Applications of hyaluronic acid synthase 2 and its inhibitors

Abstract

This invention proposes the application of hyaluronic acid synthase 2 (HAS2) and its inhibitors, belonging to the field of biomedical technology. This invention provides the application of HAS2 as a therapeutic target for diseases caused by hyaluronic acid accumulation. Experiments have demonstrated a correlation between HAS2 and hyaluronic acid accumulation, thus enabling the treatment of related diseases. Inhibiting the expression of HAS2 can reduce hyaluronic acid production, thereby significantly alleviating or preventing related diseases. This invention provides a novel use of HAS2 as a target for the treatment or prevention of diseases caused by hyaluronic acid accumulation, offering a new strategy for clinical practice.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of hyaluronic acid synthase 2 and the application of hyaluronic acid synthase inhibitors. Background Technology

[0002] The glomerular basement membrane (GBM) is a part of the glomerulus of the kidney, located between capillary endothelial cells and podocytes, and is an important component of the glomerular filtration barrier. The GBM is mainly composed of type IV collagen, laminin, heparan sulfate proteoglycan, and other proteins, which work together to maintain its structural integrity and selective filtration function.

[0003] The primary function of the glomerular basement membrane (GBM) is as a crucial part of the glomerular filtration barrier. It helps determine which substances can be filtered from the blood into the urine, while preventing the inappropriate passage of large molecules such as plasma proteins and red blood cells. This selective filtration is essential for maintaining homeostasis. When the structure of the GBM is abnormal, it can lead to a variety of diseases, often caused by genetic defects or autoimmune reactions. Several diseases caused by GBM abnormalities include Alport syndrome, thin basement membrane nephropathy, and related conditions.

[0004] Hyaluronan synthase (HAS) is a class of enzymes responsible for synthesizing hyaluronic acid (HA). Hyaluronic acid is an important polysaccharide widely found in animal tissues, particularly in connective tissue, skin, vitreous humor of the eye, and synovial fluid. It plays a vital role in maintaining the structure of the extracellular matrix, lubricating joints, retaining skin moisture, and participating in various physiological processes.

[0005] Hyaluronic acid synthases are located on the cell membrane. In humans and other mammals, three different types of hyaluronic acid synthases exist, designated HAS1, HAS2, and HAS3. While all three enzymes can synthesize hyaluronic acid, their expression levels vary across different tissues. The activity of hyaluronic acid synthases is regulated by multiple factors, including gene expression levels, cell signaling pathways, and changes in external environmental conditions. Furthermore, these enzymes are associated with several disease states; for example, abnormally high expression in cancer may lead to tumor growth and metastasis, making them potential therapeutic targets. However, the mechanism of action of HAS2 in diseases caused by changes in the glomerular basement membrane remains unclear. Summary of the Invention

[0006] The main objective of this invention is to provide an application of hyaluronic acid synthase 2 and an application of hyaluronic acid synthase inhibitors, aiming to study the application of hyaluronic acid synthase 2 as a new target for the treatment of diseases caused by hyaluronic acid accumulation, and to provide a theoretical basis for the development of novel therapeutic drugs.

[0007] To achieve the above objectives, the present invention provides the application of hyaluronic acid synthase 2 as a therapeutic target for diseases caused by hyaluronic acid accumulation.

[0008] In some implementations, the disease includes diabetic nephropathy.

[0009] This invention provides the use of hyaluronic acid synthase 2 in formulations for treating diseases caused by hyaluronic acid accumulation.

[0010] In some embodiments, the formulation is used to regulate the accumulation of hyaluronic acid.

[0011] In some embodiments, the formulation includes proteins, nucleic acid molecules, or mutants.

[0012] This invention provides the use of hyaluronic acid synthase 2 in a formulation for treating diseases caused by abnormalities of the glomerular basement membrane.

[0013] In some implementations, the disease includes Alport syndrome.

[0014] This invention provides the use of a hyaluronic acid synthase inhibitor in the preparation of formulations for the treatment or prevention of Alport syndrome.

[0015] In some embodiments, the hyaluronic acid synthase inhibitor includes 4-methylumbelliferone.

[0016] This invention provides the application of hyaluronic acid synthase 2 (HAS2) in the preparation of formulations for diseases caused by hyaluronic acid accumulation. HAS2 serves as a target, and this invention experimentally demonstrates a correlation between HAS2 and hyaluronic acid accumulation. Therefore, it can treat related diseases caused by hyaluronic acid accumulation. Inhibiting the expression of HAS2 can reduce hyaluronic acid production, thereby significantly alleviating or preventing related diseases. This invention provides a novel use of HAS2 as a target in the treatment or prevention of diseases caused by hyaluronic acid accumulation, offering a new strategy for clinical practice. Attached Figure Description

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Comparison of urinary albumin levels between AS mice and wild-type mice;

[0019] Figure 2 This is a schematic diagram showing the changes in the glomerular basement membrane of AS mice under an electron microscope.

[0020] Figure 3 A schematic diagram comparing renal parenchymal abnormalities in wild-type mice and AS mice;

[0021] Figure 4 A schematic diagram showing the comparison of HAS2 fluorescent staining in tissues of AS mice and wild-type mice;

[0022] Figure 5 A schematic diagram showing the changes in HA levels in tissues of AS mice and wild-type mice;

[0023] Figure 6 This is a schematic diagram showing the expression of HAS1, HAS2, and HAS3 in the kidney tissue of AS mice.

[0024] Figure 7 Knocking down COL4A5 in human kidney-derived HEK293 cells to mimic the pathogenesis of AS revealed a significant increase in HAS2 RNA levels, while HAS1 and HAS3 showed no significant changes.

[0025] Figure 8 Schematic diagram of protein level detection after COL4A5 knockdown in HEK293 cells;

[0026] Figure 9 This is a schematic diagram comparing the immunofluorescence of AS mice treated with and without 4-MU.

[0027] Figure 10 A schematic diagram showing the comparison of pathological staining in AS mice treated with and without 4-MU.

[0028] Figure 11 This is a schematic diagram comparing urinary protein levels in AS mice treated with and without 4-MU.

[0029] Figure 12 This is a statistical comparison of the survival status of 25 AS mice treated with 4-MU and 31 AS mice not treated with 4-MU.

[0030] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Where the manufacturers of reagents or instruments are not specified, they are all conventional products that can be purchased commercially. Furthermore, the meaning of "and / or" throughout the text includes three parallel solutions; for example, "A and / or B" includes solution A, or solution B, or a solution where both A and B are satisfied simultaneously. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Hyaluronan synthase (HAS) is a class of enzymes responsible for synthesizing hyaluronic acid (HA). Hyaluronic acid is an important polysaccharide widely found in animal tissues, particularly in connective tissue, skin, vitreous humor of the eye, and synovial fluid. It plays a vital role in maintaining the structure of the extracellular matrix, lubricating joints, retaining skin moisture, and participating in various physiological processes.

[0033] Hyaluronic acid synthases are located on the cell membrane. In humans and other mammals, three different types of hyaluronic acid synthases exist, designated HAS1, HAS2, and HAS3. While all three enzymes can synthesize hyaluronic acid, their expression levels vary across different tissues. The activity of hyaluronic acid synthases is regulated by multiple factors, including gene expression levels, cell signaling pathways, and changes in external environmental conditions. Furthermore, these enzymes are associated with several disease states; for example, abnormally high expression in cancer may lead to tumor growth and metastasis, making them potential therapeutic targets. However, the mechanism of action of HAS2 in diseases caused by changes in the glomerular basement membrane remains unclear.

[0034] In view of this, the present invention provides the use of hyaluronic acid synthase 2 as a therapeutic target for diseases caused by hyaluronic acid accumulation.

[0035] It should be noted that the occurrence of these diseases caused by renal interstitial changes and interstitial disease is accompanied by the accumulation of HA. This invention has found that inhibiting HAS2 can reduce the accumulation of HA, thereby treating and / or improving related diseases. Therefore, this invention proposes that HAS2 is a potential therapeutic target with good application prospects in the treatment of diseases caused by hyaluronic acid accumulation.

[0036] Furthermore, the diseases mentioned include diabetic nephropathy, such as diabetic nephropathy, ischemia-reperfusion kidney injury, interstitial nephritis, kidney injury caused by urinary tract obstruction, and kidney trauma repair, all of which can cause the accumulation of HA in kidney tissue. Therefore, if hyaluronic acid synthase 2 can reduce the accumulation of hyaluronic acid, it can also slow down or treat the related diseases.

[0037] In some embodiments of the present invention, the present invention provides the use of hyaluronic acid synthase 2 in formulations for treating diseases caused by hyaluronic acid accumulation. That is, hyaluronic acid synthase 2 can be prepared into a formulation for inhibiting diseases caused by hyaluronic acid accumulation.

[0038] In some embodiments of the present invention, the formulation is used to regulate the accumulation of hyaluronic acid.

[0039] This is because hyaluronic acid can accumulate in the damaged glomerular basement membrane in cases of glomerular disease, and therefore this preparation can be used to treat related diseases by regulating the accumulation of hyaluronic acid.

[0040] In some embodiments of the present invention, the hyaluronic acid synthase inhibitor includes a protein, a nucleic acid molecule, or a mutant. The preparation is not limited to any one of the proteins, nucleic acid molecules, or mutants, and can be prepared according to actual needs.

[0041] The present invention also provides the use of hyaluronic acid synthase 2 in formulations for treating diseases caused by abnormalities of the glomerular basement membrane.

[0042] It is understandable that the glomerulus is the basic filtration unit of the kidney, and its basement membrane (GBM) is a complex structure composed of various proteins and polysaccharides, playing a role in selectively filtering plasma components. When the GBM is abnormal, it may affect this screening process, leading to symptoms such as proteinuria and hematuria, and may further develop into renal insufficiency. This invention discovers that hyaluronic acid synthase 2 can be used as a therapeutic target for diseases caused by glomerular basement membrane abnormalities. Therefore, hyaluronic acid synthase 2 can be prepared into a formulation for the treatment of diseases caused by glomerular basement membrane abnormalities.

[0043] Specifically, in some embodiments of the present invention, the disease includes Alport syndrome.

[0044] It is understandable that Alport syndrome is a hereditary kidney disease caused by mutations in the type IV collagen α3, α4, and α5 chain genes (COL4A3, COL4A4, and COL4A5). The collagen complex formed by α3, α4, and α5 is specifically expressed on the glomerular basement membrane (GBM) and plays a crucial role in constructing and maintaining the glomerular filtration membrane structure. Collagen mutations prevent the normal formation of the α3, α4, and α5 complex, causing structural changes in the filtration barrier, thereby inducing progressive chronic renal impairment and renal interstitial abnormalities. X-linked COL4A5 mutations account for more than 80% of clinical AS cases, and their symptoms are more severe. This is the essential difference in pathological mechanism between Alport nephritis and other clinical kidney diseases and nephritis. Therefore, currently, it is not possible to treat the underlying cause of Alport syndrome clinically.

[0045] The present invention also provides the use of a hyaluronic acid synthase inhibitor in the preparation of a formulation for the treatment or prevention of Alport syndrome.

[0046] Specifically, the hyaluronic acid synthase inhibitor includes a biological agent that binds to hyaluronic acid synthase 2 to inhibit the synthesis of hyaluronic acid. That is, the agent of the present invention can inhibit or reduce the expression or activity of the hyaluronic acid synthase 2 gene, or inhibit or reduce the translation of the hyaluronic acid synthase 2 gene into protein, or inhibit or reduce the activity or function of the hyaluronic acid synthase 2 protein.

[0047] Hyaluronic acid (HA) is an extracellular matrix glycosaminoglycan that plays an important role in chronic inflammation, cancer, and autoimmunity. Hyaluronic acid is a major component of connective tissues such as the intercellular matrix, vitreous humor of the eye, and synovial fluid of joints. In the body, it plays an important physiological role in water retention, maintaining extracellular space, regulating osmotic pressure, lubrication, and promoting cell repair.

[0048] In some embodiments, the hyaluronic acid synthase inhibitor includes 4-methylumbelliferone.

[0049] Understandably, 4-methylumbelliferone (4-MU) is a small molecule compound with a molecular weight of 176 that can inhibit hyaluronic acid synthesis by inhibiting HAS2 activity. The application of 4-MU in the treatment of Alport syndrome has not been reported to date. This invention finds that the use of 4-methylumbelliferone can effectively alleviate the progression of Alport nephropathy.

[0050] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the present invention and are not intended to limit the present invention.

[0051] The mice used in the following examples were purchased from Guangdong Yaokang Biotechnology Co., Ltd.;

[0052] The human kidney-derived HEK293 cells were obtained from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.

[0053] Example 1

[0054] COL4A5 knockout mice can effectively mimic the abnormalities of Alport syndrome.

[0055] A COL4A5 knockout mouse model, named AS mouse, was obtained by gene editing that knocked out exons 3-20 of the COL4A5 gene. Urinary albumin levels in AS mice aged 4-26 weeks and wild-type mice were detected using enzyme-linked immunosorbent assay (ELISA). The test results are as follows: Figure 1 As shown: Figure 1 HC in the text represents controls for healthy control mice and AS mice, derived from... Figure 1 It can be seen that as the mice grow, the urinary protein level of AS mice increases significantly, indicating that AS mice have significant renal function impairment compared with wild-type control mice.

[0056] Further investigation revealed that at 6-7 weeks of age, glomerular basement membrane development was observed in COL4A5 knockout mice and wild-type mice, and transmission electron microscopy results were as follows: Figure 2 As shown: Figure 2 The left side shows a wild-type mouse with a neatly arranged and rounded basement membrane and podocytes with intact morphology; the right side shows an AS mouse with an uneven basement membrane that is curled and entangled, and the attached podocytes have obvious abnormal morphology.

[0057] One kidney was taken from 14-week-old AS mice and 14-week-old wild-type control mice, respectively. After fixation overnight with 4% paraformaldehyde, the sections were embedded in paraffin blocks and sectioned. The sections were then sequentially immersed in xylene for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min, followed by rinsing with distilled water. The sections were then immersed in Masson A staining solution overnight, rinsed, and then sequentially immersed in a 1:1 mixture of Masson B and Masson C staining solutions for 1 min, rinsed with running water, and then differentiated for a few seconds with differentiation solution. After rinsing, the sections were immersed in Masson D staining solution for 6 min, rinsed with running water, then stained with Masson E staining solution for 1 min, slightly drained, and directly stained with Masson F staining solution for 10 s. The sections were then rinsed with 1% acetic acid for differentiation, dehydrated with anhydrous ethanol (I / II / III), cleared with xylene for 5 min, mounted with neutral resin, and examined under a microscope for pathological changes. The test results are as follows: Figure 3 As shown: Figure 3 The left side shows normal kidney tissue from wild-type mice, and the right side shows kidney tissue from AS mice. The arrows indicate the areas circled in dashed lines where kidney structure has been damaged and renal parenchyma has become abnormal.

[0058] The above experiments can verify that the performance of AS mice can well match the symptoms of clinical AS disease, and is typical and representative, which can be used for subsequent experimental testing.

[0059] Example 2

[0060] The levels of HA and HAS2 expression in the kidney tissue of COL4A5 knockout mice were significantly increased.

[0061] Kidney tissues from AS mice and wild-type control mice obtained in Example 1 were collected. One kidney from each AS mouse and wild-type control mouse was taken. After fixation overnight with 4% paraformaldehyde, the tissues were embedded in paraffin blocks and sectioned. Then, the tissues were soaked in xylene, hydrated in a gradient of 100%, 75%, 50%, and 20% ethanol, soaked in distilled water, and then immersed in sodium citrate antigen retrieval solution. The antigen was retrieval was performed by microwave heating for 10 min. Peroxidase inactivation was performed with 3% hydrogen peroxide. The tissues were washed three times with PBS and then blocked with 5% BSA-PBS solution at 37°C.

[0062] Fluorescent staining 1: The tissue sections were blocked with BSA using HAS2 antibody (Santa Cruz, sc-514737) and incubated overnight at 4°C. They were then incubated again with a fluorescent secondary antibody recognizing mouse IgG for 2 hours at room temperature, counterstained with DAPI, and subsequently observed under a microscope. The results are as follows: Figure 4 As shown:

[0063] Figure 4 In this text, HC and AS represent healthy control mice (HC) and X-linked Alport syndrome mice (AS), respectively. DAPI staining (blue) is used to label cell nuclei, showing their location and distribution. HAS2 staining (green) is used to label HAS2 (hyaluronic acid synthase 2), an enzyme involved in extracellular matrix synthesis. SNA staining (red) is used to label SNA (a glycosylation marker), typically used to detect specific glycosylation patterns, and here it is used to help identify glomerular and tubular tissue regions. Merge images combine the three staining methods to more intuitively observe the relationship between different markers. The white dashed circle indicates the glomerular region. The left side shows normal kidney tissue from wild-type mice, with virtually no HAS2 expression. The right side shows kidney tissue from AS mice, where HAS2 is significantly highly expressed in both the tubules (red arrows) and glomeruli (yellow arrows). This indicates that the HAS2 level in the kidney tissue of AS mice is significantly higher than that in the wild-type control group. These results show that tissue fluorescence staining reveals high expression of HAS2 in the kidneys of AS mice. This indicates that the HAS2 expression level in the kidney tissue of AS mice is significantly higher than that in the control group, both in the glomeruli and tubules. In other words, the upregulation of HAS2 has potential pathological significance for renal parenchymal lesions in AS mice.

[0064] Fluorescent staining 2: The relative distribution and quantification of HA in tissues were detected using HA-binding protein HABP (biotin-labeled) as a probe. The mixture was incubated overnight at 4°C, followed by a second incubation with a biotin-recognizing fluorescent secondary antibody at room temperature for 2 hours. DAPI counterstaining was then performed, and the results were observed under a microscope. Figure 5 As shown: HABP staining (yellow) is used to mark tissue HA; DAPI (blue) and SNA (red) staining mark the cell nucleus and glycosylation patterns, respectively. Figure 5 The HA level in the kidney tissue of AS mice was significantly higher than that in the wild-type control group, and was similar to that in the wild-type control group. Figure 4 The upregulation of HAS2 expression was consistent in the patients. These differences reflect pathological changes in the renal tissue of AS patients, such as increased extracellular matrix synthesis, cell damage, and fibrosis. These changes are associated with renal interstitial fibrosis and renal function impairment, further supporting the pathological characteristics of renal tissue in AS patients.

[0065] Tissue from the other kidney was extracted using Nucleozol (MN, 740404.2). After RNA quantification, 1 ng of RNA was used for first-strand reverse transcription, which included gDNA clearance and reverse transcription (Aikerui AG11705), to obtain first-strand synthesized cDNA. The expression levels of HA synthases, specifically the three genes HAS1 / HAS2 / HAS3, were quantitatively detected using qPCR based on the cDNA products (Aikerui AG11701). The results were... Figure 6 As shown: Figure 6 In the graph, HC represents healthy wild-type control mice, AS represents AS mice, and the horizontal axis represents the gene names being tested (HAS1, HAS2, HAS2, and COL4A5). The vertical axis (Fold Regulations) represents the fold change in gene expression relative to the control group; that is, the values ​​on the vertical axis represent the relative expression levels compared to the control group. Figure 6 The results showed that the expression level of HAS2 was significantly increased when the RNA expression level of HAS2 was compared between samples by relative quantitative analysis. This indicates that the expression level of HAS2 in the kidney tissue of AS mice was significantly increased compared with that of wild-type control mice. The expression level of HAS1 also increased, but not as much as that of HAS2. In addition, the expression level of HAS3 did not change significantly, indicating that the synthesis process of HA, mainly by HAS2 synthase, was enhanced, which promoted the accumulation of HA in the kidney tissue.

[0066] Example 3

[0067] Knockdown of COL4A5 (Genbank sequence accession: NM_000495.5) in human kidney-derived HEK293 cells mimics the pathogenesis of AS, and is then analyzed using lipofectamine.TM RNAiMAX (Thermo, 13778075) liposome transfection of siRNA was used to inhibit the expression of specific genes. The siRNA contained two interfering strands. The nucleotide sequence of the first interfering strand's sense strand is shown in SEQ ID NO.1: GGGUCUCAAUGGAAUGAAAGG; its antisense strand's nucleotide sequence is shown in SEQ ID NO.2: UUUCAUUCCAUUGAGACCCGG. The nucleotide sequence of the second interfering strand's sense strand is shown in SEQ ID NO.3: GCAGAUCAGUGAACAGAAA; its antisense strand's nucleotide sequence is shown in SEQ ID NO.4: UUUCUGUUCACUGAUCUGC. Knockdown of the COL4A5 gene expression in HEK-293 human kidney cells simulated the direct result of functional loss due to COL4A5 mutation. The test results are as follows: Figure 7 As shown: Figure 7 In the graph, NC, si COL4A5#1, and si COL4A5#2 represent random sequence knockdown control cells and HEK-293 cells #1 and #2 obtained by interference with two interfering sequences targeting the knockdown of the COL4A5 gene, respectively. The horizontal axis represents the corresponding genes being tested, COL4A5, HAS1, HAS2, and HAS3. The vertical axis (Fold Regulations) represents the fold change in gene expression relative to the control group. In other words, the values ​​on the vertical axis represent the relative expression level relative to the control group. The RNA level of HAS2 was significantly increased, while HAS1 and HAS3 showed no significant change.

[0068] at the same time Figure 8 To further investigate the knockdown of COL4A5 gene expression in HEK-293 human kidney cells to simulate the functional loss caused by COL4A5 mutation, Western blotting (WB) was used to analyze the protein levels of the knocked-down COL4A5 gene and our target gene HAS2. Figure 8 Includes two sub-graphs, Figure 8 In the diagram, A stands for COL4A5, HAS2, and GAPDH (internal reference gene), representing the proteins corresponding to the three genes being tested. NC, siCOL4A5#1, and siCOL4A5#2 represent random sequence knockdown control cells and HEK-293 cells #1 and #2 obtained by interfering with two interference sequences targeting and knocking down the COL4A5 gene, respectively. Figure 8 The results from the study show that knocking down COL4A5 resulted in a decrease in COL4A5 protein levels and an increase in HAS2 protein levels in HEK-293 cells.

[0069] Figure 8 In Figure A, the x-axis (B) represents the proteins being tested (COL4A5 and HAS2), and the y-axis (Target / Ref) represents the ratio of the gray-scale quantitative values ​​of the corresponding proteins COL4A5 and HAS2 to the internal reference protein GAPDH, indicating the relative expression levels of the corresponding proteins in different sample groups. Figure 8 B in the equation shows that knocking down COL4A5 significantly decreased COL4A5 protein levels and increased HAS2 protein levels in HEK-293 cells. Figure 8 A and B together indicate that successful knockdown of COL4A5 leads to a decrease in the protein level of HAS2 in HEK-293 cells.

[0070] In summary, Western blotting showed that knocking down COL4A5 in HEK293 cells increased HAS2 protein levels, and protein level detection also confirmed the increase in HAS2. This indicates that COL4A5 deficiency in in vitro cells can directly induce HAS2 overexpression (but there was no significant difference in the expression of HAS1 and HAS3), suggesting a direct and significant causal relationship between COL4A5 deficiency and increased HAS2 expression. This further suggests the key role of HAS2 in the pathogenesis of COL4A5 deficiency and that it could serve as a potential therapeutic target.

[0071] Example 4

[0072] Administration of 4-MU suspension via gavage significantly improved the disease manifestations in AS mice.

[0073] It should be noted that 4-MU is poorly soluble in water and is not suitable for intraperitoneal or intravenous administration; therefore, we preferred to prepare an 8 mg / mL aqueous solution for gavage administration, starting from 15 weeks of age in AS mice, at a dose of 400 mg / kg. The decrease in HAS2 / HA ratio, renal pathological changes, renal function reflected by urinary protein, and mouse survival were detected and observed by comparing the treatment and untreatment groups of AS mice. The results are shown in Examples I-IV. Figures 9-12 :

[0074] In summary, 4-MU was found to significantly inhibit the progression of nephrotic parenchymal disease in AS mice and prolong the overall survival time of AS mice.

[0075] Example 1: Inhibition of HAS2 synthesis of HA by 4-MU

[0076] After 4-MU treatment, 26-week-old AS mice treated with 4-MU (4MU) and those not treated with 4-MU (non-4-MU) were euthanized under carbon dioxide anesthesia and myelination. Kidney tissue was harvested from both sides. Immunofluorescence staining was performed on the tissue sections. HAS2 antibody (Santa Cruz, sc-514737) was used to block BSA in the tissue sections, followed by overnight incubation at 4°C. Then, the sections were re-incubated with HRP secondary antibody recognizing mouse IgG at room temperature for 2 hours. FITC-TSA was then used for tyrosine signal amplification. The relative distribution and quantification of HA in the tissues were detected using HA-binding protein HABP (biotin-labeled) as a probe. The sections were incubated overnight at 4°C, followed by re-incubation with biotin-recognizing fluorescent secondary antibody at room temperature for 2 hours. DAPI counterstaining was then performed, followed by microscopic observation and scanning. The results are shown below. Figure 9 As shown: Figure 9 In the study, green fluorescence indicates HAS2, yellow fluorescence indicates HA, and blue fluorescence indicates DAPI staining of cell nuclei. It was observed that the levels of HAS2 and HA in the kidney tissue of AS mice treated with 4-MU were significantly lower than those in the non-treated group, both in the renal tubules and glomeruli, indicating that 4-MU can successfully inhibit HAS2-mediated HA synthesis in the kidneys of AS mice.

[0077] It is important to note that the accumulation of HA in renal tissue plays a crucial role in the pathology of diseases such as diabetic nephropathy, ischemia-reperfusion kidney injury, interstitial nephritis, kidney injury caused by urinary tract obstruction, and kidney trauma repair. Therefore, 4-MU theoretically has a therapeutic or alleviating effect on the abnormal accumulation of HA in the above-mentioned kidney diseases.

[0078] Example II. Treatment of COL4A5 knockout mice with 4-MU can block pathological changes in the renal parenchyma.

[0079] The tissue on the same side underwent the same fixation, embedding, sectioning, and hydration process. One slide was stained with hematoxylin and eosin (HE), and the procedure was repeated sequentially: hematoxylin staining → washing → eosin staining → washing → dehydration and mounting. The slide was then observed and photographed under a microscope. The results are as follows: Figure 10 As shown: Figure 10 In the table, "non-treated" refers to AS mice that have not been given 4-MU, "4-MU" refers to AS mice that have been given 4-MU, H&E refers to hematoxylin-eosin pathological staining, and Masson refers to Masson staining to indicate collagen fibers. Figure 10 Abnormalities in the kidney tissue of AS mice treated with 4-MU were observed, including the integrity of the glomerular and tubular structures and the degree of interstitial cell proliferation, which were significantly better than those in AS mice that were not treated with 4-MU.

[0080] Masson's trichrome staining was then performed, following a sequence of steps: overnight potassium dichromate staining → washing → iron hematoxylin staining → washing → Ponceau S and acid fuchsin staining → washing → phosphomolybdic acid staining → washing → aniline blue staining → washing. After dehydration and mounting, microscopic observation revealed that the interstitial collagen content (blue staining) in the renal tissue of 4-MU-treated AS mice was significantly lower than that in untreated AS mice. Both of these findings indicate that the renal parenchymal destruction and interstitial hyperplasia in the 4-MU-treated AS mice were significantly alleviated and improved compared to the untreated group.

[0081] Example III. Treatment of COL4A5 knockout mice with 4-MU significantly reduced proteinuria.

[0082] Urine was collected from 16-week-old and 28-week-old AS mice at fixed times. Urine was stimulated by gently tapping the abdominal area around the bladder. The urine was then collected, and changes in urinary protein content were detected using a mouse albumin ELISA kit (Abcam, ab207620). The results are shown below. Figure 11 As shown: Non-treated AS mice were not given 4-MU, and 4-MU mice were given 4-MU. It was found that at 16 weeks of age, 4-MU (administered for 7 days) showed a tendency to inhibit urinary protein levels in AS mice; while at 28 weeks of age, 4-MU was found to significantly reduce urinary protein levels in AS mice, suggesting that maintenance administration of 4-MU has a protective effect on renal function.

[0083] Example IV. Treatment of COL4A5 knockout mice with 4-MU can prolong the survival time of AS mice.

[0084] The survival of mice in the 4-MU treatment group and the untreated group was statistically analyzed. Survival curves were plotted, and the results were statistically analyzed using the Kaplan-Meier method. Figure 12 As shown: Figure 12 In the middle section, "Non-treated" refers to AS mice that have not been given 4-MU, and "4-MU" refers to AS mice that have been given 4-MU. Figure 12 It can be seen that the survival time of the 4-MU-treated group was significantly longer than that of the non-treated group, and there was a statistically significant difference between the two groups.

[0085] The above are merely preferred embodiments of the present invention. The scope of protection of the present invention is not limited to the above-described embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention, regardless of differences in biological species, materials used, injection time and frequency, operational details, etc. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should be considered within the scope of protection of the present invention.

Claims

The use of 1,4-methylumbelliferone in the preparation of formulations for the treatment or prevention of Alport syndrome.

Images