Antibacterial peptide modified bionic nanoparticle targeting delivery system as well as construction method and application thereof

Abstract

The invention discloses an antibacterial peptide modified bionic nanoparticle targeting delivery system as well as a construction method and application thereof. The antibacterial peptide modified bionic nanoparticle targeting delivery system comprises a recombinant antibacterial peptide LL-37, a macrophage membrane and an enzyme cascade reaction system, the recombinant antibacterial peptide LL-37 is expressed on the macrophage cell membrane to form a macrophage cell membrane modified by the recombinant antibacterial peptide LL-37; the enzyme cascade reaction system is wrapped by the macrophage membrane modified by the recombinant antibacterial peptide LL-37, so that the bionic nanoparticle targeted delivery system modified by the antibacterial peptide is formed; wherein a Toll-like receptor 2 and a Toll-like receptor 4 are highly expressed on the surface of a macrophage cell membrane; the enzyme cascade reaction system comprises a nano enzyme with catalase-like activity and a hydrogen peroxide-producing biological enzyme. The antibacterial peptide modified bionic nanoparticle targeting delivery system disclosed by the invention can be used for treating infectious bone defects such as periodontitis, peri-implantitis, infectious fracture, osteomyelitis and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biomaterials, and in particular to an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, a construction method thereof, and applications thereof. Background Art

[0002] Infected bone defects refer to the loss of bone tissue caused by infection. This lesion is commonly seen in open fractures, osteomyelitis, implant infection, periodontitis, and other conditions. Its treatment focuses not only on the repair of lost bone tissue, but also on infection control, resulting in long treatment cycles, multiple complications, and significant patient pain, making it a difficult and challenging clinical practice. Currently, the main treatment method for infected bone defects is thorough debridement supplemented by systemic and local antibiotics, which is divided into an infection control phase and a bone defect reconstruction phase. The control of local infection depends largely on the extent of debridement, but excessive debridement often causes additional bone defects, and for the treatment of periodontitis, instruments have difficulty reaching deep periodontal pockets, reducing the efficiency of debridement. Bacteria can also form biofilms locally, acting as a biological barrier that effectively resists antibiotics. This phenomenon is extremely common in periodontitis. In addition, long-term use of antibiotics can also induce bacterial resistance and dysbiosis. Summary of the Invention

[0003] The purpose of the present invention is to provide a repair material suitable for infected bone defects, which has both high antibacterial properties and osteogenic induction ability. On the one hand, it reduces adverse reactions such as bacterial resistance and dysbiosis, and on the other hand, it achieves infection control and bone regeneration at the same time, shortening the treatment cycle.

[0004] In order to achieve the above object, the present invention provides an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, wherein the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system comprises:

[0005] Recombinant antimicrobial peptide LL-37, macrophage membrane, enzyme cascade reaction system;

[0006] The recombinant antimicrobial peptide LL-37 is anchored on the macrophage membrane to form a recombinant antimicrobial peptide LL-37-modified macrophage membrane; the recombinant antimicrobial peptide LL-37-modified macrophage membrane wraps the enzyme cascade reaction system to form the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system;

[0007] Wherein, the macrophage membrane surface highly expresses Toll-like receptor 2 and Toll-like receptor 4 after pre-stimulation;

[0008] The enzyme cascade reaction system comprises a nanozyme with catalase-like activity and a hydrogen peroxide-producing biological enzyme.

[0009] Optionally, the nanozyme comprises at least one or more of manganese dioxide nanoparticles, hollow manganese dioxide particles, Prussian blue particles, and hollow Prussian blue particles.

[0010] Optionally, the hydrogen peroxide-producing biological enzyme comprises at least any one of glucose oxidase and L-amino acid oxidase.

[0011] Optionally, the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system specifically binds to pathogenic bacteria that infect bone defects, such as Porphyromonas gingivalis, Fusobacterium nucleatum, Staphylococcus aureus, and Escherichia coli.

[0012] The present invention also provides a method for preparing an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, comprising the following steps:

[0013] Step 1: Preparation of macrophage membranes overexpressing recombinant antimicrobial peptide LL-37:

[0014] Constructing a transmembrane recombinant antimicrobial peptide LL-37 lentivirus, infecting macrophages with the lentivirus to overexpress the transmembrane recombinant antimicrobial peptide LL-37, stimulating the resulting macrophages with bacterial lipopolysaccharide, and obtaining macrophage cell membranes overexpressing the recombinant antimicrobial peptide LL-37;

[0015] Step 2: Preparation of enzyme cascade reaction system:

[0016] The nanozyme with catalase-like activity was added to the hydrogen peroxide-producing enzyme solution, sonicated in an ice bath, stirred at 4°C overnight, centrifuged, and the precipitate was collected to obtain an enzyme cascade reaction system;

[0017] Step 3: Preparation of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system:

[0018] An extruder is used to push the recombinant antimicrobial peptide LL-37 overexpressing macrophage membrane to obtain macrophage membrane vesicles, and the macrophage membrane vesicles are mixed with the enzyme cascade reaction system to obtain an antimicrobial peptide modified biomimetic nanoparticle targeted delivery system.

[0019] Optionally, in step 1, when constructing the transmembrane recombinant antimicrobial peptide LL-37 lentivirus, the target gene sequence is shown as SEQ ID NO.1.

[0020] Optionally, the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system is an injectable solution.

[0021] Optionally, in the step three, the mass ratio of the enzyme cascade reaction system to the macrophage membrane vesicles is (1:2.5) to (1:20).

[0022] The present invention also provides an application of an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, wherein the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system is used to prepare a drug for treating infected bone defects.

[0023] Optionally, the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system is used to prepare drugs for treating periodontitis, peri-implantitis, infected fractures, and osteomyelitis.

[0024] Compared with the prior art, the beneficial effects of the present invention include at least:

[0025] (1) The present invention constructs an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, which comprises: a recombinant antimicrobial peptide LL-37, a macrophage membrane, and an enzyme cascade reaction system; the recombinant antimicrobial peptide LL-37 is expressed on the macrophage membrane to form a recombinant antimicrobial peptide LL-37-modified macrophage membrane; the recombinant antimicrobial peptide LL-37-modified macrophage membrane wraps the enzyme cascade reaction system to form the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system; wherein, Toll-like receptor 2 and Toll-like receptor 4 are highly expressed on the surface of the macrophage membrane; the enzyme cascade reaction system comprises a nanozyme with catalase-like activity and a hydrogen peroxide-producing bioenzyme. Through gene editing technology, the antimicrobial peptide LL-37 with broad-spectrum antimicrobial effects is expressed on the macrophage membrane, and cell membrane modification technology is used to encapsulate the enzyme cascade reaction system with the engineered macrophage membrane. The pattern recognition receptors Toll-like receptor 2 and Toll-like receptor 4 highly expressed on the macrophage membrane target bacteria in the infected area. Combined with the bactericidal effect of antimicrobial peptides and the relief of local oxidative stress effects by nanozymes, the antimicrobial, immune regulation, and osteogenesis integration are achieved, achieving efficient regeneration of infected bone defects.

[0026] (2) The enzyme cascade reaction system of the present invention can decompose substances such as hydrogen peroxide, glucose, and amino acids in the infection environment, generate oxygen, and improve the local hypoxic environment, reshape the inflammatory microenvironment, and promote osteogenesis.

[0027] (3) The antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system of the present invention is an injectable solution, which is suitable for lacunar bone defects and can reach complex structural areas that conventional instruments cannot reach. Its use range can be expanded when used in combination with other repair materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the target gene sequence of the present invention.

[0029] Figure 2 This is the sequencing result of the recombinant plasmid of the present invention.

[0030] Figure 3 Schematic diagram of the recombinant plasmid of the present invention.

[0031] Figure 4 This is a diagram showing the expression of related proteins in Raw264.7 cells positive for lentivirus infection after LPS stimulation detected by immunofluorescence of the present invention.

[0032] Figure 5 This is the detection diagram of hMnO2 loaded LAAO of the present invention.

[0033] Figure 6 A is the Western Blot detection of the present invention for the expression of membrane proteins such as LL-37 and TLR2 / 4 on control macrophages (Mφ), LPS-stimulated recombinant antimicrobial peptide LL-37 lentivirus-transfected macrophages (LMφ), macrophage membranes (LMφvesicles), and recombinant antimicrobial peptide LL-37-modified macrophage membrane-encapsulated nanoparticles (LMNPs).

[0034] Figure 6 B is the electron microscope image of LAAO-hMnO2 and LMNPs of the present invention.

[0035] Figure 7 A represents the oxygen production after adding LL-37 modified macrophage membranes (LMMs), hMnO2 particles, and LL-37 modified macrophage membrane-encapsulated enzyme cascade reaction system (LMNPs) to the H2O2 and L-Trp solution of the present invention.

[0036] Figure 7 B is the colony formation of Porphyromonas gingivalis (Pg) and Fusobacterium nucleatum (Fn) of the present invention after adding LMMs and LMNPs.

[0037] Figure 7 C shows the polarization of Raw264.7 cells after adding LPS and various nanoparticles of the present invention.

[0038] Figure 7 D is the detection of MC3t3 mineralization induced by the Raw264.7 cell conditioned medium (CM) obtained by different treatments of the present invention. DETAILED DESCRIPTION

[0039] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0040] Experimental methods not specifically mentioned in the present invention are all routine experimental methods in the art, and experimental materials not specifically mentioned in the present invention are all routine experimental materials in the art.

[0041] Currently, bone defect repair materials, such as autologous bone, allograft bone, xenograft bone, and titanium alloys, lack antimicrobial properties and are unable to simultaneously achieve both infection control and bone regeneration. While treatment with antibiotic-compounded bone cement can prevent and treat infection to a certain extent, it carries the risk of allergic reactions and bacterial resistance.

[0042] Antimicrobial peptides are a class of small molecule peptides with antimicrobial activity in the human defense system and are an important supplement to the immune system. LL-37, a key member of the cathelicidins family of antimicrobial peptides, can be derived from macrophages, neutrophils, natural killer cells, and other cells. It possesses broad-spectrum antimicrobial activity, showing excellent bactericidal effects against both Gram-positive and Gram-negative bacteria. Furthermore, due to its distinct antimicrobial mechanism from antimicrobial drugs, it is less likely to induce bacterial resistance and exhibits strong antimicrobial activity against some antimicrobial-resistant strains, thus gradually attracting the attention of researchers.

[0043] The cell membrane is a key component that stabilizes cellular contents and effectively separates the interface between the intracellular and extracellular media. It not only maintains the stability of the intracellular environment but also enables information exchange with the surrounding environment. Through membrane receptors, it can target specific targets and exert unique effects. Consequently, the technology of modifying biomaterials using cell membranes and their derivatives has developed rapidly. Macrophage-derived cell membranes are abundant in vivo and can be used to effectively manipulate the expression of membrane receptors to encapsulate drugs, improving their biocompatibility and enabling targeted drug homing, making them ideal drug delivery vehicles.

[0044] Based on the above, the present invention provides an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system for the treatment of infected bone defects and a preparation method thereof, wherein a recombinant antimicrobial peptide LL-37-modified macrophage membrane-encapsulated enzyme cascade reaction system is used to specifically bind to bacteria through pattern recognition receptors on the macrophage membrane, thereby exerting the bactericidal effect of the antimicrobial peptide. At the same time, the contained enzyme cascade reaction system can decompose hydrogen peroxide, glucose or amino acids in the infected environment to produce oxygen, improve the local hypoxic environment, induce local inflammatory cells to polarize toward an anti-inflammatory phenotype, reshape the inflammatory environment, and ultimately promote bone regeneration, achieving the effects of anti-infection and bone repair at the same time.

[0045] The present invention provides a method for preparing an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, comprising the following steps:

[0046] Step 1: Preparation of recombinant LL-37 overexpressing macrophage membranes:

[0047] 1. Construction of transmembrane recombinant antimicrobial peptide LL-37 lentiviral vector:

[0048] LL-37 is a small molecule peptide containing 37 amino acids that is released by the C-terminal cleavage of its precursor protein hCAP18. The N-terminal portion of hCAP18 contains a 30-amino acid signal peptide that regulates the release of LL-37 and its resistance to proteolysis. Therefore, when constructing a recombinant plasmid, we choose to retain both sequences and connect them to the transmembrane protein SS1 through a flexible protein to achieve cell membrane anchoring. Figure 1 As shown, the full length is 10084 bp. The signal peptide is selected from the sequence encoding the first 30 amino acids of the hCAP18 protein, and the LL-37 active peptide is selected from the sequence encoding the last 37 amino acids of the hCAP18 protein. The two are connected to the transmembrane protein SS1 sequence via a flexible sequence (GGS) 4. Transfected cells are screened for puromycin resistance. The constructed target gene sequence is shown in SEQ ID NO. 1 and is as follows:

[0049] GCCACCATGAAGACCCAGAGAGACGGCCACAGTCTCGGGAGGTGGAG

[0050] CCTGGTGCTGCTTCTATTGGGACTGGTCATGCCACTGGCCATCATTGCTT

[0051] TGCTAGGGGATTTCTTCAGGAAATCCAAGGAGAAGATTGGCAAAGAAT

[0052] TCAAGCGGATAGTGCAGAGGATCAAGGACTTTCTCAGAAACCTGGTCC

[0053] CTAGAACCGAGAGTGGTGGATCCGGCGGGTCTGGGGGCTCAGGTGGTT

[0054] CCGAACAGCTTGAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTC

[0055] TTCTGCTGGTGACTCCATTTCTGGCAGCAGCCTGGAGCCTTCATCCCTAA.

[0056] like Figure 1 As shown, the target gene was recombined with the enzyme-digested vector lenti-CMV-MCS-PGK-Puro using the seamless cloning method. The ligation product was transferred into the prepared competent E. coli strain stbl3 for amplification. The grown monoclonal colonies were sent to a sequencing company for sequencing. The sequencing results are shown in Figure 2As shown, confirm that the inserted fragment sequence in the recombinant clone is completely consistent with the target fragment sequence, and the final recombinant plasmid structure is as follows Figure 3 shown.

[0057] The constructed vector plasmid and auxiliary packaging vector plasmid were co-transfected into HEK-293T cells, and the cell supernatant rich in lentiviral particles was collected and concentrated to obtain a high-titer lentiviral concentrate.

[0058] 2. Lentiviral infection of Raw264.7 cells to overexpress transmembrane recombinant antimicrobial peptide LL-37:

[0059] Raw264.7 cells of a mouse macrophage cell line with good growth status were inoculated into a culture plate and transfected with culture medium containing lentivirus. 5 μg / mL puromycin was then used for selection to obtain transfection-positive cells. After 24 hours of stimulation with bacterial lipopolysaccharide (LPS), the expression of recombinant antimicrobial peptide LL-37, Toll-like receptor 2 (TLR2), and Toll-like receptor 4 (TLR4) was detected by immunofluorescence. The results are shown in Figure 2. Figure 4 As shown, compared with normal macrophages (Raw group), lentiviral transfected positive cells (Rawrh LL-37OE )LL-37 expression was significantly enhanced, and under LPS induction, the expression of the pattern recognition receptors TLR2 / 4 on the membrane was further increased.

[0060] 3. Extraction of macrophage membrane modified with recombinant antimicrobial peptide LL-37:

[0061] Collect Raw rhLL-37OE The cells were resuspended in hypotonic PBS solution, and the cell suspension was sonicated on ice for 10 min and centrifuged at 10,000 rpm for 10 min to remove organelles. The supernatant was collected and centrifuged at 14,000 g for 30 min to obtain the recombinant antimicrobial peptide LL-37-modified macrophage membrane. The protein concentration was determined by the BCA method and the cells were stored at -80°C for future use.

[0062] Step 2: Preparation of enzyme cascade reaction system:

[0063] The enzyme cascade reaction system includes a nanozyme with catalase-like activity and a hydrogen peroxide-producing bioenzyme. Wherein, the nanozyme has the performance of decomposing hydrogen peroxide to produce oxygen, and at least comprises any one or more of manganese dioxide nanoparticles, hollow manganese dioxide particles, Prussian blue particles, and hollow Prussian blue particles. The hydrogen peroxide-producing bioenzyme comprises at least any one of glucose oxidase (GOX) and L-amino acid oxidase (LAAO). GOX is more suitable for use in infected bone defects with diabetes, and LAAO is more suitable for the gingival sulcus environment of periodontitis. The cascade reaction of nano-bioenzymes can improve the catalytic efficiency of the two, accelerate the rate of oxygen production, alleviate the hypoxic environment in the infected area, and reshape the local inflammatory environment. Because the infected area is usually an oxygen-deficient environment, which is not conducive to cell repair and regeneration, and there is generally a certain concentration of hydrogen peroxide in the infected area, nanozymes that can decompose hydrogen peroxide are used to alleviate the local hypoxic environment by decomposing hydrogen peroxide to produce oxygen. However, the catalytic efficiency of a single enzyme is limited and cannot meet the complex environment of the infected area. Therefore, an enzyme cascade reaction system is introduced. The so-called cascade reaction is that the reaction product of enzyme one is the reaction substrate of enzyme two, thus forming a circulation system, which can improve the catalytic efficiency of both.

[0064] In some embodiments, the nanozyme cascade reaction system is hollow manganese dioxide particles (hMnO2) loaded with L-amino acid oxidase (LAAO), and the specific preparation method thereof is:

[0065] Add 1 mg of hMnO2 powder to 1 mL of LAAO solution (1 mg / mL), ultrasonicate in an ice bath for 15 min, stir overnight at 4°C, centrifuge at 15,000 rpm for 10 min, and the supernatant is used to measure the enzyme loading efficiency. The particles are washed with PBS and collected by centrifugation to obtain LAAO-hMnO2 particles, which are stored at 4°C for later use. The washing liquid is collected to detect the enzyme loading efficiency. The protein concentration is determined by the BCA method, LAAO loading efficiency = (total protein amount - (supernatant protein amount + washing liquid protein amount)) / total protein amount. hMnO2 enzyme loading capacity = LAAO loading amount / hMnO2 mass. Figure 5 As shown, the LAAO loading efficiency was 50.1±5.19% and the loading capacity was 326.3±35.52 μg / mg.

[0066] Step 3: Construction of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system:

[0067] Macrophage membranes modified with the recombinant antimicrobial peptide LL-37 were extruded 10 times using an extruder equipped with 400 nm and 200 nm pore size filters to produce macrophage vesicles. LAAO-hMnO2 particles and macrophage vesicles were mixed at a mass ratio of 1:5. After 15 minutes of ice-bath sonication, the mixture was extruded 10 times using an extruder equipped with 400 nm and 200 nm pore size filters to produce a biomimetic nanoparticle targeted delivery system modified with the antimicrobial peptide.

[0068] Characterization of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system:

[0069] Western Blot technology was used to detect the expression levels of cell membrane-related proteins, such as Figure 6 As shown in Figure A, the expression of LL-37 and TLR2 / 4 in the normal macrophage (Mφ) group was lower than that in the macrophages (LMφ) transfected with the recombinant antimicrobial peptide LL-37 lentivirus and stimulated by LPS. The membrane extraction process did not significantly affect the expression of macrophage membrane-related proteins (LMφvesicles), and the expression of related proteins on the recombinant antimicrobial peptide LL-37 modified macrophage membrane-cloaked nanoparticles (LL-37-modified macrophage membrane-cloaked nanoparticles, LMNPs) (i.e., biomimetic nanoparticle targeted delivery system) did not change significantly. The morphology of the nanoparticles was observed using a scanning electron microscope. The results are shown in Figure 5. Figure 6 B, hMnO2 is a hollow spherical nanoparticle with a diameter of about 100-200nm. Compared with hMnO2, the particle size of LMNPs is slightly increased, showing a clear core-shell structure, indicating that LAAO-hMnO2 is successfully encapsulated.

[0070] Detection of oxygen production effect of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system:

[0071] LMNPs were prepared as described above, with a macrophage membrane concentration of 1 mg / mL and a LAAO-hMnO2 particle concentration of 200 μg / mL. One mL of LMNPs was added to a mixture of 5 mL of H2O2 (100 μmol / L) and L-tryptophan (L-Trp, 5 mmol / L) and allowed to react at room temperature. A dissolved oxygen meter was used to measure oxygen production. Controls containing only modified macrophage membranes (H2O2+L-Trp+LMMs group) or only hMnO2 particles at equal concentrations (H2O2+L-Trp+hMnO2) were used. The results are shown in Figure 2. Figure 7 As shown in Figure A, since LAAO in LMNPs locally decomposes L-Trp to provide additional H2O2, the catalytic efficiency and oxygen production rate of hMnO2 can be improved, forming an effective cascade reaction.

[0072] Antimicrobial effect detection of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system:

[0073] The antibacterial properties of LMNPs were tested against the periodontal pathogens Porphyromonas gingivalis (Pg) and Fusobacterium nucleatum (Fn). LMNPs were prepared as described above, with a macrophage membrane concentration of 1 mg / mL and a LAAO-hMnO2 particle concentration of 200 μg / mL. Pg and Fn were diluted to 2 × 10 4 / ml CFU, mixed with PBS (Con), modified macrophage membrane particles (LMMs), and LMNPs in a ratio of 1:1, cultured in an anaerobic chamber for 12 hours and then plated. After culture in an anaerobic chamber for 5 days and 3 days respectively, the cells were photographed and counted. The antibacterial results are shown in Figure 7 B. LL-37 modified macrophage membrane particles have obvious antibacterial effect, and the antibacterial effect is further enhanced after being encapsulated in LAAO-hMnO2.

[0074] Detection of the immunomodulatory and osteogenic induction abilities of antimicrobial peptide-modified biomimetic nanoparticle targeted delivery systems:

[0075] 1. Take Raw264.7 cells with good growth conditions and inoculate them into 6-well plates. When the cell confluence reaches 80-90%, add LPS (1 mg / mL, 1:10000 ratio), or add LL-37 modified macrophage membrane particles (LPS+LMMs) and LMNPs (LPS+LMNPs) at the same time. Use only PBS without LPS and particles to treat Raw cells as controls. After 24 hours, collect samples, extract RNA, and reverse transcribe to generate cDNA. Then, perform qPCR to detect the polarization state of Raw cells. The expression of Cd86, iNos, and Il-1 is used to evaluate the pro-inflammatory macrophage phenotype, and the expression of Arg-1, Cd206, and Il-10 is used to evaluate the anti-inflammatory macrophage phenotype. The results are as follows Figure 7 As shown in Figure C, the addition of LPS can promote the polarization of Raw cells in a pro-inflammatory direction, and LMMs and LMNPs can reverse this trend, with the effect of LMNPs being the most significant.

[0076] 2. Take Raw264.7 cells with good growth conditions, inoculate them in a culture dish, and when the cell fusion reaches 80-90%, add LPS (1 mg / mL, 1:10000 ratio), or add LMNPs at the same time, and use only PBS, without LPS and particles, to add Raw cells as a control. After 36 hours, collect the supernatant by centrifugation, mix it with osteogenic induction solution at a ratio of 1:1, and prepare conditioned medium (CM). Take MC3t3 cells with good growth conditions, inoculate them in a 24-well plate, and when the cell fusion reaches more than 80%, replace the culture medium with the aforementioned conditioned medium. Alkaline phosphatase (ALP) and Alizarin red (ARS) staining are performed on 7 and 14 days of culture to evaluate osteogenesis. The results are as follows: Figure 7 As shown in Figure D, the addition of LPS to the CM significantly inhibited osteogenic differentiation, while the addition of LMNPs significantly promoted the cell mineralization ability.

[0077] In summary, the present invention provides an antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system, which comprises: a recombinant antimicrobial peptide LL-37, a macrophage membrane, and an enzyme cascade reaction system; the recombinant antimicrobial peptide LL-37 is expressed on the macrophage membrane to form an antimicrobial peptide LL-37-modified macrophage membrane; the antimicrobial peptide LL-37-modified macrophage membrane wraps the enzyme cascade reaction system to form the antimicrobial peptide-modified biomimetic nanoparticle targeted delivery system; wherein, Toll-like receptor 2 and Toll-like receptor 4 are highly expressed on the surface of the macrophage membrane; the enzyme cascade reaction system comprises a nanozyme with catalase-like activity and a hydrogen peroxide-producing bioenzyme. The present invention uses gene editing technology to express the antimicrobial peptide LL-37 with a broad-spectrum antimicrobial effect on the macrophage membrane, and utilizes cell membrane modification technology to encapsulate the enzyme cascade reaction system with the engineered macrophage membrane. The bacteria in the infected area are targeted through the pattern recognition receptors on the macrophage membrane. The bactericidal effect of antimicrobial peptides and the relief of local oxidative stress by nanozymes are combined to achieve the integration of antibacterial, immune regulation and osteogenesis, thereby achieving the effect of efficient regeneration of infected bone defects.

[0078] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A biomimetic nanoparticle targeted delivery system modified with an antimicrobial peptide, characterized in that: The antimicrobial peptide modified bionic nanoparticle targeted delivery system comprises: Recombinant antimicrobial peptide LL-37, macrophage membrane, enzyme cascade reaction system; The recombinant antimicrobial peptide LL-37 is expressed on the macrophage membrane to form a macrophage membrane modified by the recombinant antimicrobial peptide LL-37; the macrophage membrane modified by the recombinant antimicrobial peptide LL-37 wraps the enzyme cascade reaction system to form a bionic nanoparticle targeted delivery system modified by the antimicrobial peptide; wherein, after pre-stimulation, the surface of the macrophage membrane highly expresses Toll-like receptor 2 and Toll-like receptor 4; The enzyme cascade reaction system comprises a nanozyme with catalase-like activity and a hydrogen peroxide-producing biological enzyme.

2. The antimicrobial peptide modified biomimetic nanoparticle targeted delivery system according to claim 1, characterized in that: The nanozyme comprises at least one or more of manganese dioxide nanoparticles, hollow manganese dioxide particles, Prussian blue particles, and hollow Prussian blue particles.

3. The antimicrobial peptide modified biomimetic nanoparticle targeted delivery system according to claim 1, characterized in that: The hydrogen peroxide-producing biological enzyme at least comprises any one of glucose oxidase and L-amino acid oxidase.

4. The antimicrobial peptide modified biomimetic nanoparticle targeted delivery system according to claim 1, characterized in that: The antimicrobial peptide-modified bionic nanoparticle targeted delivery system specifically binds to pathogenic bacteria of infected bone defects, such as Porphyromonas gingivalis, Fusobacterium nucleatum, Staphylococcus aureus, and Escherichia coli.

5. A method for preparing the antimicrobial peptide modified bionic nanoparticle targeted delivery system according to any one of claims 1 to 4, characterized in that: The following steps are involved: Step 1: Preparation of macrophage membranes overexpressing recombinant antimicrobial peptide LL-37: Constructing a transmembrane recombinant antimicrobial peptide LL-37 lentivirus, infecting macrophages with the lentivirus to overexpress the transmembrane recombinant antimicrobial peptide LL-37, stimulating the obtained macrophages with bacterial lipopolysaccharide, and obtaining a macrophage cell membrane overexpressing the recombinant antimicrobial peptide LL-37; Step 2, preparation of enzyme cascade reaction system: The nanozyme with catalase-like activity was added to the hydrogen peroxide-producing biological enzyme solution, and after ice bath sonication, it was stirred at 4°C overnight, centrifuged, and the precipitate was collected to obtain an enzyme cascade reaction system; Step 3: Preparation of antimicrobial peptide modified biomimetic nanoparticle targeted delivery system: An extruder is used to push the recombinant antimicrobial peptide LL-37 overexpressing macrophage membrane to obtain macrophage membrane vesicles, and the macrophage membrane vesicles are mixed with the enzyme cascade reaction system. After ice bath ultrasound, the extruder is repeatedly pushed to obtain an antimicrobial peptide modified bionic nanoparticle targeted delivery system.

6. The preparation method according to claim 5, characterized in that: In the step 1, when constructing the transmembrane recombinant antimicrobial peptide LL-37 lentivirus, the target gene sequence is shown in SEQ ID NO.

1.

7. The preparation method according to claim 5, characterized in that: The antimicrobial peptide-modified bionic nanoparticle targeted delivery system is an injectable solution.

8. The preparation method according to claim 5, characterized in that: In the step three, the mass ratio of the enzyme cascade reaction system to the macrophage membrane vesicles is (1:2.5) to (1:20).

9. Use of the antimicrobial peptide modified bionic nanoparticle targeted delivery system as claimed in any one of claims 1 to 4, characterized in that: The antimicrobial peptide-modified bionic nanoparticle targeted delivery system is used for preparing a drug for treating infected bone defects.

10. The use according to claim 9, characterized in that The antimicrobial peptide-modified bionic nanoparticle targeted delivery system is used for preparing drugs for treating periodontitis, peri-implantitis, infected fractures and osteomyelitis.

Images