Application of EEF1B2 as drug target or EEF1B2 in preparation of anti-tumor immunosuppression drugs

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of EEF1B2 serving as a drug target or EEF1B2 in preparation of anti-tumor immunosuppression drugs. By inhibiting the EEF1B2, the generation and differentiation of MDSCs in colorectal adenoma are remarkably reduced, and the immunosuppression function of MDSCs is interfered, so that the growth or disease course development of colorectal adenoma is remarkably slowed down or reduced. The invention provides a medicine CBD containing an EEF1B2 inhibitor, particularly innovative application of the CBD as the EEF1B2 inhibitor, and a method for treating colon adenoma and preventing further canceration of the adenoma by inhibiting the EEF1B2 function. The invention further relates to a method for detecting the regulatory relation between the EEF1B2 and the CEBP beta. The implementation of the invention provides a new strategy and a drug development direction for treatment of colon adenoma and intervention of further development of colon adenoma into immunosuppressive treatment of colorectal cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of EEF1B2 as a drug target or EEF1B2 itself in the preparation of anti-tumor immunosuppressive drugs. Background Art

[0002] Colorectal adenoma is an important precursor lesion of colorectal cancer. The formation of colorectal adenoma is related to multiple factors, including genetic mutations, chronic inflammation, dietary structure, and immune system disorders. Recently, immunotherapy for colorectal adenoma has gradually become a research hotspot, but the presence of immunosuppressive cells in the tumor microenvironment of colorectal adenoma, especially myeloid-derived suppressor cells (MDSCs), limits the effectiveness of immunotherapy. MDSCs inhibit the activity and proliferation of T cells and promote tumor growth and development. At present, the treatment strategies for MDSCs are mainly focused on inhibiting their migration and function, but how to effectively regulate the generation and differentiation of MDSCs is still not fully understood. At present, MDSCs are considered to be one of the important targets for cancer immunotherapy, such as inhibitors targeting MDSCs function such as L-NMMA, drugs targeting MDSCs differentiation such as retinoic acid, and combined treatment of immune checkpoint inhibitors and MDSCs such as PD-1 / PD-L1 inhibitors + MDSCs inhibitors. These inhibitors can be used alone or in combination with immune checkpoint inhibitors, chemotherapy or radiotherapy to improve the effect of cancer treatment. Although there are many drugs targeting MDSCs, research on new drug targets is the core of drug development and medical progress, and has important scientific significance and practical application value. For example, drugs targeting new targets may have higher selectivity, thereby reducing toxicity to normal tissues. New targets may be located at key regulatory nodes of the disease, and drugs targeting these targets may have stronger therapeutic effects. Therefore, discovering new targets is a key research and development direction in this field.

[0003] In recent years, studies have found that eukaryotic translation elongation factor 1β2 (EEF1B2) plays an important role in many diseases, especially in tumors and immune regulation. EEF1B2 is a key factor in protein translation elongation and is involved in regulating the protein synthesis process of cells. Specifically, EEF1B2 and EEF1A1 jointly regulate the translation and elongation process. EEF1A1 is responsible for delivering aminoacylated tRNA to the ribosome A site in a GTP-dependent manner, while its inactive state (EEF1A-GDP) is reactivated to the GTP-bound state through the action of nucleotide exchange factors (GEFs) mediated by the EEF1B2 complex, thereby cyclically participating in translation elongation. Studies have shown that EEF1B2 is abnormally expressed in a variety of tumors, such as esophageal cancer and lung cancer, and is closely related to tumor progression.

[0004] However, the relationship between EEF1B2 and the generation and differentiation of MDSCs has not been fully studied. It is not known whether EEF1B2 can become a key target for regulating the generation and differentiation of MDSCs, and whether inhibiting EEF1B2 itself can improve the effect of tumor immunotherapy. Summary of the invention

[0005] In view of this, the primary purpose of the present invention is to provide EEF1B2 as a drug target or EEF1B2 itself in the preparation of anti-immunosuppressive drugs. The present invention found that EEF1B2 can regulate the generation and differentiation of MDSCs, and inhibiting the function of EEF1B2 can significantly reduce the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal adenoma, thereby controlling the growth of adenoma. The present invention found that CBD can directly act on EEF1B2 and be used as an innovative drug for the treatment of colorectal adenoma, which provides new targets and new strategies for the treatment of colorectal adenoma.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides the use of EEF1B2 as a drug target in the preparation of anti-tumor immunosuppressive drugs.

[0008] EEF1B2 is used in the preparation of drugs for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenomas.

[0009] Cannabidiol is used in the preparation of anti-tumor immunosuppressive drugs.

[0010] Cannabidiol is used as an EEF1B2 inhibitor in the preparation of drugs to inhibit the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenomas.

[0011] shEEF1B2 is used in the preparation of anti-tumor immunosuppressive drugs, characterized in that the nucleotide sequence of shEEF1B2 is GCACAGTATGAGTCCAAGAAA.

[0012] shEEF1B2 is used in the preparation of a drug for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenoma. The nucleotide sequence of shEEF1B2 is GCACAGTATGAGTCCAAGAAA.

[0013] Furthermore, the EEF1B2 refers to: Eukaryotic translation elongation factor 1 beta 2 (EEF1B2), which is a key factor in protein translation elongation and participates in regulating the protein synthesis process of cells.

[0014] Furthermore, the EEF1B2 is used as a drug target in the preparation of a drug for treating colorectal adenoma or a drug for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal adenoma, characterized in that EEF1B2 is used as a drug target of the drug cannabidiol (Cannabidiol, CBD) to treat colorectal adenoma and inhibit the immunosuppressive effect of MDSCs in the tumor microenvironment.

[0015] Furthermore, EEF1B2 is used as a drug target in the preparation of drugs for treating colorectal adenoma or drugs for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal adenoma, characterized in that the approaches for treating colorectal adenoma through the EEF1B2 target include but are not limited to: inhibiting the protein translation extension function of EEF1B2, inhibiting the protein translation extension function of EEF1B2 by blocking the formation of the EEF1B2 and EEF1A1 complex, interfering with the function of EEF1B2 in inhibiting the generation and differentiation of MDSCs, or blocking EEF1B2 from participating in regulating the generation and differentiation of MDSCs through CEBPβ.

[0016] The second aspect of the present invention provides a drug combination for inhibiting the function of EEF1B2 for use in the preparation of a drug for treating colorectal adenoma or a drug for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal adenoma.

[0017] Furthermore, the drug combination for inhibiting the function of EEF1B2 is characterized in that CBD, as an inhibitor of the function of EEF1B2, can significantly control the growth and development of colon adenomas and inhibit the generation and differentiation of MDCSs in the tumor microenvironment.

[0018] The third aspect of the present invention provides a method for regulating the expression of transcription factor CEBPβ ​​by inhibiting the function of EEF1B2, which is characterized by comprising administering an EEF1B2 inhibitor to reduce the expression of CEBPβ, thereby inhibiting the generation and differentiation of MDSCs.

[0019] Furthermore, the CEBPβ ​​refers to CCAAT / enhancer binding protein beta, CCAAT / enhancer binding protein beta, C / EBPβ), also known as nuclear factor for IL-6 (NF-IL6), which is an important member of the transcription factor CCAAT / enhancer binding protein (CCAAT / enhancer binding proteins, C / EBPs) family. Its C-terminus has a highly conserved DNA binding domain and a dimerization functional domain. It mainly participates in important life activities such as cell proliferation and differentiation, tumor occurrence and apoptosis, and inflammatory response of the body through the regulation of target cell gene transcription. It is also an important transcription factor that promotes the generation of MDSC.

[0020] Beneficial effects of the present invention:

[0021] One of the reasons why rectal adenomas are difficult to treat is that there are immunosuppressive cell infiltration and immune escape mechanisms in rectal adenomas, including immunosuppressive cell infiltration: there are a large number of immunosuppressive cells in the tumor microenvironment, such as myeloid-derived suppressor cells (MDSCs), regulatory T cells (Tregs), and tumor-associated macrophages (TAMs). These cells suppress anti-tumor immune responses by secreting inhibitory cytokines (such as TGF-β, IL-10) and expressing immune checkpoint molecules (such as PD-L1). Immune escape mechanism: Rectal adenoma cells may upregulate molecules such as PD-L1, bind to PD-1 on T cells, inhibit the activity of T cells, and thus escape the attack of the immune system. Therefore, how to reduce immunosuppression is a technical problem that needs to be solved urgently in the treatment of rectal adenomas. Although there are many drugs for MDSCs inhibitors themselves, if new targets are discovered, it will bring new ideas to drug research.

[0022] The present invention discovers for the first time that inhibiting EEF1B2 will reduce the generation and differentiation of MDSCs. It actually controls the generation and differentiation of MDSCs and their immunosuppressive formation by regulating CEBPβ, thereby improving the immunosuppressive state of the tumor microenvironment. Since EEF1B2 is a key factor in protein translation elongation and participates in regulating the protein synthesis process of cells, and EEF1B2 is an upstream protein of MDSCs, inhibiting EEF1B2 can not only inhibit MDSCs, but may also bring new functions and may have more advantages, such as providing new ideas for overcoming poor effects or side effects. Therefore, EEF1B2 can be used as a new drug target for the treatment of colorectal adenomas or a target for screening drugs.

[0023] The inventors found that cannabidiol (CBD) or shEEF1B2 is an EEF1B2 inhibitor, which can inhibit the generation and differentiation of MDSCs by inhibiting the function of EEF1B2 and reducing the expression of CEBPβ, and promote the differentiation of MDSCs into M1 macrophages and dendritic cells, thereby improving the immunosuppressive state of the tumor microenvironment. The present invention provides a new strategy and drug development direction for early intervention and immunotherapy of colorectal adenomas. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Example 1 EEF1B2 is significantly increased in colon cancer tissues. The function of EEF1B2 translation elongation protein is necessary to promote the generation and differentiation of MDSCs. Figure AB shows the samples in the TCGA database. It is found that the expression of EEF1B2 gene increases in colon cancer tissues. At the same time, the expression of EEF1B2 is positively correlated with the degree of MDSCs infiltration in the tumor and with CD4 + T cells, CD8 + The degree of T cell infiltration was negatively correlated. Figures C and D show the changes in the mRNA and protein expression of EEF1B2 in MDSCs induced by bone marrow cells in vitro. Figures E and F show the ratio of induced differentiation of two subtypes of MDSCs (PMN-MDSC, M-MDSC) detected by flow cytometry after knocking out EEF1B2 in MDSCs, and the changes in the expression of immunosuppressive-related genes in MDSCs were quantified.

[0025] Figure 2 For Example 2, inhibition of EEF1B2 will block the generation and differentiation of MDSCs mediated by CEBPβ. Figure A shows the gene transcription of CEBPβ ​​in normal samples and samples of various stages of colon cancer in the TCGA database. Figure B shows the protein expression of CEBPβ ​​in normal samples and samples of various stages of colon cancer in the CPTAC database. Figure C is a survival curve showing the relationship between the high and low TPM of the CEBPβ ​​gene and the survival rate of colon cancer patients. Figure D shows the gene transcription of CEBPβ ​​in normal samples and colon cancer samples. Figure E shows the protein expression of CEBPβ ​​in normal samples and colon cancer samples. Figure F uses Western blot to analyze the changes in CEBPβ ​​expression during the generation and differentiation of MDSCs. Figure G uses Western blot to analyze the changes in CEBPβ ​​expression after knocking out EEF1B2 in MDSCs. Figure H uses Western blot to analyze the changes in CEBPβ ​​expression after overexpressing EEF1B2 in HEK293T cells.

[0026] Figure 3In Example 3, cannabidiol can inhibit the generation and differentiation of MDSCs and its immunosuppressive function. AB is the differentiation ratio of two types of MDSCs after the induced bone marrow cells were treated with different concentrations of CBD by flow cytometry. C is the expression of MDSCs immunosuppressive related genes after treatment with different concentrations of CBD. D is T cells incubated with MDSCs treated with different concentrations of CBD, and the activation and proliferation of CSFE-labeled T cells are detected. E is a schematic diagram of the structure of EEF1B2 interacting with EEF1A1 through its GEF domain. F is an immunoprecipitation and Western blot experiment to verify that CBD inhibits the interaction between EEF1B2 and EEF1A1. G is a Western blot analysis of changes in MDSC cell protein translation after MDSCs were treated with different concentrations of CBD or CHX. H is a Western blot analysis of changes in CEBPβ ​​expression after MDSCs were treated with different concentrations of CBD. I: EEF1B2 was overexpressed in MDSCs and treated with CBD at the concentrations indicated in the figure, and the changes in CEBPβ ​​expression were analyzed by Western blot.

[0027] Figure 4 In Example 4, the EEF1B2 protein in MDSC cells is a direct binding target of CBD. A is a schematic diagram of the drug target of CBD acting on MDSCs using the TRAP method. B is a protein target with significant differences in CBD binding in MDSCs detected by the TRAP method at 5μM and 10μM CBD concentrations, with DMSO as the control, in which the binding of EEF1B2 to CBD is concentration gradient dependent; red indicates a protein with high TRAP labeling efficiency and weak binding to CBD, and green indicates a protein with low TRAP labeling efficiency and strong binding to CBD. C is a Western blot analysis showing the change in thermal stability of EEF1B2-EGFP protein under 60-69°C after CBD treatment. D, H, and I are the binding curves of EEF1B2, EEF1B2(D62V), and EEF1B2(S6A) with CBD measured by microthermophoresis experiments, respectively. E and F are peptide sequences (RSIQADGLVWGSSKLVPVGYGIKKL) of CBD binding to EEF1B2, located in the GEF domain of EEF1B2 protein. G is the site of molecular docking simulation of the binding of the GEF domain of EEF1B2 to CBD.

[0028] Figure 5 Example 5 Effect of CBD on Apc induced by high fat diet (HFD) Min / + It has an inhibitory effect on spontaneous colorectal adenoma in mice. A is the designed Apc Min / +Schematic diagram of animal experiment of CBD treatment in mouse spontaneous colorectal adenoma model. B and C are Apc Min / + The formation of intestinal adenomas and the number of adenomas after colorectal sampling and dissection of mice. E and F are Apc Min / + Mouse spleen pictures and spleen weight statistics. G is Apc Min / + The fat content of mouse liver. H is Apc Min / + Statistics of T-CHO and TG content in mouse serum. Min / + HE pathological staining of paraffin sections of mouse colorectum.

[0029] Figure 6 Example 6 shows that overexpression of EEF1B2 in vivo weakened the inhibitory effect of CBD on the growth of colorectal adenoma. A is a design of a high fat diet (HFD) to induce Apc Min / + Schematic diagram of the animal experiment of overexpressing EEF1B2 in the mouse spontaneous colorectal cancer precancerous lesion model. B is the colonoscopy detection of Apc Min / + The occurrence of intestinal adenoma in mice. C is Apc Min / + Body weight changes of mice during the experiment. D is Apc Min / + The formation of intestinal adenomas and the number of adenomas after colorectal sampling and dissection of mice. E is Apc Min / + HE pathological staining of mouse colorectal paraffin sections. F is Apc Min / + Statistics of mouse spleen size and spleen weight. G is a representative flow cytometric graph of the proportion of infiltrating MDSCs in colorectal adenomas after overexpression of EEF1B2. H is a statistical graph of the proportion of the two types of MDSCs in Figure G. DETAILED DESCRIPTION

[0030] Embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. In addition, unless otherwise specified, methods that do not specifically record conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial sources.

[0032] Example 1: EEF1B2 is significantly elevated in colon cancer tissue and promotes the generation and differentiation of MDSCs

[0033] 1. Experimental Methods

[0034] 1.1 Statistics of EEF1B2 gene expression in relevant colon cancer samples and normal colon tissue samples in the TCGA database

[0035] The Timer website (https: / / cistrome.shinyapps.io / timer / ) was used to analyze colon cancer infiltrating immune cells online. The total EEF1B2 gene expression in colon cancer was analyzed according to gene name, cancer type, and tumor infiltrating immune cell type, and the correlation between EEF1B2 and MDSCs and CD4 + T cells, CD8 + Correlation of T cell infiltration degree.

[0036] 1.2 In vitro differentiation of bone marrow cells into MDSCs

[0037] Bone marrow cells were obtained from the tibia and femur of C57 / B6 mice. After being lysed with Tris-NH4Cl lysis buffer, they were inoculated at a density of 6×10^5 cells / mL in RPMI 1640 medium containing 10% fetal bovine serum, 1% double antibody and 55μM 2-mercaptoethanol. To induce the differentiation of myeloid-derived suppressor cells (MDSCs), 50ng / mL of GM-CSF and IL-6 were added to the culture medium and cultured for 7 days. RNA and protein of bone marrow cells being stimulated to differentiate were collected once a day, and RT-qPCR was used to quantify the mRNA expression of EEF1B2 and Western blot experiments were used to quantify the protein expression.

[0038] 1.3 In vitro lentiviral infection with shRNA to knock down EEF1B2 gene

[0039] Mouse bone marrow cells were extracted and cultured. After the cells were stably attached to the wall, lentiviral particles containing shRNA (shEEF1B2) fragments were prepared and added to the mouse bone marrow cells. After infection, the cells were incubated at 37°C and 5% CO2 for 24 hours. After 24 hours, the culture medium containing puromycin was replaced and the successfully infected cells were screened. After 3-5 days of screening, cells with stable knockdown of EEF1B2 were obtained.

[0040] 2. Experimental results

[0041] We counted the changes in EEF1B2 gene expression in colon cancer samples and normal samples in the TCGA database, as well as the correlation between EEF1B2 and the infiltration of immune cells related to tumor microenvironment immunosuppression. We found that the expression of EEF1B2 gene increased in colon cancer tissues, and the expression of EEF1B2 was positively correlated with the degree of MDSCs infiltration in tumors and with CD4 + T cells, CD8 + The degree of T cell infiltration was negatively correlated with Figure 1A, B). By inducing bone marrow cells to differentiate into MDSCs in vitro, we found that as MDSCs differentiated and matured, the expression of EEF1B2 gradually increased ( Figure 1 C, D), which indicates that EEF1B2 may be involved in the differentiation and maturation of MDSCs. After knocking out the EEF1B2 gene in mouse bone marrow cells, it was found that the proportion of bone marrow cells induced to form MDSC cells decreased, and the immunosuppressive activity of MDSCs was also weakened ( Figure 1 The above results indicate that EEF1B2 is a target for regulating the generation and differentiation of MDSCs.

[0042] Example 2: Inhibition of EEF1B2 blocks CEBPβ-mediated MDSC generation and differentiation

[0043] 1. Experimental Methods

[0044] 1.1 Statistics of CEBPβ ​​gene expression in relevant colon cancer samples and normal colon tissue samples in the TCGA database and CPTAC database

[0045] The Timer website (https: / / cistrome.shinyapps.io / timer / ) and the CPTAC database (https: / / proteomics.cancer.gov / programs / cptac) were used to analyze the CEBPβ ​​gene expression levels at various stages of colon cancer and the survival curve associated with the CEBPβ ​​gene TPM and patient survival rate.

[0046] 1.2 In vitro differentiation of bone marrow cells into MDSCs

[0047] Bone marrow cells were obtained from the tibia and femur of C57BL / 6 mice. After being lysed with Tris-NH4Cl lysis buffer, they were inoculated at a density of 6×10^5 cells / mL in RPMI 1640 medium containing 10% fetal bovine serum, 1% double antibody and 55μM 2-mercaptoethanol. To induce the differentiation of myeloid-derived suppressor cells (MDSCs), 50ng / mL of GM-CSF and IL-6 were added to the culture medium and cultured for 7 days. RNA and protein of bone marrow cells being stimulated to differentiate were collected once a day, and RT-qPCR was used to quantify the mRNA expression of EEF1B2 and Western blot experiments were used to quantify the protein expression.

[0048] 1.3 In vitro lentiviral infection with shRNA to knock down EEF1B2 gene

[0049] Mouse bone marrow cells were extracted and cultured. After the cells were stably attached to the wall, lentiviral particles containing shRNA (shEEF1B2, whose nucleotide sequence is GCACAGTATGAGTCCAAGAAA) were prepared and added to the mouse bone marrow cells. After infection, the cells were incubated at 37°C and 5% CO2 for 24 hours. After 24 hours, the culture medium containing puromycin was replaced and the successfully infected cells were screened. After 3-5 days of screening, cells with stable knockdown of EEF1B2 were obtained.

[0050] 1.4 Lentiviral transfection of cells to overexpress EEF1B2 gene

[0051] Add the lentivirus containing the EEF1B2 gene to HEK293T cells or bone marrow cells. After infection, incubate at 37°C and 5% CO2 for 24 hours. After 24 hours, replace the culture medium containing puromycin and select the successfully infected cells. After 3-5 days of selection, cells that stably overexpress EEF1B2 are obtained.

[0052] 2. Experimental results

[0053] The generation and differentiation of MDSCs are regulated by a variety of factors, among which CEBPβ ​​is a key transcription factor that forms the immunosuppressive properties of MDSCs. In particular, we found that the gene expression of CEBPβ ​​was significantly higher in colon cancer samples at all stages of the TCGA database than in normal tissue samples ( Figure 2 A, D), and the results of protein changes in the CPTAC database are also the same. And the survival rate of colon cancer patients with high CEBPβ ​​expression is relatively lower ( Figure 2 C).

[0054] Here we further explored whether EEF1B2 controls the generation and differentiation of MDSCs and their immunosuppressive formation by regulating CEBPβ. During the process of stimulating mouse bone marrow cells to differentiate into MDSCs in vitro, the expression of CEBPβ ​​gradually increased ( Figure 2 F). However, after the EEF1B2 gene in bone marrow cells was knocked out, the amount of CEBPβ ​​protein in MDSCs induced by bone marrow cells also decreased ( Figure 2 G). In contrast, overexpression of EEF1B2 in bone marrow cells increased the amount of CEBPβ ​​protein in MDSCs induced by bone marrow cells ( Figure 2 H). These data suggest that EEF1B2 mediates the generation and differentiation of MDSCs through CEBPβ.

[0055] Example 3: Cannabidiol (CBD) can inhibit the generation and differentiation of MDSCs and their immunosuppressive properties

[0056] 1. Experimental Methods

[0057] 1.1 Induction of bone marrow cells into MDSCs in vitro

[0058] Bone marrow cells were obtained from the tibia and femur of C57BL / 6 mice. After being lysed with Tris-NH4Cl lysis buffer, they were inoculated at a density of 6×10^5 cells / mL in RPMI 1640 medium containing 10% fetal bovine serum, 1% double antibody and 55μM 2-mercaptoethanol. To induce the differentiation of myeloid-derived suppressor cells (MDSCs), 50ng / mL of GM-CSF and IL-6 were added to the culture medium and cultured for 4 days. Different concentrations of CBD were added to the experimental group when the cells were inoculated, and the corresponding volume of DMSO was added to the control group. On the last day, RNA of the stimulated differentiated bone marrow cells was collected for RT-qPCR quantification, and the differentiation ratio of MDSCs was detected by flow cytometry.

[0059] 1.2 T cell proliferation assay

[0060] The experiment first adjusted the density of MDSCs with different treatments to 1×10^6 / mL, and at the same time, T cells were isolated from the spleen of mice and labeled with CFSE (2μM) to adjust the density to 2×10^6 / mL. Subsequently, T cells were cultured alone or co-cultured with MDSCs at a ratio of 1:1, 2:1, and 4:1 in 96-well plates pre-coated with anti-CD3 (5μg / mL) and soluble anti-CD28 (5μg / mL) for 4 days. Finally, the proliferation of CFSE-labeled T cells was detected by flow cytometry to evaluate the inhibitory ability of MDSCs on T cell proliferation.

[0061] 1.3 Co-immunoprecipitation experiments

[0062] Mouse bone marrow cells were cultured in 6 cm dishes, stimulated and induced to differentiate into MDSCs, and collected for 4 days to extract protein by cell lysis. 1 mg of protein was incubated with 2 μg of primary antibody at 4 ° C overnight. Then, magnetic Protein A / G beads (Millipore) were incubated at 4 ° C for 4 hours to precipitate the protein bound to the antibody. After washing 6 times with pre-cooled PBS and 2 times with pre-cooled lysis buffer, proteins not bound to the beads were removed. Then, the proteins bound to the beads were boiled in SDS loading buffer for 10 minutes. Take an equal amount of protein and boil it in SDS loading buffer for 10 minutes. Finally, Western blotting was used to detect EEF1B2 and EEF1A1.

[0063] 2. Experimental results

[0064] We chose cannabidiol (CBD) to verify its inhibitory effect on EEF1B2 function because we found that CBD treatment significantly reduced the generation of M-MDSCs ( Figure 3A, B). As the CBD concentration gradient increased, the expression of MDSCs immunosuppressive genes (such as Arg1, Nos2, Ptgs2, Tgfb, Il1b and Cd300ld) decreased in a dose-dependent manner ( Figure 3 C). In addition, in the co-culture experiment of T cells and bone marrow-derived MDSCs, CBD treatment significantly weakened the immunosuppressive function of MDSCs, and the activation and proliferation ability of T cells was significantly improved ( Figure 3 D).

[0065] EEF1B2 is a key factor in protein translation elongation and regulates protein translation and elongation together with EEF1A1. Figure 3 E). We also found that when bone marrow cells were stimulated to differentiate into MDSCs, the addition of CBD to the cells weakened the interaction between EEF1B1 and EEF1A1 ( Figure 3 F), and the activity level of protein translation marked by puromycin in MDSCs was also weakened ( Figure 3 G). In addition, incubation of differentiated bone marrow cells with CBD also reduced the amount of CEBPβ ​​protein in the induced MDSCs ( Figure 3 H), while overexpression of EEF1B2 in MDSCs counteracted the reduction of CEBPβ ​​protein caused by CBD treatment ( Figure 3 I). The above data indicate that CBD can act as an inhibitor of EEF1B2 and attenuate the generation and differentiation of MDSCs mediated by EEF1B2.

[0066] Example 4: EEF1B2 protein in MDSC cells is a direct binding target of CBD

[0067] 1. Experimental Methods

[0068] 1.1 TRAP method for screening CBD binding proteins

[0069] In the same way as the in vitro induction of bone marrow cells to differentiate into MDSCs, 3 dishes of bone marrow cells were seeded and cultured in RPMI 1640 medium containing GM-CSF and IL-6. After 2 days, the attached MDSC cells were treated with DMSO or CBD (5 or 10 μM) for 1 hour. The cells were then collected and washed, lysed using M-PER lysis buffer, and lysine residues in proteins were labeled with deuterated formaldehyde and borane-pyridine complex. Next, TRAP-labeled proteins were enzymatically digested and further labeled with tandem mass spectrometry tags (TMT) reagents. Proteins with significant changes in lysine accessibility were screened as CBD binding targets by LC–MS quantitative proteomics analysis. The accessibility changes were evaluated by the abundance ratio of TRAP-labeled peptides, and this ratio was closely related to the ligand binding affinity. The t-test was used to analyze whether the accessibility changes of the labeled peptides were statistically significant, and the p value (p<0.001) and TRAP ratio>2 or <0.5 were set as the criteria for screening CBD binding proteins.

[0070] 1.2 Cell thermal migration assay

[0071] 48 hours after HEK293T cells were transfected with pcDNA3.1-EEF1B2-EGFP plasmid, the cells were collected and resuspended in 800 μL PBS containing PMSF. After ultrasonic disruption, the cell suspension was centrifuged at 12000g for 10 minutes to obtain a cell lysate. The lysate was divided into 7 parts and placed in PCR tubes. Subsequently, it was incubated with CBD on ice for 30 minutes and then heated at different temperatures (60°C, 66°C, 72°C, 78°C, 84°C, 90°C, 96°C) for 5 minutes. The heated lysate was centrifuged at 20000g for 20 minutes, and the soluble protein in the supernatant was collected. The protein sample was mixed with the loading buffer, heated for 10 minutes, and then subjected to Western blot analysis, and the target protein was detected using EGFP antibody.

[0072] 1.3 Molecular docking simulation of the binding between CBD and EEF1B2

[0073] The guanine exchange factor (GEF) domain model of human EEF1B2 was obtained from the Protein Data Bank (PDB ID: 1B64), and the molecular structure of CBD was obtained from PubChem (compound CID: 644019). Molecular docking was performed using Autodock2 software, and the docking process was completed using default parameter settings.

[0074] 1.4 Microscale thermophoresis (MST) experiment

[0075] Monolith NT.115 (Nano Temper) was used to perform MST experiments to detect the interaction between CBD and EEF1B2. HEK293T cells were transfected with empty EGFP plasmid or EEF1B2-WT-EGFP (S6A-EGFP, D62V-EGFP) plasmid, and cells were collected after 48 hours of culture, ultrasonically disrupted and centrifuged (12000g, 10min) to obtain cell lysate. The fluorescence intensity of the empty plasmid and WT / S6A / D62V plasmid was adjusted to the same level in the range of 400-1000, and then the cell lysate was mixed with different concentrations of CBD in a 1:1 volume ratio. Finally, Monolith NT.115 was used for binding detection.

[0076] 2. Experimental results

[0077] In order to verify whether the inhibitory effect of CBD on MDSCs generation and differentiation is produced by directly acting on EEF1B2, we chose to use the TRAP method to find the target protein that binds to CBD in MDSCs cells ( Figure 4 A). We found that the lysine labeling efficiency of EEF1B2 was lower in the CBD-treated groups (5, 10 μM) compared with the control group, indicating that CBD binds more strongly to EEF1B2 ( Figure 4 B). Then, the cell thermal migration assay and micro-thermophoresis assay were used to verify the binding of EEF1B2 to CBD, with an affinity Kd of 613 nM ( Figure 4 C, D). In addition, according to the mass spectrometry results, the peptide segment that binds EEF1B2 to CBD is located in the functional GEF domain (guanine nucleotide exchange factor domain) of EEF1B2 ( Figure 4 E, F). We then used molecular docking simulation to calculate the binding of the two, and the calculation results showed that CBD formed a hydrogen bond with the GEF domain ASP62 of EEF1B2 and the SER6 site ( Figure 4 G). To verify these two binding sites, we constructed EEF1B2 with point mutations at the ASP62 and SER6 sites in the GEF domain, EEF1B2-D62V and S6A. We then used micro-thermophoresis experiments to verify the binding of EEF1B2 D62V and S6A to CBD ( Figure 4 H, I), it was found that the affinity of CBD to EEF1B2 D62V decreased to 3.14 μM, while the binding to EEF1B2 S6A was directly destroyed. Therefore, the direct binding of EEF1B2 to CBD enables CBD to inhibit EEF1B2-mediated MDSCs generation and differentiation and immunosuppressive formation.

[0078] Example 5: Effect of CBD on Apc Min / + Inhibitory effect on spontaneous colorectal adenomas in mice

[0079] 1. Experimental Methods

[0080] 1.1Apc Min / + Spontaneous colorectal adenoma model in mice

[0081] Apc Min / + After acclimation, the mice were randomly divided into two groups: Vehicle and CBD administration groups. The Vehicle group was intraperitoneally injected with 200 μL of solvent control daily, and the CBD administration group was intraperitoneally injected with 200 μL of CBD (10 mg / kg, intraperitoneally) daily. At the same time, the ordinary feed was replaced with a high-fat feed (60% fat), and the weight of the mice was monitored weekly.

[0082] 1.2 HE staining experiment

[0083] After the paraffin sections of tissue samples were dewaxed and hydrated, they were first stained with hematoxylin, and then the sections were placed in 1% hydrochloric acid alcohol for differentiation until the cell nuclei were clearly visible, then stained with eosin, and finally dehydrated and sealed with neutral resin.

[0084] 2. Experimental results

[0085] Since MDSCs are one of the main contributors to the immunosuppressive nature of the tumor microenvironment of colorectal adenomas, we then verified whether CBD inhibits the generation and differentiation of MDSCs and then inhibits the generation or development of colorectal adenomas. Min / + Spontaneous colorectal adenoma model in mice ( Figure 5 A). The mice were fed a high-fat diet for 3 consecutive months. At the end of the experiment, the colorectal tissues of the mice were collected. It was observed that the number of adenomas in the colorectal glands of the mice treated with CBD was significantly reduced ( Figure 5 B, C), the weight loss of mice slowed down ( Figure 5 D), spleen inflammation in mice was reduced ( Figure 5 E, F). In addition, CBD administration also alleviated the accumulation of fat in the liver of mice ( Figure 5 G, H), HE pathological staining results of mouse intestine also showed that the adenoma lesions in the intestinal wall were weakened ( Figure 5 I). The above shows that CBD can be used as an inhibitor of EEF1B2 and has a therapeutic effect on colorectal adenoma.

[0086] Example 6: Overexpression of EEF1B2 in vivo weakens the inhibitory effect of CBD on colorectal adenoma growth

[0087] 1. Experimental Methods

[0088] 1.1Apc Min / + Overexpression of EEF1B2 in a mouse model of spontaneous colorectal adenoma

[0089] Apc Min / + Mice (C57BL / 6 background strain) were fed a high-fat diet for three months to induce colorectal or small intestinal adenomas. To determine whether EEF1B2 overexpression in bone marrow-derived MDSCs could aggravate the development of colorectal adenomas, we performed an Apc Min / + Mice were injected with 50 μL (concentration 1.0E+12 v.g. / ml AAV) recombinant AAV2-EEF1B2 for in vivo overexpression of EEF1B2 in bone marrow cells. Adeno-associated virus expressing EEF1B2 or control AAV2 in bone marrow cells. During the modeling process, 200 μL CBD (10 mg / kg) or PBS was injected intraperitoneally every day.

[0090] 1.2 HE staining experiment

[0091] After the paraffin sections of tissue samples were dewaxed and hydrated, they were first stained with hematoxylin, and then the sections were placed in 1% hydrochloric acid alcohol for differentiation until the cell nuclei were clearly visible, then stained with eosin, and finally dehydrated and sealed with neutral resin.

[0092] 2. Experimental results

[0093] To further confirm that the therapeutic effect of CBD on colorectal adenoma is produced through EEF1B2, we constructed an Apc2 overexpressing EEF1B2 in bone marrow cells. Min / + Experiments on mice ( Figure 6 A). It was found that overexpression of EEF1B2 could inhibit the inhibitory effect of CBD on the development of colorectal adenomas. Colonoscopy showed that the adenomas in the intestines of mice that received CBD and overexpressed EEF1B2 were significantly enlarged ( Figure 6 B), mice that received CBD and overexpressed EEF1B2 also had the lightest body weight, indicating the most severe adenoma disease ( Figure 6 C). At the end of the experiment, the colorectal tissues of the mice were collected and dissected. It was found that the number of adenomas in the colorectal tissues of the mice that received CBD and overexpressed EEF1B2 increased significantly ( Figure 6 D), the adenoma lesions in the intestinal wall also worsen ( Figure 6 E), and the spleen weight increased significantly ( Figure 6 F). After overexpression of EEF1B2, the proportion of M-MDSCs subtype in colorectal adenomas increased significantly ( Figure 6 GH). The above data indicate that EEF1B2 promotes the formation of colorectal adenoma by promoting the differentiation of MDSCs. Overexpression of EEF1B2 can weaken the inhibitory effect of CBD on the development of colorectal adenoma. Therefore, it is shown that the therapeutic effect of CBD on colorectal adenoma is mediated by EEF1B2, and it also indicates that CBD can act as an inhibitor of EEF1B2 to treat colorectal adenoma.

[0094] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0095] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of EEF1B2 as a drug target or EEF1B2 itself in the preparation of anti-tumor immunosuppressive drugs.

2. EEF1B2 is used in the preparation of drugs to inhibit the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenomas.

3. Application of cannabidiol in the preparation of anti-tumor immunosuppressive drugs.

4. Cannabidiol is used as an EEF1B2 inhibitor in the preparation of drugs to inhibit the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenomas.

5. Use of shEEF1B2 in the preparation of anti-tumor immunosuppressive drugs, characterized in that: The nucleotide sequence of shEEF1B2 is GCACAGTATGAGTCCAAGAAA.

6. Use of shEEF1B2 in the preparation of a drug for inhibiting the immunosuppressive effect of MDSCs in the tumor microenvironment of colorectal cancer adenoma, characterized in that: The nucleotide sequence of shEEF1B2 is GCACAGTATGAGTCCAAGAAA.

Images