.

[0053] Experiment 1

[0054] 200 seeds of 3076AB dual-purpose line (sister backcross population) were sown in a 50-hole seedling tray, and 192 seedlings emerged. The seedling leaves were picked at the 2-3 true leaf stage to extract DNA. After the quality inspection was qualified, the genotypes of the 192 plants were detected with the two markers provided by the present invention. The results showed that SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 fragments were detected in 98 plants (hereinafter referred to as group 1), and only SEQ ID NO.2 and SEQ ID NO.4 fragments were detected in the other 94 plants (hereinafter referred to as group 2). When the 6-8 true leaves stage came, the 192 plants were transplanted to the field respectively, and the pollen fertility of each plant was investigated during the flowering period. The results showed that all the plants in group 1 were heterozygous fertile plants, and all the plants in group 2 were sterile plants. Therefore, in this group, the plant phenotype and genotype were 100% completely consistent ( Figure 3 ).

[0055] Experiment 2

[0056] In order to transfer the sterility gene msc-5 carried by the 3076A sterile line into other excellent pepper inbred line materials, we used the 3076A sterile line as the female parent and the excellent pepper inbred line M601 as the male parent to obtain F 1 Offspring, F 1 Self-pollination to obtain F 2A total of 208 plants were isolated, and the leaves of the seedlings were picked to extract DNA. After the quality inspection was passed, the genotypes of the 208 plants were detected with the two markers provided by the present invention. The results showed that SEQ ID NO.1 and SEQ ID NO.3 fragments were detected in 52 plants (hereinafter referred to as group 1); SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 fragments were simultaneously detected in 105 plants (hereinafter referred to as group 2); SEQ ID NO.2 and SEQ ID NO.4 fragments were detected in 51 plants (hereinafter referred to as group 3). According to the purpose of the experiment, group 1 was eliminated at the seedling stage, and groups 2 and 3 were transplanted to the field. During the flowering period, sister backcrossing was carried out with group 3 as the female parent and group 2 as the male parent for subsequent breeding experiments. Pollen fertility surveys during the flowering period showed that all plants in group 2 were heterozygous fertile plants, and all plants in group 3 were sterile plants, indicating that the use of the two molecular markers of the present invention for auxiliary selection is accurate and reliable ( Figure 4 ).

[0057] The present invention and its embodiments are described above, and such description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. In short, if ordinary technicians in the field are inspired by it, without departing from the purpose of the invention, they can design a structure and embodiment similar to the technical solution without creativity, which should belong to the protection scope of the present invention.

Claims

1. Molecular markers closely linked to pepper nuclear male fertility, named Ind-Sc1 and Ind-Vc21, are characterized by: The marker Ind-Sc1 is composed of a nucleotide fragment shown in SEQ ID NO.1 and a nucleotide fragment shown in SEQ ID NO.2, wherein the fragment shown in SEQ ID NO.1 is tightly linked to the pepper nuclear male fertility gene Msc-5, and the fragment shown in SEQ ID NO.2 is tightly linked to the pepper nuclear male sterility gene msc-5; The marker Ind-Vc21 consists of a nucleotide fragment shown in SEQ ID NO.3 and a nucleotide fragment shown in SEQ ID NO.4, wherein the fragment shown in SEQ ID NO.3 is tightly linked to the pepper nuclear male fertility gene Msc-5, and the fragment shown in SEQ ID NO.4 is tightly linked to the pepper nuclear male sterility gene msc-5.

2. A primer, characterized in that: The molecular marker tightly linked to the male fertility of pepper kernels as claimed in claim 1 can be amplified.

3. The primer according to claim 2, characterized in that: The primers shown in SEQ ID NO.5 and SEQ ID NO.6 can amplify the molecular marker Ind-Sc1 which is closely linked to the male fertility of pepper kernels.

4. The primer according to claim 2, characterized in that: The primers shown in SEQ ID NO.7 and SEQ ID NO.8 can amplify the molecular marker Ind-Vc21 which is closely linked to the male fertility of pepper kernels.

5. Use of the molecular marker tightly linked to male fertility of pepper kernels as claimed in claim 1 in assisted breeding.

6. An assisted breeding method, characterized in that: The method of using the molecular marker closely linked to the male fertility of pepper kernels as claimed in claim 1 comprises the following steps: taking pepper as breeding object, amplifying the DNA of the plant to be tested at the seedling stage, When the fragments shown in SEQ ID NO.1 and / or SEQ ID NO.3 are present in the amplified product, it indicates that the plant to be tested is nuclear male fertile. When only the fragments shown in SEQ ID NO. 2 and / or SEQ ID NO. 4 exist in the amplified product, it indicates that the plant is nuclear male sterile.

7. The assisted breeding method according to claim 6, characterized in that: Amplify the DNA of the plant to be tested using the primers shown in SEQ ID NO.5 and SEQ ID NO.6; When the fragment shown in SEQ ID NO.1 is present in the amplified product, it indicates that the plant is nuclear male fertile; When only the fragment shown in SEQ ID NO. 2 exists in the amplified product, it indicates that the plant is nuclear male sterile.

8. The assisted breeding method according to claim 6, characterized in that: Amplify the DNA of the plant to be tested using the primers shown in SEQ ID NO.7 and SEQ ID NO.8; When the fragment shown in SEQ ID NO.3 is present in the amplified product, it indicates that the plant is nuclear male fertile; When only the fragment shown in SEQ ID NO. 4 exists in the amplified product, it indicates that the plant is nuclear male sterile.

9. An assisted breeding kit, characterized in that: It contains reagents for detecting the molecular markers tightly linked to the male fertility of pepper kernels as claimed in claim 1.

Images