Engineered probiotic with a surface-modified protective shell, methods of making and uses thereof
By modifying the surface of probiotics with glycyrrhizic acid, pectin protective shell, and metal ion cross-linking, engineered probiotics were prepared, solving the problems of poor treatment effect of IBD and difficulty in maintaining the activity of probiotics in the gastrointestinal environment. They achieved targeted colonization of the intestine and immune regulation, significantly improving enteritis symptoms and intestinal flora imbalance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-08
- Publication Date
- 2026-04-10
AI Technical Summary
Current treatments for IBD rely on anti-inflammatory drugs and immunosuppressants, which are not very effective and may lead to serious complications with long-term use. Systemic administration of PD-L1 drugs carries immunosuppressive effects and infection risks, and probiotics are difficult to maintain activity in the gastrointestinal environment.
Engineered probiotics are encapsulated in a protective shell formed by glycyrrhizic acid and pectin, and then cross-linked with metal ions to prepare engineered probiotics with a surface-modified protective shell. PD-L1 is used for immune regulation to enhance the retention time in the intestine and the therapeutic effect.
Engineered probiotics significantly improve enteritis symptoms, restore the intestinal mucosal barrier, regulate gut microbiota, reduce Th17 and Th1 cells, and improve the bioavailability of PD-L1 by inhibiting neutrophil activity, promoting macrophage polarization, reducing the secretion of pro-inflammatory cytokines, targeting and colonizing the colon.
Smart Images

Figure CN119970669B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biomedical engineering, and particularly relates to an engineered probiotic with a surface modification protective shell, a preparation method and application thereof. BACKGROUND
[0002] Inflammatory Bowel Disease (IBD) is characterized by repeated and persistent intestinal inflammation, which seriously affects the quality of life of patients, and the disease can further develop into intestinal obstruction, intestinal perforation or colorectal cancer and other diseases. At present, the treatment of IBD mainly relies on the use of anti-inflammatory drugs and immunosuppressive agents to reduce inflammation, but these therapies can only partially alleviate symptoms, and often the treatment effect is not ideal. In addition, long-term use of the above drugs can also cause serious complications, such as opportunistic infections, gastrointestinal dysfunction, liver toxicity or kidney toxicity. Therefore, there is an urgent need for more effective and safer IBD treatment options.
[0003] Immune, genetic, environmental, and microorganisms are generally considered to be the four major factors that induce the onset of IBD. Among them, at the immune level, the chronic inflammatory response of IBD is directly related to the imbalance and excessive activation of the immune system. The imbalance of T cell populations, especially the excessive activation of effector subsets (such as Th17 and cytotoxic T cells), combined with the damage of regulatory T cells (Treg), leads to uncontrolled inflammation. Dysregulated T cell activation not only damages the intestinal mucosa, but also recruits additional immune cells to the inflammation site, exacerbating damage to the body's tissues. T cell activation is often regulated by immune checkpoint pathways, such as the interaction between programmed death-1 (PD-1) and its ligand PD-L1 on T lymphocytes can transmit inhibitory signals, thereby resisting T cell activation. This interaction represents an important homeostatic mechanism for relieving inflammation and maintaining autoimmune tolerance. Recent studies have shown that PD-L1 knockout can increase the incidence and mortality of colitis models, while administration of PD-L1 can improve the colonic inflammation symptoms of animals, which indicates the potential of PD-L1 as a treatment for IBD. However, PD-L1 has a strong immunosuppressive effect, and its systemic administration is associated with an increased risk of infection and cancer. In addition, it also faces challenges such as high cost, short half-life, and the need for multiple doses to be effective in treatment. Therefore, it is necessary to develop a more advanced strategy to improve the bioavailability of PD-L1 locally in IBD lesions and fully exert its therapeutic effect in IBD.
[0004] The gut microbiota is a vast community of microorganisms that plays a crucial role in maintaining gut homeostasis and host health. Studies have shown that gut microbiota imbalance is also a significant cause of IBD. In an inflamed gut, the proliferation of harmful microorganisms and the reduction of beneficial bacteria lead to an increase in harmful toxins, disrupting the host's metabolic processes. Therapies that can reprogram the gut microbiota can help alleviate IBD symptoms. Probiotics, due to their ability to reprogram the gut microbiome, have been used as an alternative to traditional IBD treatments, and their application in this area has received considerable attention. However, maintaining the activity of probiotics in the harsh gastrointestinal environment—due to stomach acid, various digestive enzymes, and a destructive pathological microenvironment—remains a significant challenge. Summary of the Invention
[0005] This invention aims to at least solve one of the technical problems existing in related technologies. Therefore, the first objective of this invention is to provide an engineered probiotic with a surface-modified protective shell; the second objective is to provide a method for preparing the engineered probiotic; and the third objective is to provide an application of the engineered probiotic.
[0006] To achieve the first objective, the technical solution adopted by this invention is as follows:
[0007] An engineered probiotic with a surface-modified protective shell includes a protective shell and engineered probiotics, wherein the protective shell encapsulates the engineered probiotics;
[0008] The protective shell is composed of glycyrrhizic acid and pectin, and the mass ratio of glycyrrhizic acid to pectin is 3:10 to 10:3.
[0009] The engineered probiotics are surface-modified by immune regulatory factors, and the surface of the surface-modified engineered probiotics is loaded with metal ions.
[0010] The complex gastrointestinal environment often leads to the inactivation of probiotics and limits their colonization, and the present application encapsulates the engineered probiotics in a protective shell formed by pectin and glycyrrhizic acid to protect them from the destruction of the complex environment of the gastrointestinal tract and prolong their residence time in the intestinal tract. Glycyrrhizic acid is a natural anti-inflammatory triterpenoid saponin that can directly bind to high-mobility group protein 1 (HMG1) in high-mobility group protein B1 (HMGB1), thereby inhibiting its function as a damage-associated molecular pattern (DAMP) to activate inflammation; pectin is a polysaccharide that can be degraded by colonic enzymes while remaining resistant to enzymes in the upper digestive tract, allowing the engineered probiotics to be protected from the interference of pepsin and is an ideal excipient for oral drug delivery to the colon; the present application forms a protective shell with good mechanical properties by in-situ gelation on the surface of the engineered probiotics, using metal ions to form cross-linking sites on the surface of the engineered probiotics, and then promoting the cross-linking of glycyrrhizic acid and pectin.
[0011] Further, the mass ratio of the glycyrrhizic acid to the pectin is 1:1.
[0012] Further, the metal ion is calcium ion, and 1×10 9 The engineered probiotics with 0.025mmol-0.5mmol of calcium ion per CFU.
[0013] Further, the engineered probiotics are Escherichia coli Nissle 1917.
[0014] Among them, the EcN strain represents Escherichia coli Nissle 1917.
[0015] Further, the engineered probiotics are a mutant of the EcN strain with the nlpl gene knocked out, and the nucleotide sequence of the nlpl gene is shown in SEQ ID NO. 1.
[0016] Among them, the ΔEcN strain represents a mutant of the EcN strain with the nlpl gene knocked out.
[0017] Further, the immune regulatory factor is selected from PD-L1.
[0018] To achieve the second object, the technical scheme adopted by the present application is:
[0019] A preparation method of engineered probiotics for preparing the engineered probiotics with a surface-modified protective shell as described in any one of the above, comprising the following steps:
[0020] S100, preparing the competence of the engineered probiotic bacteria by calcium chloride method;
[0021] S200, introducing the plasmid pET28a-T5-PD-L1 into the competence of the engineered probiotic bacteria by heat shock method, inducing the expression of PD-L1 in the competent engineered probiotic bacteria, and obtaining the engineered probiotic bacteria with PD-L1 surface modification;
[0022] S300, preparing the engineered probiotic bacteria suspension with PD-L1 surface modification in a buffer solution of metal salt with a concentration of 5*10 -1 8 9 CFU·mL -1 of the engineered probiotic bacteria with PD-L1 surface modification, stirring, centrifuging, and obtaining the engineered probiotic bacteria suspension with metal ion adsorption;
[0023] S400, adding glycyrrhizin and pectin to the buffer solution to prepare a mixed buffer solution containing glycyrrhizin and pectin;
[0024] S500, dispersing the mixed buffer solution in step S400 in the bacterial suspension obtained in step S300 to obtain the engineered probiotic bacteria suspension loaded with the first coating;
[0025] S600, after centrifuging the engineered probiotic bacteria suspension loaded with the first coating obtained in step S500, adding it to a buffer solution of metal salt with a concentration of 0.025-0.5mmol·mL -1
[0026] Further, the stirring in steps S300 and S600 is selected from vortex stirring.
[0027] To achieve the third object, the technical scheme adopted by the present application is:
[0028] An application of the engineered probiotic bacteria, the engineered probiotic bacteria with surface modification protective shell as described in any one of the above, is used for intestinal inflammation drug preparation.
[0029] Further, the drug preparation further comprises at least one of a pharmaceutically acceptable adjuvant, excipient and carrier.
[0030] The above one or more technical solutions in the embodiments of the present application have at least one of the following technical effects:
[0031] The application provides an engineered probiotic with a surface modification protective shell, which comprises a protective shell and an engineered probiotic, and the protective shell is coated on the engineered probiotic; the engineered probiotic is surface modified by an immune regulation factor, and the surface of the engineered probiotic after surface modification is loaded with metal ions. The protective shell is crosslinked on the surface of the engineered probiotic to form a protective layer under the guidance of the metal ions; the cell experiment results show that ΔEcN P @PG can inhibit the activity of neutrophils, repolarize proinflammatory macrophages, inhibit the secretion of proinflammatory cytokines, reduce the number of Th17, Th1 and Tfh cells, and up-regulate immunosuppressive Treg cells; the in vivo experiment results of mice show that ΔEcN P @PG can target and colonize the colon, can promote the repair of the intestinal mucosal surface of mice, and has a good treatment effect on intestinal inflammation mice. Therefore, the engineered probiotic with the surface modification protective shell is expected to be applied to the preparation of intestinal inflammation drug preparations.
[0032] The application provides a preparation method of the engineered probiotic, raw materials are easy to obtain, the operation process is simple, and the reaction conditions are controllable, so that the large-scale production is facilitated.
[0033] Additional aspects and advantages of the application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 is the PCR detection result of the ΔEcN strain and the EcN strain provided in embodiment 1 of the application and the bacterial vesicle protein content.
[0035] Figure 2 is a statistical diagram of the percentage of PD-1 retention in the vesicles produced by different strains provided in embodiment 1 of the application. P is an immunoblotting diagram of the protein PD-1 expressed by the ΔEcN strain.
[0036] Figure 3 is a statistical diagram of the percentage of PD-1 retention in the vesicles produced by different strains provided in embodiment 1 of the application.
[0037] Figure 4 is a scanning electron microscope diagram of the ΔEcN strain before and after coating the protective shell provided in embodiment 2 of the application. P
[0038] Figure 5 is a statistical diagram of the survival number of different strains in the in vitro simulated gastric juice for 10 min and 20 min provided in embodiment 2 of the application.
[0039] Figure 6 is the macrophage regulation ability of different groups provided in embodiment 2 of the application.
[0040] Figure 7 is the treatment effect of different groups provided by embodiment 2 of the present application on inflammatory mice.
[0041] Figure 8 is the immunohistochemical graph of ZO-1 protein and Occludin protein in the colon sample of different groups provided by embodiment 2 of the present application.
[0042] Figure 9 is the statistical graph of inflammatory cytokines of different groups provided by embodiment 2 of the present application.
[0043] Figure 10 is the flow cytometry scatter plot of different groups provided by embodiment 2 of the present application.
[0044] Figure 11 is the statistical graph of MHC II + DCs, F4 / 80 macrophage markers, IFN-γ cytokines and IL-17A cytokine expression.
[0045] Figure 12 is the statistical graph of the influence of different groups provided by embodiment 2 of the present application on the intestinal flora abundance of inflammatory bowel disease mice.
[0046] Figure 13 is the principal component analysis (PCA) graph of intestinal flora of different groups provided by embodiment 2 of the present application.
[0047] Figure 14 is the statistical heat map of the influence of different groups provided by embodiment 2 of the present application on the intestinal flora abundance. DETAILED DESCRIPTION
[0048] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the present application will be described clearly and completely below in combination with the drawings in the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. The following embodiments are used to illustrate the present application, but cannot be used to limit the scope of the present application.
[0049] In the following embodiments, the experimental methods used are conventional methods, and the materials, reagents, etc. used are commercially available unless otherwise specified.
[0050] The nucleotide sequence of the nlpl gene (SEQ ID NO. 1) from 5' to 3' end is as follows:
[0051] ATGAAGCCTTTTTTGCGCTGGTGTTTCGTTGCGACAGCACTTACGCTTGCAGGATGCAGTAATACTTCCTGGCGTAAAAGTGAAGTCCTCGCGGTACCATTGCAACCGACTTTACAGCAGGAAGTGATTCTGGCACGTATGGAACAGATCCTTGCCAGTCGGGCTTTAACCGATGACGAACGCGCACAGCTTTTATATGAGCGCGGAGTGTTGTATGATAGTCTCGGTCTGAGGGCATTAGCGCGTAACGATTTTTCGCAAGCGCTGGCAATCCGACCGGATATGCCTGAAGTATTCAATTACTTAGGCATATATTTAACGCAGGCAGGCAATTTTGATGCTGCCTATGAAGCGTTTGATTCTGTACTTGAGCTTGATCCAACTTACAACTACGCGCACTTGAATCGCGGGATCGCATTATATTACGGCGGTCGTGACAAGTTAGCGCAAGATGATCTGCTGGCGTTTTATCAAGACGATCCCAATGATCCTTTCCGTAGTCTGTGGCTTTATCTCGCCGAGCAGAAGCTCGATGAGAAGCAGGCTAAAGAAGTGTTGAAACAGCACTTCGAAAAATCGGATAAGGAACAGTGGGGATGGAACATTGTCGAGTTCTACCTGGGCAACATTAGCGAACAAACGTTAATGGAAAGGCTCAAGGCGGACGCAACGGATAACACCTCGCTCGCTGAGCATCTCAGTGAAACCAACTTCTATTTAGGTAAGTACTACCTAAGTCTGGGGGATTTGGACAGCGCCACGGCACTGTTCAAACTGGCGGTTGCCAACAACGTTCATAACTTTGTTGAGCACCGATACGCATTGTTGGAATTATCGCTCCTGGGCCAGGACCAAGATGACCTGGCAGAATCGGACCAGCAATAG.
[0052] The nucleotide sequence of the upstream homology arm of EcN-nlp l-HA1 (SEQ ID NO. 2) from 5' to 3' end is as follows:
[0053] TGCTCTGACCGAAGAAACCGGCACCACCATCGAAATTGAAGATGACGGTACTGTGAAGATTGCAGCGACCGACGGCGAGAAAGCGAAACACGCGATTCGTCGTATCGAAGAGATCACTGCAGAAATCGAAGTGGGCCGCGTCTACAATGGTAAAGTGACCCGTATCGTTGATTTTGGCGCATTTGTTGCCATTGGTGGCGGTAAAGAAGGTCTGGTCCACATCTCTCAAATCGCTGATAAACGCGTTGAGAAAGTGACCGATTACCTGCAGATGGGTCAGGAAGTACCGGTGAAAGTTCTGGAAGTTGATCGCCAGGGCCGTATCCGTCTGAGCATTAAAGAAGCGACTGAGCAATCTCAACCTGCTGCAGCACCGGAAGCTCCGGCTGCTGAACAGGGCGAGTAAGGTTGCCATTTGCCCTCCGCTGCGGCGGGGGGCTTTTAACCGGGCAGGACGCCTTGTTAGCAACCGGGAACAGGACGTTCATTCAACCGTGGTCTTCGGGAGTGGGAA.
[0054] The nucleotide sequence of the downstream homology arm of EcN-nlp 1 -HA2 (SEQ ID NO. 3) from the 5' to 3' end is as follows:
[0055] TTTCAATGAAAATTGCTGATCAATTTCATGATGAGTTATGTAGACTGGCCGCCATTAATTTTGAGGCACACGTACTACATGGCTGAATTCGAAACCACTTTTGCAGATCTGGGCCTGAAGGCTCCTATCCTTGAAGCCCTTAACGATCTGGGTTACGAAAAACCATCTCCAATTCAGGCAGAGTGTATTCCACATCTGCTGAATGGCCGCGACGTTCTGGGTATGGCCCAGACGGGGAGCGGAAAAACTGCAGCATTCTCTCTACCTCTGCTGCAGAATCTTGATCCTGAGCTGAAAGCACCACAGATTCTGGTGCTGGCACCGACCCGCGAACTGGCGGTACAGGTTGCTGAAGCAATGACGGATTTCTCTAAACACATGCGCGGCGTAAACGTGGTTGCCCTGTACGGCGGCCAACGTTATGACGTGCAATTACGCGCCCTGCGTCAGGGGCCGCAGATCGTTGTCGGTACTCCGGGCCGTCTGCTGGACCACCTGAAACGTGG.
[0056] Example 1 Preparation of surface-modified engineered probiotic bacteria.
[0057] Reference is made to the preparation methods disclosed in the following two references:
[0058] I. Caldwell BJ, Bell CE. Structure and mechanism of the Red recombination system of bacteriophage lambda. Prog Biophys Mol Biol. 2019;147: 33-46.
[0059] II. Thomas SC, Madaan T, Kamble NS, Siddiqui NA, Pauletti GM, Kotagiri N. Engineered Bacteria Enhance Immunotherapy and Targeted Therapy through Stromal Remodeling of Tumors. Adv Healthc Mater. 2022;11(2).
[0060] Targeted knockout of nlpl gene in the genome of Escherichia coli Nissle 1917 (EcN) by λ-Red recombinase-mediated genetic engineering technology to obtain ΔEcN strain, including the following steps:
[0061] I. Constructing nlpl gene homologous recombination fragment, the process is as follows: taking EcN-nlpl-HA1 as the upstream homologous arm primer, taking EcN-nlpl-HA2 as the downstream homologous arm primer, taking plasmid pKD13 as the template, using EcN-nlpl-HA1 and EcN-nlpl-HA2 primers to amplify the homologous recombination fragment EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 with short homologous arms of nlpl gene at both ends, and then fusing it with kanamycin cassette fragment by overlap PCR to form EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 long homologous recombination fragment.
[0062] II. Preparing competent cells, the process is as follows: transforming the pKD46 plasmid encoding the Red recombination system into EcN strain, screening the transformants and naming them as EcN / pKD46. After culturing the EcN / pKD46 strain at 30°C overnight, inoculating it into LB medium containing kanamycin at a ratio of 1%, and adding L-arabinose with a final concentration of 50 mM, stopping the culture when OD600 = 1.0 to express a large amount of homologous recombination enzyme and improve the knockout efficiency, and using the electric shock method to prepare EcN / pKD46 competent bacteria.
[0063] III. Introducing the EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 long homologous recombination fragment into the EcN / pKD46 competent cells by electroporation method, screening the transformants on the plate containing kanamycin, and using primer pairs for PCR identification to screen the nlpl gene EcN competent bacteria replaced by kanamycin cassette.
[0064] IV. Electroporating the pCP20 plasmid expressing FLP recombinase into the screened EcN competent bacteria, and performing site-specific recombination under the action of FLP recombinase to delete the kanamycin cassette, eliminating the temperature-sensitive pCP20 plasmid by high-temperature culture at 42°C, and verifying the resistance plate to finally obtain the EcN strain with nlpl gene knockout, i.e. ΔEcN strain.
[0065] The contents of proteins in ΔEcN strain and EcN strain and outer membrane vesicles (OMV) were detected by PCR method and BCA method, and the results are shown in Table 1. Figure 1
[0066] Among them, Figure 1 In the figure, A is the PCR detection result of the ΔEcN strain and the EcN strain, and B is the statistical result of the protein content in the outer membrane vesicle of the ΔEcN strain and the EcN strain.
[0067] V. The pET28a-T5-PD-L1 was introduced into the ΔEcN strain by using the heat shock method, PD-L1 expression was induced by adding isopropyl β-d-1-thiogalactopyranoside (IPTG, 0.1 mM) in the culture medium and incubating at 25°C for 12 h, and the ΔEcN strain surface-modified by PD-L1 was obtained, i.e. ΔEcN P strains, the Western blotting is shown as follows Figure 2 The results show that the ΔEcN P strain can effectively express the target protein PD-1, Figure 2 GAPDH is glyceraldehyde-3-phosphate dehydrogenase, which is used as an internal reference protein.
[0068] The control strain, the ΔEcN, the OMV (the vesicle secreted by the ΔEcN), the ΔEcN P and the OMV P (the vesicle secreted by the ΔEcN P ) were respectively incubated with PD-1, and the remaining concentration of PD-1 was detected by using the enzyme-linked immunosorbent assay (ELISA) to evaluate the PD-1 binding activity thereof. The results are shown as follows Figure 3 The ΔEcN P and the OMV P respectively account for 46.48% and 86.49% of PD-1, which are significantly better than the ΔEcN (5.78%) and the OMVs (2.91%), the results show that the ΔEcN overexpressing PD-L1 is successfully prepared and has a strong PD-1 binding capacity, and in the figure, the control strain is the EcN strain in which the nlpl gene is knocked out but no expression plasmid is introduced.
[0069] Example 2 Preparation of the ΔEcN P strain with a protective shell.
[0070] 1×10 9 CFU of the ΔEcN P strain was dispersed in 1 ml of PBS buffer (containing 55.5 mg of calcium chloride) to obtain the ΔEcN P strain suspension, vortex stirring was performed for 2 min to allow the calcium ions to interact with the strain monomers, and centrifugation was performed to obtain the calcium ion-adsorbed ΔEcN P strain suspension, i.e. the ΔEcN P / Ca 2+ strain suspension.
[0071] Glycyrrhizin (25 mg) and pectin (25 mg) were dissolved in 5 ml of PBS solution to obtain a PBS mixed solution of glycyrrhizin and pectin, and the mixed solution was dispersed in ΔEcN P / Ca 2+ The strain suspension was incubated for 1 h to promote cross-linking of the first coating layer, and then the strain suspension was centrifuged at 4000 g for 5 min to obtain a concentrated bacterial solution, 1 ml of PBS buffer (containing 55.5 mg of calcium chloride) was added to the concentrated bacterial solution, vortexed for 2 min, and then co-incubated with 5 ml of a PBS mixed solution of glycyrrhizin (25 mg) and pectin (25 mg) to perform the second layer coating to obtain ΔEcN P strains, i.e. ΔEcN P @PG, the protective shell coated ΔEcN P The scanning electron micrographs of the strains before and after coating are shown in Figure 4 , which shows that the protective shell can effectively coat the ΔEcN P strains.
[0072] 1 x 10 8 CFU of ΔEcN P strains and ΔEcN P @PG strains were co-incubated with simulated gastric juice for 10 min and 20 min, respectively, and the number of live bacteria was determined by dilution plating, and the results are shown in Figure 5 , which shows that the glycyrrhizin and pectin protective shell has good protective ability for ΔEcN P strains.
[0073] The supernatant of the macrophages co-incubated with the control strain, PBS buffer, ΔEcN, ΔEcN@PG and ΔEcN P @PG treated HT-29 cells was co-incubated, and the expression of the representative marker of M1 phenotype (iNOS) and the biomarker of M2 phenotype (CD206) in each group was analyzed by flow cytometry, wherein the control is the EcN strain knocked out of the nlpl gene but not transfected with the expression plasmid;
[0074] The results are shown in Figure 6 , which shows that the expression of iNOS in the macrophages of ΔEcN@PG and ΔEcN P @PG coated with the protective shell is significantly reduced, while the expression of CD206 is increased, indicating that the macrophages are polarized from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype;
[0075] Among them, Figure 6 A is the expression of iNOS in each group by flow cytometry, B is the statistical diagram of the iNOS macrophage marker in each group, C is the expression of CD206 in each group by flow cytometry, and D is the statistical diagram of the CD206 macrophage marker in each group.
[0076] ΔEcN P The treatment effect of ΔEcN@PG on inflammatory bowel disease mice was observed, and the process was as follows: the mice were divided into a healthy group, a PBS group, a ΔEcN strain group, a ΔEcN@PG group, and a ΔEcN P ΔEcN@PG protection shell coating method is the same as ΔEcN P ΔEcN@PG protection shell coating method is the same as ΔEcN
[0077] The colonitis of mice was constructed by giving the mice 2.5% dextran sulfate sodium salt (DSS) in drinking water;
[0078] Among them, each group was orally given once every two days until the 14th day of euthanasia;
[0079] As Figure 7 shown, compared with other treatment groups, the mice in the ΔEcN P @PG treatment group had the least weight loss, the lowest disease activity index (DAI) score index, and the DAI score of the mice at the end of the experiment decreased from 10.2 at the beginning of the experiment to 2.2;
[0080] Among them, the effect of the ΔEcN P @PG treatment group on the weight of the mice was statistically analyzed with the effect of the PBS group, the ΔEcN strain group, and the ΔEcN@PG group on the weight of the mice, and the results were P<0.0001, P<0.0001, P<0.0001, and P=0.0475, respectively;
[0081] The effect of the ΔEcN P @PG treatment group on the disease treatment index of the mice was statistically analyzed with the effect of the PBS group, the ΔEcN strain group, and the ΔEcN@PG group on the disease treatment index of the mice, and the results were P<0.0001, P<0.0001, P<0.0001, and P=0.0020, respectively;
[0082] The colon length of the ΔEcN P @PG group was significantly recovered to about 5.68 cm, while the length of the DSS-induced control group was shortened to about 3.40 cm, which indicated that the ΔEcN P @PG had obvious effect in treating colonitis;
[0083] Among them, Figure 7 A is the relationship curve between the weight percentage of the mice and time, B is the relationship curve between the disease treatment index of the mice and time, C is the colon picture of the mice in each group after the 14-day treatment cycle, and D is the statistical graph of the colon length of the mice in each group.
[0084] As shown in Figure 8 compared with the healthy group, the blank control PBS group significantly inhibited the expression of colon occludin and ZO-1, indicating that the mucosal barrier was severely damaged, ΔEcN P @PG strain treatment group, significantly restored the expression level of ZO-1 and occludin in the colon of mice, almost reaching the level observed in healthy mice, indicating that ΔEcN P @PG can promote the reconstruction of the mucosal barrier.
[0085] As shown in Figure 9 compared with the healthy group, the blank control PBS group significantly increased the levels of three key inflammatory cytokines (including IL-1β, IL-6 and TNF-α) in IBD, and ΔEcN P @PG group significantly down-regulated pro-inflammatory cytokines and significantly up-regulated anti-inflammatory cytokines (IL-10);
[0086] Among them, Figure 9 A is a statistical diagram of IL-1β expression in different groups, B is a statistical diagram of IL-6 expression in different groups, C is a statistical diagram of TNF-α expression in different groups, and D is a statistical diagram of IL-10 expression in different groups.
[0087] As shown in Figure 10 and Figure 11 compared with colitis mice without treatment and colitis mice treated with ΔEcN, colitis mice treated with ΔEcN P @PG or ΔEcN P @PG had a reduced frequency of dendritic cells (DC) and macrophages, and among them, ΔEcN P @PG group decreased most significantly, which suggested that ΔEcN + @PG can inhibit the recruitment of DC and macrophages to the colon during colitis; the proportion of Th1 cells producing IFN-γ and Th17 cells producing IL-17A in the colon tissue of mice in different treatment groups. Th1 and Th17 cells differentiated from activated CD4 P T cells are generally up-regulated in IBD and are associated with increased disease activity in IBD patients; the cytokines they secrete (including IFN-γ and IL-17A) play a key role in recruiting immune cells to the intestine, significantly exacerbating inflammation, tissue damage and intestinal barrier destruction in colitis; compared with the PBS group, ΔEcN + IFN-γ + Th1 and CD4 + IL-17A +The percentage of Th17 cells was significantly reduced. Notably, ΔEcN P @PG exhibited a stronger ability to suppress these T cell subsets, highlighting the key role of PD-L1 expression in mediating this suppression;
[0088] wherein, Figure 10 A is the flow cytometry scatter plot of the relationship between CD11c marker and MHC II protein, B is the flow cytometry scatter plot of the relationship between CD11b marker and macrophage marker F4 / 80, C is the flow cytometry scatter plot of the relationship between CD4 marker and IFN-γ cytokine, and C is the flow cytometry scatter plot of the relationship between CD4 marker and IL-17A cytokine;
[0089] Figure 11 wherein, A is the statistical chart of the expression of MHC II + DCs in the intestinal tissues of mice in different groups, B is the statistical chart of the expression of F4 / 80 macrophage marker in the intestinal tissues of mice in different groups, C is the statistical chart of the expression of IFN-γ cytokine in the intestinal tissues of mice in different groups, and D is the statistical chart of the expression of IL-17A cytokine in the intestinal tissues of mice in different groups.
[0090] As Figure 12 , Figure 13 and Figure 14 shown, ΔEcN P @PG treatment group increased the relative abundance of beneficial bacteria, among which Muribaculaceae can regulate the inflammatory response of intestinal diseases, Odoribacter and Lachnospiraceae_NK4A136 can produce short-chain fatty acids, and Prevotellaceae_UCG-001 is beneficial to ulcerative colitis; in addition, compared with healthy mice, the abundance of Proteobacteria (a marker of colitis) in the intestinal tract of the blank control PBS group increased, and Proteobacteria is a marker of colitis, and ΔEcN P @PG group reduced the relative abundance of Bacteroides and IBD-related virulent pathogens Escherichia-Shigella; further analysis of the top 30 bacterial genera with the highest abundance showed that ΔEcN P @PG group effectively restored the relative abundance of some probiotic flora in IBD mice, close to the level of healthy controls;
[0091] wherein, Figure 12A is a statistical diagram of the influence of different groups on the relative abundance of Muribaculaceae bacteria, B is a statistical diagram of the influence of different groups on the relative abundance of Odoribacter bacteria, C is a statistical diagram of the influence of different groups on the relative abundance of Lachnospiraceae bacteria, D is a statistical diagram of the influence of different groups on the abundance of Prevotellaceae_UCG-001 bacteria, E is a statistical diagram of the influence of different groups on the abundance of Bacteroidaceae bacteria, F is a statistical diagram of the influence of different groups on the abundance of Escherichia-Shigella bacteria, and G is a statistical diagram of the influence of different groups on the abundance of Proteobacteria.
[0092] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. An engineered probiotic with a surface-modified protective shell, characterized in that, The protective shell and the engineered probiotic bacteria, wherein the protective shell comprises glycyrrhizic acid and pectin, and the mass ratio of the glycyrrhizic acid to the pectin is 3:10-10:
3. The engineered probiotic bacteria are surface-modified by an immune regulatory factor, and the surface-modified engineered probiotic bacteria are loaded with metal ions on the surface. The immune regulatory factor is selected from PD-L1. The engineered probiotic bacteria are mutants of Escherichia coli Nissle 1917 with nlpl gene knocked out, and the nucleotide sequence of the nlpl gene is shown in SEQ ID NO.
1. The metal ion is a calcium ion, 1 x 10 9 CFU of engineered probiotic bacteria load 0.025 mmol to 0.5 mmol of calcium ion; The method for preparing the engineered probiotic bacteria with the surface-modified protective shell comprises the following steps: S100, preparing competent cells of the engineered probiotic bacteria by a calcium chloride method; S200, introducing the plasmid pET28a-T5-PD-L1 into the competent cells of the engineered probiotic bacteria by a heat shock method, inducing expression of PD-L1 in the competent engineered probiotic bacteria, and obtaining the engineered probiotic bacteria surface-modified by PD-L1; S400, adding glycyrrhizic acid and pectin into a buffer solution to prepare a mixed buffer solution containing glycyrrhizic acid and pectin; S300, at a concentration of 0.025–1 mmol / mL -1 The concentration of metal ions was prepared in a buffer solution with a concentration of 5 × 10⁻⁶. 8 ~2×10 9 CFU·mL -1 The engineered probiotic suspension modified with PD-L1 surface was stirred and centrifuged to obtain an engineered probiotic suspension with metal ion adsorption. S500, dispersing the mixed buffer solution in step S400 into the bacterial suspension obtained in step S300 to obtain a suspension of the engineered probiotic bacteria loaded with a first coating layer; The mass ratio of the glycyrrhizic acid to the pectin is 1:
1. S600, the engineered probiotic bacteria with the first coating layer obtained in step S500 is centrifuged and then added to a solution with a concentration of 0.025-1 mmol·mL -1 The metal ions are stirred and incubated in a buffer solution to obtain the engineered probiotic bacteria with the surface modification protective shell.
2. The engineered probiotic with a surface-modified protective shell of claim 1, wherein, The method for preparing the engineered probiotic bacteria with the surface-modified protective shell as claimed in claim 1 or 2 comprises the following steps:
3. A method of preparing an engineered probiotic, characterized in that, S100, preparing competent cells of the engineered probiotic bacteria by a calcium chloride method; S200, introducing the plasmid pET28a-T5-PD-L1 into the competent cells of the engineered probiotic bacteria by a heat shock method, inducing expression of PD-L1 in the competent engineered probiotic bacteria, and obtaining the engineered probiotic bacteria surface-modified by PD-L1; S400, adding glycyrrhizic acid and pectin into a buffer solution to prepare a mixed buffer solution containing glycyrrhizic acid and pectin; S300, at a concentration of 0.025–1 mmol / mL -1 The concentration of metal ions was prepared in a buffer solution with a concentration of 5 × 10⁻⁶. 8 ~2×10 9 CFU·mL -1 The engineered probiotic suspension modified with PD-L1 surface was stirred and centrifuged to obtain an engineered probiotic suspension with metal ion adsorption. S500, dispersing the mixed buffer solution in step S400 into the bacterial suspension obtained in step S300 to obtain a suspension of the engineered probiotic bacteria loaded with a first coating layer; The stirring in step S300 and step S600 is selected from vortex stirring. S600, the engineered probiotic bacteria with the first coating layer obtained in step S500 is centrifuged and then added to a solution with a concentration of 0.025-1 mmol·mL -1 The metal ions are stirred and incubated in a buffer solution to obtain the engineered probiotic bacteria with the surface modification protective shell.
4. The method of producing an engineered probiotic of claim 3, wherein, The engineered probiotic bacteria with the surface-modified protective shell as claimed in claim 1 or 2 are used for preparing an enteritis drug preparation.
5. Use of an engineered probiotic, characterized in that, The drug preparation further comprises a pharmaceutically acceptable excipient.
6. Use of an engineered probiotic according to claim 5, wherein the engineered probiotic is a Lactobacillus plantarum.
Citation Information
Patent Citations
Polysaccharide embedded probiotics as well as preparation method and medicine thereof
CN116115652A
Biological material based on phenylboronic acid targeting tumor cells as well as construction method and application of biological material
CN118126916A