Soybean Metalaria thunbergii SC02, compound wettable powder and application of soybean Metalaria thunbergii SC02
By using soybean SC02 and its compound wettable powder, the problem of difficult to effectively prevent and eliminate a Canadian yellow flower in the prior art is solved, and efficient prevention and control of the weed is achieved and environmental pollution is reduced.
Patent Information
- Application Number
- CN202510452511.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-05-13
AI Technical Summary
The existing technology is difficult to effectively prevent and eliminate a yellow flower in Canada, and chemical prevention and control methods will lead to environmental pollution.
Using soybean SC02 and its compound wettable powder, the strain was screened and identified that the strain had a pathogenic effect on Canadian yelpsia but had no effect on other plants, and a compound wettable powder containing Tween 80, sodium lignin sulfonate, chlorofluoropyacetic acid, kaolin and SC02 strain spore liquid was prepared.
It has achieved effective pathogenic and prevention of a yellow flower in Canada, and has no effect on other surrounding plants, reducing the use of chemical herbicides and reducing environmental pollution.
Smart Images
Figure CN119979347A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of microbial control, and in particular to a Solanum gracile SC02, a compound wettable powder and applications thereof. Background Art
[0002] Canada goldenrod Solidago canadensis Lour is a species of Solidago spp. in the Asteraceae family. Solidago ) is a perennial herb, also known as yellow flower grass, yellow warbler, hundred-root grass or king flower, with lanceolate or linear lanceolate leaves. Canada goldenrod often forms a single dominant species community in the invaded area, affecting the connection between various functional groups in the ecosystem, destroying the structure and function of the ecosystem, threatening biodiversity, and seriously causing local extinction of local species. It is recognized as a highly invasive and malignant weed.
[0003] At present, chemical control is still an effective method to control invasive alien weeds, but the long-term and large-scale use of chemical agents will cause environmental pollution such as soil and air, and destroy the ecological balance. Biological control is efficient and non-toxic, harmless, pollution-free, and does not produce drug resistance. It is especially suitable for large-scale control of invasive alien organisms in natural ecology or uncultivated fields. Therefore, herbicide compounding has become a better solution in production practice, which can not only expand the weed control spectrum, but also reduce the amount and cost of drugs used, and achieve the purpose of effectively preventing and controlling resistant weeds. Therefore, it is very meaningful to find a biological control method that effectively prevents and / or eliminates Canada goldenrod. Summary of the invention
[0004] The purpose of the present invention is to provide a soybean spore fungus SC02 and a composite wettable powder thereof, which can be used in biological control, especially can be used for causing disease to Canada thistle without affecting other surrounding plant species.
[0005] In order to achieve the above object, the present invention provides a soybean spore fungus SC02, whose taxonomic name is Diaporthe sojae The soybean Aspergillus SC02 has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on February 14, 2025, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCCNO.41785. The soybean Aspergillus SC02 provided by the present invention can be used to prepare a biocontrol agent.
[0006] The Solanum glycines SC02 provided by the invention can be used for biological control of Canada thistle.
[0007] The present invention also provides a composite wettable powder prepared by Aspergillus sojae SC02.
[0008] Preferably, the above-mentioned compound wettable powder comprises: Tween 80, sodium lignin sulfonate, fulvic acid, 20% clofopyralid, kaolin, and SC02 strain spore liquid.
[0009] Preferably, the compound wettable powder comprises: 3% Tween 80, 1% sodium lignin sulfonate, 0.9% fulvic acid, 0.5 μL / mL 20% clofopyralid, 7% kaolin, 40% 1×10 9 cfu / mL SC02 strain spore liquid; the percentage values are all mass volume percentages.
[0010] The compound wettable powder provided by the present invention can be applied in the field of microbial control, including the control of resistant weeds, and can be particularly used for the control of the resistant weed Canadawort.
[0011] The present invention has the following advantages: The present invention screens and extracts microorganisms from diseased leaves and roots of Canada goldenrod, and finds a strain that has a pathogenic effect on Canada goldenrod. The strain is identified as Aspergillus japonicus SC02. It is verified that the strain has a significant pathogenic effect on Canada goldenrod, and has no effect on other plants around it. The strain can be used to control the impact of Canada goldenrod on the environment and improve the biological control effect.
[0012] The present invention also provides a composite wettable powder, wherein the spore liquid content of the fungus is 1×10 9 cfu / mL, and a compound wettable powder was prepared by combining the spore solution with a carrier, a wetting agent, a UV protectant, and a dispersant. The control effect of the compound wettable powder on Canada goldenrod at different dilution multiples was verified, and the results showed that the dilution showed a good control effect on Canada goldenrod. 50, 100, 200, 400, and 800 times dilutions and the chemical herbicide clofopyralid all have a strong control effect on Canada goldenrod, which can basically kill Canada goldenrod, and has potential application value in the biological control of Canada goldenrod. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 This is a plate map of the Aspergillus SC02 provided in the present invention, wherein A and B are pathogenic leaves and diseased roots screened by the strain, and C is the plate growth condition of the strain Aspergillus SC02.
[0014] Figure 2 The figures show the infection conditions of different hosts inoculated with the selected Aspergillus SC02 in the present invention, wherein A is inoculated with Cinnamomum camphora leaves; B is inoculated with Phoebe nanmu leaves; C is inoculated with Solidago canadensis leaves; and D is inoculated with Solidago canadensis roots.
[0015] Figure 3 The morphological identification results of the strain SC02 of the screened Aspergillus niger in the present invention are shown in Figure 1, wherein A is the front of the colony; B is the back of the colony; C is the spore-forming culture medium; D is the perithecia; E is the ascus; F is the α conidia; and G is the identification of the β conidia.
[0016] Figure 4 These are the results of ITS-TEF1-CAL-HIS PCR amplification of strain SC02, where A is the PCR electrophoresis result of the strain ITS sequence, and B is the PCR electrophoresis result of the strain TEF1-CAL-HIS gene. M stands for nucleic acid ladder, and lanes 1, 2, and 3 have three technical replicates, respectively.
[0017] Figure 5 This is the phylogenetic tree of strain SC02 constructed based on the ITS-TEF1-CAL-HIS gene sequences. DETAILED DESCRIPTION
[0018] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0019] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.
[0020] Experimental Example 1 Isolation and pathogenicity determination of pathogenic fungi 1. Isolation of pathogenic fungi Three plots were randomly selected from the area invaded by Solidago canadensis in Longquanyi District, Chengdu City, Sichuan Province. Several diseased plants of Solidago canadensis were randomly selected from the plots. The diseased plants were placed in sealed bags with water and roots. After returning to the laboratory, they were transplanted into pots. At the same time, some diseased leaves and roots were collected and brought back to the laboratory (see Figure 1 (A and B in the figure) Rinse the diseased leaves and roots of Canada goldenrod with tap water and soak for 15 to 30 minutes. Use dissecting scissors to cut off about 5 mm of the junction between the leaf with obvious lesions and the diseased and healthy root. 2A small piece of diseased tissue was first immersed in 75% alcohol for 30 seconds and sodium hypochlorite containing 3.5% effective chlorine for 15 seconds, then immersed in 75% alcohol for 15 seconds, then rinsed with sterile water three times, and finally clamped with sterilized tweezers to a PDA plate and cultured at 27°C for 3 days. After the colony grew, the uncontaminated hyphae around the diseased tissue were picked with an inoculation loop and transferred to a new PDA plate for culture, and further single spores were picked for culture until purification. After purification, a total of 10 fungal strains were obtained, which were divided into 7 strains by morphological identification, namely SC01-07 in Table 1, among which SC02 had the highest isolation rate of 30%, and the growth diagram of SC02 on the plate is shown in Figure 1 As shown in C.
[0021] Table 1 Isolation results of pathogenic bacteria
[0022] When storing, cut a bacterial cake with a diameter of about 5 mm along the edge of the colony and place it in the prepared PDA slant culture medium and store it at 4°C for later use.
[0023] 2. Determination of host specificity and pathogenicity of pathogens Because it is necessary to ensure that the pathogen is only pathogenic to Canada goldenrod during the prevention and control process, representative plants in the area invaded by Canada goldenrod should be given priority when determining specificity. Therefore, after the isolated strains were cultured on PDA medium for 5 days, a mycelium block with a diameter of 7 mm was taken from the edge of the colony and inoculated into the selected potted Canada goldenrod, Phoebe nanmu, and Cinnamomum camphora plants with good growth. One seedling was planted in each pot, and each seedling was 4 (4 pots), that is, 4 replicates, and a control was set up for live determination. During inoculation, use a medical needle to gently poke the leaves on healthy young leaves. The size and shape of the circular holes formed by the combination of the punctures should be similar to the mushroom cake. At the same time, the mycelium block is placed upside down on the healthy young leaves of the plant, wrapped with wet gauze and then wrapped with plastic wrap on the outer layer to keep it moist. Each bacteria is repeated at least 3 times, and a control is set to observe the infection of the isolated pathogens on the host and whether it infects the non-host. At the same time, after the plant shows obvious disease symptoms, the sample is separated and purified for a second time to observe whether it is consistent with the culture characteristics of the original strain. The 0-5 level method is used for disease assessment, and the disease index is calculated by the number of cases at each disease level. Among them, the grading standard of the disease index of Canada goldenrod is shown in Table 2, and the grading standard of the disease index of branches and leaves of non-host plants is shown in Table 3.
[0024] Table 2 Disease index grading standard of Solidago canadensis
[0025] Table 3 Classification standard of disease index of branches and leaves of non-host plants
[0026] Table 4 Pathogenicity of the screened strains to Solidago canadensis and its non-host plants
[0027] Note: 0~5 are representative values of disease severity.
[0028] The pathogenicity of each strain to Canada goldenrod and its non-host plants after classification is shown in Table 4. It can be seen from Table 4 that only the SC02 strain can control Canada goldenrod while having no or almost no effect on its surrounding non-host plants. At the same time, the specificity and pathogenicity of the SC02 strain were determined, and the results are shown in Figure 2 As shown, it can be seen that after the SC02 strain-inoculated plants showed obvious disease symptoms, the samples were separated and purified for a second time, and it was observed that they were consistent with the culture characteristics of the original strain.
[0029] In summary, SC02 was selected for further molecular biological identification and functional studies.
[0030] Experimental Example 2 Identification of strains 1. Morphological identification The strain was inoculated into PDA medium and cultured in the dark at 28°C. After 6 days, the PDA medium was covered with the colonies. The front of the colonies was white ( Figure 3 A in the figure), with a small amount of turmeric pigment deposited on the back, dense hyphae, and well-developed aerial hyphae ( Figure 3 B in the figure): Sporulation begins around day 12, hyphae decrease, and sporulation reaches its maximum on day 16-20 ( Figure 3 C in the figure). Sexual characteristics: Ascocarp is black, spherical or nearly spherical, clustered, buried in the matrix, with papillary protrusions extending out of the matrix, the protrusion (beak) is 728.2 μm~2278.3 μm long; ascocarp diameter is 261.5 μm~303.2 μm ( Figure 3 D in the figure). The ascus has a single wall, is sessile and club-shaped, contains 8 ascospores, and has a distinct apical ring at the top. The ascus size is (60.18~72.97)×(12.25~16.61)μm. The ascospores are transparent, overlapping and single-row, oval or fusiform, and the ascospore size is (9.02~12.66)×(3.23~4.54)μm ( Figure 3 E in the figure). Asexual conidia: α conidia are 5.4~7.0×2.0~3.1 μm in size, unicellular, spindle-shaped to elliptical, blunt at one end and pointed at the other, colorless, without septa, and with 2 or more oil globules ( Figure 3 F in Figure 1). β-conidia are 17.7~23.5×1.3~1.8 μm in size, unicellular, hooked or curved, with a truncated base, colorless, and without septa ( Figure 3Based on the above morphological characteristics, the pathogen was preliminarily identified as the genus Metaschisome ( Diaporthe ).
[0031] 2. Molecular Biology Identification The DNA of SC02 was extracted, and the 4 gene sequences of ITS, EF-1α, CAL, and HIS were PCR amplified and sequenced, as shown in Table 5. The 4 sequences obtained, whose nucleotide sequences are shown in SEQ ID NO.9, 10, 11, and 12, were compared by BLAST in NCBI, and the sequences of other related strains used for identification were downloaded from GenBank, and the phylogenetic tree was constructed using the 4 gene sequences. The PCR amplification results of strain SC02 based on ITS-EF-1α-CAL-HIS were obtained as shown in Table 5. Figure 4 The phylogenetic tree constructed based on the ITS-EF-1α-CAL-HIS gene sequences is shown in Figure 5 As shown in the figure, it can be seen that the pathogen is similar to Soybean Aspergillus ( D . sojae ) were clustered into one category, with the most significant genetic homology, and the support rate reached 100%. Therefore, based on morphological and molecular identification, the isolated pathogen SC02 was identified as Soybean Sphaerotheca ( Diaporthe sojae ), the strain was deposited in the China Center for Microbiological Culture Collection on February 14, 2025, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.41785.
[0032] Table 5 PCR amplification reaction system and conditions for target gene sequence of SC02 strain
[0033] ITS sequence (SEQ ID NO.9): accagaaaccctttgtgaacttatacctattgttgcctcggcgtaggccggcctcttcactgaggccccctggaaacagggagcagcccgccggcggccaaccaaactcttgtttctacagtgaatctctgagtaaaaaacataaatgaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctctggtattccggagggcatgcctgttcgagcgtcatttcaaccctcaagcctggcttggtgatggggcactgctttcgtccagaaagcaggccctgaaatctagtggcgagctcgccaggaccccgagcgtagtagttatatctcgctctggaaggccctggcggtgccctgccgttaaacccccaacttctgaaaatttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaataagcggaggaa; EF-1α sequence (SEQ ID NO.10): gagaaggaaggttagtaaacatcgcccaacgggcaccttgacctccacatcaccccatacgcacagaactcgttggcgcgcgctgcctgcgaggcttcgtcacacctgtcaaggcattttcacccctccctctggattttccattttcagtgcgggtgcggggtgcgcttatcaggccgcttatctctcacaccaaaaccctgtcgcaccttacctctcttccaccagtgacgcaccaacagtatcaccttcattcccatctgttgctcgtgggagcttttcgacttgcttgaaaatgatgctgactctttctgaacagccgccgagctgggtaagggttccttcaag; CAL sequence (SEQ ID NO.11): tgcaggataaggatggcgatggttagtgcagtcaccgcttcctcccctctttcccggctacgtacgcgtcatgctcgatccgccgcgacggtctgcgcctgcagtctactccgagcgaccgatcatcaaatctatcacgagtggtatgctaaggctggcatgtaggacaaatcaccaccaaggagctcggcacagtcatgcggtcgcttggtcaaaacccttccgagtccgagctgcaggacatgatcaacgaggtcgacgccgacaacaatggcaccattgacttccctggtaagtctcaactgtcacaccggggattgggcggtggcggggtatgcgccggtgctggtgcttgtcctgtgccgcatccgggttgcgatatactgacgcgttccacgcagagttcctgaccatgatggccagaag; HIS sequence (SEQ ID NO.12): gctccccgcaagcagctcgcctccaaggctgcccgcaagtccgcgccctccaccggaggtgtcaagaagcctcaccgctacaagcctggtaccgtcgctctgcgtgagatccgtcgctaccagaagagcaccgagctgctgatccgcaagctccccttccagcgtctggtatgttttcacacccacccaaatcaatcaacttcaccctcgtttaccctgctgaccgtcgcctcttcctccccaggtccgtgagatcgcccaggacttcaagtccgacctgcgcttccagtcttccgccatcggtgctctccaggagtccgtcgagtcttacctcgtgtccctcttcgaggacaccaacctgtgcgccatccacgccaagcgtgtcaccatccagtcggtacgtcacattccctcctgacccacagacctcacgtctgccttgagacacgca。
[0034] Experimental Example 3 Preparation of the wettable powder compound of Diaporthe sojae SC02 1. Screening of chemical single agents in compound herbicides The experimental materials selected 7 chemical herbicides: 20% clofopyralid; 25% cyclazinone SL; 41% glyphosate isopropyl ammonium salt; 48% triclopyr butoxyethyl ester EC; 20% glufosinate AS; 24% chlorfenapyr; 20% dimethyl tetrachloride aqueous solution. A single-dose control test was conducted using a pot experiment. A total of 8 treatments were set up in the experiment. In addition to the above 7 chemical herbicides, a group of clear water controls was added, and 10 plants were treated in each group. Foliar spraying was carried out when the height of Canada goldenrod was 40-50 cm, and 100mL of the reagent was used to spray the stems and leaves of each plant. After the drug was applied, the symptoms of poisoning and death of the plants were observed regularly, and the degree of leaf or root death was recorded.
[0035] At the same time, compatibility tests were conducted on seven chemical herbicides and pathogens to analyze the effects of herbicides on the mycelial growth, spore germination rate and spore production of the strains. The results are recorded in Table 6.
[0036] Table 6 Chemical herbicide screening results
[0037] Note: (1) The recommended concentration in the table is the officially recommended dilution concentration when purchasing pesticides, and the optimum concentration is the optimal growth concentration of pathogens after dilution of the recommended concentration: (2) "—" in the table means no mycelium growth, spore germination rate and spore production are 0, the same below; (3) Different lowercase letters in the same column in the table indicate significant differences between different treatments at the same time (P<0.05). The same below.
[0038] In the single-dose test, all seven chemical herbicides could kill Canada goldenrod, among which 20% clofopyralid, 20% dimethoate aqueous solution, 41% glyphosate isopropylammonium salt, 24% chlorpyrifos, and 20% dimethoate aqueous solution were the most effective.
[0039] At the same time, seven chemical herbicides were added to PDA culture medium at recommended concentrations to make plates, and the strain was inoculated. It was found that it could grow on 20% clofopyralid, 25% cyclazinone SL, 41% glyphosate isopropylammonium salt, and 24% cypermethrin.
[0040] However, in the subsequent optimal concentration screening, the strain growth was too poor in the 25% cyclohexanone SL treatment, and the dilution multiple was too high when 41% glyphosate isopropylammonium salt and 24% chlorpyrifos reached the optimal concentration, resulting in a serious decline in efficacy. Only 20% clofopyralid with a recommended concentration of 1 μL / mL and an optimal concentration of 0.5 μL / mL had both efficacy and compatibility. Based on the effects of herbicides on mycelial growth, spore production and spore germination of pathogens in Table 6, 0.5 μL / mL 20% clofopyralid was determined to be the most suitable compound chemical herbicide in the compatibility test.
[0041] 2. Development of wettable powder (1) Preparation of spore suspension After the isolated strains were cultured on PDA medium for 5 days, a mycelium block with a diameter of 3 mm was obtained at the edge of the colony. In a sterile environment, the pathogenic bacteria were inoculated into PDA solid medium and cultured in an incubator at a temperature of 25±1°C and a light intensity of L:D=14h:10h for 20 days until the pathogenic bacteria strain produced a large number of spores. The spores were scraped off in a sterile clean bench, 10 mL of sterile water was added, and the mixture was fully shaken with an oscillator. The content of the spore solution was fixed to 1×10 9 cfu / mL, and then store the spore solution in a 4 ℃ refrigerator.
[0042] (2) Carriers and additives The carriers kaolin, diatomaceous earth, bentonite and silica gel were added into the solid culture medium PDA at a mass volume ratio of 7%, and then sterilized to prepare plates with different treatments.
[0043] Wetting agents Tween 20, Tween 80, and polyethylene glycol 2000 were added to PDA culture medium at a mass volume ratio of 3%, respectively, and plates with different treatments were prepared after sterilization.
[0044] Dispersants sodium lignin sulfonate, calcium lignin sulfonate and sodium methylene bis(methyl)naphthalene sulfonate were added to the solid culture medium PDA at a mass volume ratio of 3%, and plates with different treatments were prepared after sterilization.
[0045] In this test preparation, the original drug is composed of the conidia of pathogenic fungi. It is sensitive to ultraviolet rays. When the preparation is applied to crops, the strong light in the field will affect the activity of the spores, which not only wastes the drug, but also requires frequent application and wastes labor. Therefore, a strong ultraviolet protective agent is added to prolong the action time of the drug. The protective agents sodium alginate, dextrin, and fulvic acid are added to the solid culture medium PDA at a mass volume ratio of 0.5%, respectively, and after sterilization, plates with different treatments are made. Set up control experiments CK1: UV irradiation without adding ultraviolet protective agent, CK2: no UV irradiation without adding ultraviolet protective agent.
[0046] (3) Effects of different carriers and adjuvants on the growth of Soybean Sc02 6mm culture cakes were inoculated on the above-prepared culture medium and cultured in a constant temperature incubator at 28°C until the strain covered the control culture medium. The colony size was measured by the cross method. Five replicates were set for each treatment, and then the plates were waited for spore production. Finally, the average colony diameter and spore production were used as the main factors to determine the best carrier, wetting agent, dispersant and protective agent. The results are shown in Table 7. According to the spore production and the colony diameter of the pathogen, kaolin was finally selected as the carrier (with better suspension effect), Tween 80 as the wetting agent, fulvic acid as the UV protective agent, and sodium lignin sulfonate as the dispersant.
[0047] Table 7 Screening results of wettable powder carriers, wetting agents, dispersants, and UV protectants
[0048] On the basis of the single factor test, the only three factors of wetting agent (1%~5%), dispersant (1%~5%) and ultraviolet protective agent (0.5%~0.9%) were determined as independent variables. At the same time, the optimal concentration of herbicide that had been screened was mixed in. The colony diameter and spore production were used as evaluation indicators. A three-factor three-level experimental design was designed, and the optimal dosage ratio of wetting agent 3%, dispersant 1% and ultraviolet protective agent 0.9% was determined, as shown in Table 8.
[0049] Table 8 Screening results of the best ratio of three additives
[0050] 3. Preparation of Soybean Sphaerotheca SC02 Wettable Powder Compound (1) Inoculate SC02 into PDA medium and culture in an incubator at 25 ± 1 °C and light intensity L:D = 14 h:10 h for 20 days until the pathogenic bacteria produce a large number of spores. Scrape the spores in a sterile clean bench, add sterile water, and oscillate thoroughly with an oscillator to mix evenly. Then adjust the volume of the spore solution to 1 × 10 9 cfu / mL and prepared a spore suspension.
[0051] (2) 3% Tween 80, 1% sodium lignin sulfonate, 0.9% fulvic acid, 7% kaolin, and 40% SC02 spore solution (1×10 9 cfu / mL), and the remaining mass was made up with pure water, where the percentages are all mass volume fractions. 0.5 μL / mL of 20% clofopyralid was added according to the total amount of liquid after making up, and the above mixture was stirred to fully dissolve to form a mixed solution, which was then dried in an oven at 30°C (exceeding 35°C will cause the death of some pathogens) until the change in the sample weight is small.
[0052] (3) After drying, remove the solid preparation and grind it thoroughly in a high-speed universal grinder to make a compound wettable powder, which is then placed in a dry and ventilated environment for storage.
[0053] 4. Quality testing of soybean SC02 wettable powder compound
[0054] The test results are shown in Table 9. The live spore content of the preparation is 1.65×10 9cfu / g, wetting time is 36.0s (<120s), suspension rate is 74% (>70%), pH is 6.5, fineness is 92% (≥90%), foaming property is 7mL (≤10mL), drying loss is 5.65% (≤6%), storage stability is ≥81.5% (≥80%), and all its indicators are higher than the relevant national standards (NY / T2293.1-2012).
[0055] Table 9 Quality test results of soybean SC02 wettable powder compound
[0056] In summary, a composite wettable powder of Solanum sphaerocephalum SC02 was obtained, which contained 40% SC02 spore liquid (1×10 9 cfu / mL), wetting agent 3%, dispersant 1%, UV protectant 0.9%, carrier 7%, 0.5μL / mL 20% clofopyralid, wherein the carrier is kaolin, the wetting agent is Tween 80, the UV protectant is fulvic acid, and the dispersant is sodium lignin sulfonate, and the percentages are all mass volume fractions.
[0057] Experimental Example 4 Practical application verification of compound wettable powder 1. Verification of compound wettable powder application in potted plants The potted control experiment was conducted in the greenhouse of Sichuan Agricultural University, with a temperature of 25-28℃ and a relative humidity of 70%-80%. 100 potted plants of Canada goldenrod with basically uniform growth, good growth, a height of 15cm-20cm, and 15 to 20 leaves were selected.
[0058] The prepared wettable powder was used, and a total of 8 treatment groups were set up, in which the wettable powder was diluted to 50 times, 100 times, 200 times, 400 times, 800 times, 1200 times, 1600 times, and 2000 times, respectively, for a total of 8 test groups; sterile water treatment was set as CK1, and the chemical herbicide clofopyralid was set as CK2. 100 healthy Canada goldenrod plants were selected, and 10 Canada goldenrod plants were selected from each test group. Each plant was sprayed with 100mL of the agent on the stems and leaves. The incidence rate, disease index, and control effect were calculated 20 days after application. The calculation formula is as follows:
[0059] Leaf (root) death rate = (number of dead leaves (roots) / total number of leaves (roots)) × 100%; Fresh weight protection effect = (control fresh weight - application fresh weight) / control fresh weight × 100%; Plant control efficiency (%) = [1-(number of weeds in the control area before treatment × number of weeds in the treatment area after treatment) / (number of weeds in the control area × number of weeds in the treatment area)] ×100.
[0060] Table 10 The potted control effect of the combination of soybean sphaerocephala SC02 wettable powder
[0061] As shown in Table 10, the control effect of the SC02 wettable powder compound of Soybean ...
[0062] 2. Field application verification of compound wettable powder The test site was selected in the flat Longquan Mountain area invaded by Canada goldenrod. The test set up 8 treatments, which were divided into 50 times, 100 times, 200 times, 400 times, 800 times, 1200 times, 1600 times, and 2000 times according to the different dosages per square meter. In addition, a herbicide clofopyralid (CK2) and clean water (CK1) were added as controls. Each treatment was repeated 3 times, with a total of 30 plots, each with an area of 30 m 2 , each plot is randomly arranged.
[0063] Before applying pesticides, investigate the number of Canada solidago asiatica using the double diagonal method, with 5 fixed survey points in each plot, 3 m 2 The dosage of each point was 300 mL. The number, plant height and fresh weight of Canada solidago were investigated 20 days after application, and the plant protection effect and fresh weight protection effect were calculated respectively.
[0064] Plant control effect (%) = [1-(number of weeds in the control area before treatment × number of weeds in the treatment area after treatment) / (number of weeds in the control area × number of weeds in the treatment area)] × 100; Fresh weight control effect (%) = [(fresh weight of weeds in blank control area minus fresh weight of weeds in treatment area) / fresh weight of weeds in blank control area] × 100.
[0065] Table 11 Field control effect of soybean spore fungus SC02 wettable powder compound
[0066] As shown in Table 11, the control of Canada goldenrod after spraying at different dilutions under natural conditions was recorded. The results showed that the chemical herbicide clofopyralid and the compound agent diluted 50, 100, 200, 400, and 800 times had a good control effect on Canada goldenrod, which began to decline at 1200 times dilution, and showed a trend of sharp decline at 1600 and 2000 times dilutions, with poor plant control effect and fresh weight control effect. Therefore, in practice, the concentration between 800 times and 1200 times is the economic concentration. If the control effect is to be enhanced, the concentration of 800 times or more can be selected. In general, the soybean SC02 strain and the prepared wettable powder compound agent have strong control effect on Canada goldenrod, strong environmental suitability and good affinity, reduce the use of chemical herbicides, reduce environmental pollution, and are suitable for commercial production, with broad market prospects.
[0067] In summary, the present invention provides a soybean spore fungus SC02 and a compound wettable powder, wherein the compound wettable powder comprises: 3% Tween 80, 1% sodium lignin sulfonate, 0.9% fulvic acid, 0.5 μL / mL 20% clofopyralid, 7% kaolin, 40% SC02 strain spores (1×10 9 cfu / mL), it has been verified that the strain provided by the present invention has a significant pathogenic effect on Canada thistle, and the prepared compound wettable powder thereof also has a significant application effect in the actual application of Canada thistle, and has no effect on other surrounding species. The strain and its compound wettable powder have significant application prospects in the field of microbial control, especially in the biological control of Canada thistle.
[0068] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.
Claims
1. A soybean phytosporum Diaporthe sojae ) SC02, characterized in that, The soybean Aspergillus SC02 was deposited in the China Center for Microbiological Culture Collection on February 14, 2025. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.41785.
2. Use of the soybean spore fungus SC02 as claimed in claim 1 in the preparation of a biocontrol agent.
3. Use of the soybean spore fungus SC02 as claimed in claim 1 in biological control of Canada thistle.
4. The composite wettable powder prepared by Aspergillus spp. SC02 according to claim 1.
5. The composite wettable powder according to claim 4, characterized in that: The compound wettable powder comprises: Tween 80, sodium lignin sulfonate, fulvic acid, 20% clofopyralid, kaolin, and SC02 strain spore liquid.
6. The composite wettable powder according to claim 5, characterized in that: The compound wettable powder comprises: 3% Tween 80, 1% sodium lignin sulfonate, 0.9% fulvic acid, 0.5 μL / mL 20% clofopyralid, 7% kaolin, 40% 1×10 9 cfu / mL SC02 strain spore liquid; the percentage values are all mass volume percentages.
7. Use of the compound wettable powder according to any one of claims 4 to 6 in the field of microbial control.
8. The use according to claim 7, characterized in that: The use described includes the control of resistant weeds.
9. The use according to claim 8, characterized in that: The resistant weeds include Canada thistle.