Yarrowia lipolytica engineering bacterium for producing retinol, retinyl ester and derivatives of retinol and retinyl ester as well as fermentation method and application of Yarrowia lipolytica engineering bacterium

Abstract

The invention belongs to the technical field of microorganisms and fermentation engineering, and particularly relates to Yarrowia lipolytica engineering bacteria for producing retinol, retinyl ester and derivatives thereof as well as a fermentation method and application of the Yarrowia lipolytica engineering bacteria. Specifically, firstly, yarrowia lipolytica is modified, beta-carotene 15, 15 '-oxygenase and retinol dehydrogenase from different host sources are screened, the copy number of key genes in a metabolic pathway is adjusted, the metabolic flux of a precursor is enhanced, the yield of retinol is increased, and meanwhile, the yield of retinol is increased by optimizing culture conditions. Therefore, the content of retinol is increased, and direct biosynthesis of retinol palmitate is finally realized by adjusting a carbon source and introducing retinol binding protein. In a word, a yarrowia lipolytica platform for efficiently synthesizing the retinol and the retinol ester is designed, and a foundation is laid for sustainable industrial production of the retinol and the retinol ester, so that the yarrowia lipolytica has excellent practical application value and application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and fermentation engineering, and specifically relates to an engineering strain of Yarrowia lipolytica for producing retinol, retinyl esters and derivatives thereof, and a fermentation method and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Vitamin A (retinoids) is an essential fat-soluble vitamin for the human body, including retinol and its active derivatives such as retinol, retinal, retinoic acid and retinyl esters. It plays a very important role in human growth and health, such as in embryonic development, vision, learning and memory, immune system, reproduction and skin function, and is widely used in food and beverages, medicines, dietary supplements, animal feed and skin care. In the human body, vitamin A mainly exists in the form of long-chain fatty acid esters of retinol. Retinyl esters are the storage form of retinol and are more stable, less irritating and better tolerated than retinol and retinoic acid under ultraviolet light. Therefore, they are regarded as a substitute for retinol and are widely used in medicines and cosmetics. At present, retinyl palmitate, retinyl acetate and retinyl propionate are the main forms used in cosmetics and dermatological skin care treatments, and retinyl esters of other chain lengths have similar properties.

[0004] Currently, vitamin A products on the commercial market are mainly produced by Roche or BASF through chemical synthesis, with β-ionone as an important precursor. The process requires toxic raw materials such as phosgene and prenylaldehyde, prenol and acetone, and undergoes multi-step catalysis in the presence of acetylene, strong acid, HCl gas, etc. It requires high pressure and high heat, and has extremely high requirements for equipment. Microbial synthesis is an environmentally friendly and sustainable way, providing an ideal alternative route for retinoid production. It is very feasible to produce retinyl esters at high levels in microorganisms. The direct biosynthesis of retinyl esters can avoid the further step of converting retinol into retinyl esters, thereby shortening the processing time and providing an efficient and sustainable method for the biological production of retinoids. Yarrowia lipolytica, as a generally considered safe microorganism, has been widely used in the synthesis of natural products, but its application in the synthesis and production of retinol and its derivatives is still rarely reported. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered strain of Yarrowia lipolytica for producing retinol, retinyl esters and their derivatives, as well as a fermentation method and application thereof. Specifically, the present invention first transforms Yarrowia lipolytica, and increases the yield of retinol by screening β-carotene 15,15'-oxygenase and retinol dehydrogenase from different host sources, adjusting the copy number of key genes in the metabolic pathway and strengthening the metabolic flux of precursors, while optimizing the culture conditions to increase the content of retinyl esters, and finally achieving direct biosynthesis of retinol palmitate by adjusting the carbon source and introducing retinol binding protein. Based on the above research results, the present invention is completed.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] The first aspect of the present invention provides an engineered strain of Yarrowia lipolytica for producing retinol, retinyl esters and derivatives thereof, wherein the engineered strain of Yarrowia lipolytica expresses at least β-carotene 15,15'-oxygenase and retinol dehydrogenase;

[0008] Wherein, the β-carotene 15,15'-oxygenase is derived from the uncultured marine bacterium (the uncultured marine bacterium 66A03), and its encoding gene is BLH (GenBank: AAY68319.1); further preferably, the encoding gene BLH is codon optimized, and the nucleotide sequence of the optimized BLH is shown in SEQ ID NO: 5. The retinol dehydrogenase is derived from Homo sapiens, and its encoding gene is RDH12 (GenBank: NP_689656.2); further preferably, the encoding gene RDH12 is codon optimized, and the nucleotide sequence of the optimized RDH12 is shown in SEQ ID NO: 6.

[0009] In the present invention, the starting strain Yarrowia lipolytica can specifically be Yarrowia lipolytica T3GI12VC-ΔCLA4 / MHY1, whose genotype is MatA, leu2-270, ura3-302, xpr2-322, axp-2, trp1::FBAp-GGS1 / EXPp-CarRP / TEFp-CarB, TEFp-AtoB / GPDp-HMGS / FBAp-HMGR / EXPp-ERG12, FBAp-ERG20 / EXPp-IDI / TEFp-ERG19 / GPDp-ERG8, hyg / GPDp-IDI / TEFp-ERG12 / GPDp-GPS, leu2 / EXPp-VHb / GPDp-ERG8 / TEFp-ERG19, ura3 / GPDp-CarRP / TEFp-GGS1, ΔMHY1, ΔCLA4. This strain has been published in the paper "Morphological and Metabolic Engineering of Yarrowia lipolytica to Increase β-Carotene Production" (ACS Synth. Biol. 2021, 10, 3551-3560.).

[0010] To further strengthen the upstream pathway, the Yarrowia lipolytica engineered bacteria of the present invention further express one or more of acetyl-CoA acetyltransferase, NADH-dependent HMG-CoA reductase, HMG-CoA synthetase, and mevalonate kinase. Preferably, a combination of acetyl-CoA acetyltransferase, NADH-dependent HMG-CoA reductase, HMG-CoA synthetase, and mevalonate kinase is expressed.

[0011] Wherein, the acetyl-CoA acetyltransferase is derived from Escherichia coli, and the encoding gene of the acetyl-CoA acetyltransferase is AtoB (GenBank: b2224); further preferably, the encoding gene AtoB is codon optimized, and the optimized nucleotide sequence of AtoB is shown in SEQ ID NO: 1.

[0012] The NADH-dependent HMG-CoA reductase is derived from Bordetella petrii, and the encoding gene of the NADH-dependent HMG-CoA reductase is HMGR (GenBank: Bpet3342). Further preferably, the encoding gene HMGR is codon optimized, and the nucleotide sequence of the optimized HMGR is shown in SEQ ID NO: 2.

[0013] The HMG-CoA synthetase is derived from Yarrowia lipolytica, and the gene encoding the HMG-CoA synthetase is HMGS (GenBank: YALI0_F30481g).

[0014] The mevalonate kinase is derived from Yarrowia lipolytica, and the gene encoding the mevalonate kinase is ERG12 (GenBank: YALI0_B16038g).

[0015] To further balance the metabolic intensity of the upstream pathway, the engineered Yarrowia lipolytica of the present invention further expresses any one or both of GGPP synthase and phytoene synthase / lycopene cyclase; preferably, the above two enzymes are expressed.

[0016] The GGPP synthase is derived from Haematococcus pluvialis, and its encoding gene is HpGGPPs (GenBank: KP759940.1). Further preferably, the encoding gene HpGGPPs is codon optimized, and the nucleotide sequence of the optimized HpGGPPs is shown in SEQ ID NO:4.

[0017] The phytoene synthase / lycopene cyclase is derived from Rhizomucor circinelloides, and its encoding gene is CarRP (GenBank: AJ250827.1); further preferably, the encoding gene CarRP is codon optimized, and the nucleotide sequence of the optimized CarRP is shown in SEQ ID NO: 3.

[0018] To further improve the synthesis of retinyl esters, the Yarrowia lipolytica engineered bacteria of the present invention further express at least one of diacylglycerol acyltransferase 1, diacylglycerol acyltransferase 2, lecithin retinol acyltransferase and retinol binding protein 1.

[0019] Among them, the diacylglycerol acyltransferase 1 is derived from Yarrowia lipolytica, the diacylglycerol acyltransferase 1 is DGA1 (GenBank: YALI0_E32769g), and the diacylglycerol acyltransferase 2 is derived from Yarrowia lipolytica, and the diacylglycerol acyltransferase 2 is DGA2 (GenBank: YALI0_D07986g).

[0020] The lecithin retinol acyltransferase can be derived from Homo sapiens or Rattus norvegicus, and correspondingly, its encoding gene can be HsLRAT (GenBank: AF071510) or RnLRAT (GenBank: AF255060); further preferably, the encoding gene HsLRAT or RnLRAT is codon optimized, and the optimized nucleotide sequences of HsLRAT and RnLRAT are shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0021] The retinol binding protein 1 is derived from Homo sapiens, and its encoding gene is RBP1 (GenBank: M11433). Further preferably, the encoding gene RBP1 is codon optimized, and the optimized nucleotide sequence of RBP1 is shown in SEQ ID NO:9.

[0022] In another specific embodiment of the present invention, a strain of Yarrowia lipolytica VA15 is provided. The strain has been deposited in the China Center for Type Culture Collection (CCTCC) on December 16, 2024, at Wuhan University, Wuhan, China, and its biological deposit number is: CCTCC NO: M 20242815.

[0023] The second aspect of the present invention provides the use of the above-mentioned Yarrowia lipolytica engineered bacteria in the preparation and production of retinol, retinyl esters and their derivatives.

[0024] The derivatives include retinol, retinal, retinoic acid and / or retinyl esters.

[0025] The third aspect of the present invention provides a method for industrial production of retinol, retinyl esters and derivatives thereof, the method comprising: fermenting and culturing the above-mentioned Yarrowia lipolytica engineered bacteria, and separating and purifying to obtain the retinol and derivatives thereof.

[0026] The retinol and its derivatives include retinol, retinal, retinoic acid and / or retinyl esters.

[0027] The method includes a control strategy for fermentation culture to change the ratio of the products retinol and retinyl esters and their derivatives;

[0028] Specifically, the fermentation culture can be carried out by batch feeding fermentation culture. Further, a nitrogen-rich culture medium (80% glucose, 8% peptone, 4% yeast extract, 1.5 mM Zn 2+, 2% BHT and 20% dodecane) for fed-batch fermentation, the fermentation product of the engineered bacteria was mainly retinol; when nitrogen-limited medium (80% glucose, 1.5 mM Zn 2 + , 2% BHT and 20% dodecane), when fed-batch fermentation was carried out, the fermentation products of the engineered bacteria were mainly retinyl esters.

[0029] Furthermore, in the fermentation culture, the oil carbon source includes but is not limited to oleic acid, palmitic acid, palm oil, peanut oil, olive oil and rapeseed oil, among which palmitic acid is preferred.

[0030] Beneficial technical effects of one or more of the above technical solutions:

[0031] The above technical scheme produces retinol by transforming Yarrowia lipolytica. Specifically, the above technical scheme increases the yield of retinol by screening β-carotene 15,15'-oxygenase and retinol dehydrogenase from different host sources, adjusting the copy number of key genes in the metabolic pathway and strengthening the metabolic flux of precursors. Combined with the optimization of culture conditions, the engineered strain produced 5.89g / L retinol in fed-batch fermentation. When the culture conditions were changed from nitrogen-rich to nitrogen-limited, the engineered strain switched from producing retinol to producing retinyl esters, and the yield of retinyl esters reached 8.18g / L. This is the highest yield reported so far for microbial production of retinol and retinyl esters. Subsequently, the direct biosynthesis of retinol palmitate was achieved by adjusting the carbon source and introducing retinol-binding protein, ultimately producing 4.53g / L retinol palmitate.

[0032] In summary, the above technical scheme designs a Yarrowia lipolytica platform for the efficient synthesis of retinyl esters, laying the foundation for the sustainable industrial production of retinyl esters. Therefore, the above technical scheme has excellent practical application value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0034] Figure 1 Schematic diagram of the plasmid used in Example 1.

[0035] Figure 2 This is a graph showing the retinoid production of the strains used in Example 2.

[0036] Figure 3 This is a graph of glucose fermentation yield under nitrogen-rich conditions of the engineered strain VA11 in Example 3.

[0037] Figure 4This is a graph of glucose fermentation yield under nitrogen-limited conditions of the engineered strain VA11 in Example 3.

[0038] Figure 5 This is a graph showing the retinoid production in fermentation with different carbon sources in Example 4.

[0039] Figure 6 This is a graph showing the retinoid production of the strains used in Example 4.

[0040] Figure 7 This is a diagram of palmitic acid fermentation yield of the engineered strain VA15 in Example 4. DETAILED DESCRIPTION

[0041] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0042] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0043] The present invention is further explained by the following examples, but it does not constitute a limitation of the present invention. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art unless otherwise specified, and can be obtained through commercial channels.

[0044] Example 1

[0045] 1. Materials and Methods

[0046] 1. The gene synthesis in the present invention was completed by Beijing Qingke Biotechnology Co., Ltd.; the primer synthesis and sequencing in the present invention were completed by Beijing Qingke Biotechnology Co., Ltd. and Beijing Ruiboxingke Biotechnology Co., Ltd.

[0047] 2. The experimental methods used in the following examples, including plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc., are all conventional methods unless otherwise specified. If necessary, the specific experimental conditions can be determined by simple experiments.

[0048] 3. Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0049] 4. The original strain of Yarrowia lipolytica "T3GI12VC-ΔCLA4 / MHY1" (genotype MatA, leu2-270, ura3-302, xpr2-322, axp-2, trp1::FBAp-GGS1 / EXPp-CarRP / TEFp-CarB, TEFp-AtoB / GPDp-HMGS / FBAp-HMGR / EXPp-ERG12, FBAp-ERG20 / EXPp-IDI / TEFp-ERG19 / GPDp-ERG8, hyg / GPDp-IDI / TEFp-ERG12 / GPDp-GPS, leu2 / EXPp-VHb / GPDp-ERG8 / TEFp-ERG19, ura3 / GPDp-CarRP / TEFp-GGS1, ΔMHY1, ΔCLA4) involved in the present invention is from this laboratory and is preserved.

[0050] 5. The genes involved in the present invention, BLH from the uncultured marine bacterium 66A03, RDH12 from Homo sapiens, HpGGPPs from Haematococcus pluvialis, HsLRAT from Homo sapiens, RnLRAT from Rattus norvegicus, RBP1 from Homo sapiens, after codon optimization and synthesis (Qingke Biotechnology, Beijing, China); AtoB from Escherichia coli, HMGR from Bordetella petrii, and Rhizomucor circinelloides. circinelloides) was codon-optimized and synthesized (General Biotechnology, Anhui, China); HMGS, ERG12, DGA1, and DGA2 genes were cloned from the Yarrowia lipolytica genome.

[0051] 6. LB solid medium: 1% peptone, 0.5% yeast extract, 1% sodium chloride, 2% agar powder.

[0052] LB liquid medium: 1% peptone, 0.5% yeast extract, 1% sodium chloride.

[0053] YPD medium: 2% peptone, 1% yeast extract, 2% glucose.

[0054] YPD solid medium: 2% peptone, 1% yeast extract, 2% glucose, 2% agar powder.

[0055] II. Amplification of Gene Elements and Preparation of Target Plasmids (I) Preparation of Target Genes

[0056] 1. According to the nucleotide sequence of the acetyl-CoA acetyltransferase gene AtoB from Escherichia coli (GenBank: b2224) provided by NCBI, after codon optimization, it was commissioned to General Biosystems (Anhui) Co., Ltd. for synthesis optimization. The optimized nucleotide sequence of AtoB is shown in SEQ ID NO: 1.

[0057] 2. According to the nucleotide sequence of the NADH-dependent HMG-CoA reductase gene HMGR from Bordetella petrii (GenBank: Bpet3342) provided by NCBI, after codon optimization, it was commissioned to General Biosystems (Anhui) Co., Ltd. for synthesis optimization. The optimized nucleotide sequence of HMGR is shown in SEQ ID NO: 2.

[0058] 3. According to the nucleotide sequence of the phytoene synthase / lycopene cyclase gene CarRP from Rhizomucor circinelloides (GenBank: AJ250827.1) provided by NCBI, after codon optimization, it was commissioned to General Biosystems (Anhui) Co., Ltd. for synthesis optimization. The optimized nucleotide sequence of CarRP is shown in SEQ ID NO: 3.

[0059] 4. According to the nucleotide sequence of the GGPP synthase gene HpGGPPs (GenBank: KP759940.1) from Haematococcus pluvialis provided by NCBI, after codon optimization, Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize and optimize. The optimized nucleotide sequence of HpGGPPs is shown in SEQ ID NO:4.

[0060] 5. According to the nucleotide sequence of the β-carotene 15,15'-oxygenase gene BLH (GenBank: AAY68319.1) from the uncultured marine bacterium (the uncultured marinebacterium 66A03) provided by NCBI, after codon optimization, it was commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis optimization. The optimized nucleotide sequence of BLH is shown in SEQ ID NO: 5.

[0061] 6. According to the nucleotide sequence of the retinol dehydrogenase gene RDH12 from Homo sapiens (GenBank: NP_689656.2) provided by NCBI, after codon optimization, Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize and optimize. The optimized nucleotide sequence of RDH12 is shown in SEQ ID NO:6.

[0062] 7. According to the nucleotide sequence of the lecithin retinol acyltransferase gene HsLRAT (GenBank: AF071510) from Homo sapiens provided by NCBI, after codon optimization, the optimized synthesis was entrusted to Beijing Qingke Biotechnology Co., Ltd. The optimized nucleotide sequence of HsLRAT is shown in SEQ ID NO:7.

[0063] 8. According to the nucleotide sequence of the lecithin retinol acyltransferase gene RnLRAT (GenBank: AF255060) from Rattus norvegicus provided by NCBI, after codon optimization, the optimized nucleotide sequence of RnLRAT was entrusted to Beijing Qingke Biotechnology Co., Ltd. The optimized nucleotide sequence of RnLRAT is shown in SEQ ID NO:8.

[0064] 9. According to the nucleotide sequence of the retinol binding protein 1 gene RBP1 (GenBank: M11433) from Homo sapiens provided by NCBI, after codon optimization, Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize and optimize. The optimized nucleotide sequence of RBP1 is shown in SEQ ID NO:9.

[0065] 10. Based on the nucleotide sequences of HMG-CoA synthase gene HMGS (GenBank: YALI0_F30481g), mevalonate kinase gene ERG12 (GenBank: YALI0_B16038g), diacylglycerol acyltransferase 1 gene DGA1 (GenBank: YALI0_E32769g), and diacylglycerol acyltransferase 2 gene DGA2 (GenBank: YALI0_D07986g) in Yarrowia lipolytica provided by NCBI, they were amplified by PCR from the Yarrowia lipolytica genome using the primers in Table 1.

[0066] Table 1 Primer sequences

[0067]

[0068] (II) Construction of plasmid

[0069] The structure of the plasmid used in this example is shown in Figure 1 .

[0070] 1. The backbone plasmid used in this example

[0071] The preparation method of backbone plasmids pKi-1 and 113-GPD-TEF was prepared according to the method described in Cui, Z., Jiang, X., Zheng, H., Qi, Q., and Hou, J. (2019) Homology-independent genome integration enables rapid library construction for enzyme expression and pathway optimization in Yarrowia lipolytica, Biotechnology and bioengineering 116, 354-363.

[0072] 2. Construction of plasmids pKi1-TRP, pKi1-HYG and 113-LEU-GPD-TEF

[0073] Plasmids pKi1-TRP and pKi1-HYG were prepared with pKi-1 as the backbone. The LEU2 gene was replaced with TRP1 or HYG using the conventional Gibson assembly method to obtain pKi1-TRP and pKi1-HYG plasmids; plasmid 113-LEU-GPD-TEF was prepared with 113-GPD-TEF as the backbone. The URA3 gene was replaced with LEU2 using the conventional Gibson assembly method to obtain 113-LEU-GPD-TEF plasmid.

[0074] 3. Construction of plasmid pKi1-TRP-BLH-RDH12

[0075] Plasmid pKi1-TRP-BLH-RDH12 was prepared with pKi1-TRP as the backbone. The BLH gene was inserted into the downstream of the UT8 promoter of the pKi1-TRP plasmid using the conventional Gibson assembly method to obtain the pKi1-TRP-BLH plasmid, and the RDH12 gene was inserted into the downstream of the UT8 promoter of the pKi1-TRP plasmid to obtain the pKi1-TRP-RDH12 plasmid; the RDH12 gene expression frame was inserted into the NdeI restriction site of the pKi1-TRP-BLH plasmid to obtain the pKi1-TRP-BLH-RDH12 plasmid.

[0076] 4. Construction of plasmid AtoB-HMGS-HMGR-ERG12

[0077] Plasmid AtoB-HMGS-HMGR-ERG12 was prepared according to the preparation method described in Cui, ZY, et al., Homology-independent genome integration enables rapid library construction for enzyme expression and pathway optimization in Yarrowia lipolytica. Biotechnology and Bioengineering, 2019.116(2): p.354-363.

[0078] 5. Construction of plasmid 113-LEU-HpGGPPs-CarRP

[0079] Plasmid 113-LEU-HpGGPPs-CarRP was prepared with 113-LEU-GPD-TEF as the backbone. The 113-LEU-HpGGPPs plasmid obtained by inserting the HpGGPPs gene into the TEFin expression frame of the 113-LEU-GPD-TEF plasmid was synthesized by Beijing Qingke Biotechnology Co., Ltd. The 113-LEU-HpGGPPs-CarRP plasmid was obtained by inserting the CarRP gene into the GPD expression frame of the 113-LEU-HpGGPPs plasmid using the conventional Gibson assembly method.

[0080] 6. Construction of plasmids pKi1-HYG-DGA1, pKi1-HYG-DGA2, pKi1-HYG-HsLRAT, pKi1-HYG-RnLRAT, pKi1-HYG-RBP1, and pKi1-HYG-HsLRATRBP1

[0081] Plasmids pKi1-HYG-DGA1, pKi1-HYG-DGA2, pKi1-HYG-HsLRAT, pKi1-HYG-RnLRAT, pKi1-HYG-RBP1 and pKi1-HYG-HsLRATRBP1 were prepared using pKi-HYG as the backbone. Using the conventional Gibson assembly method, the DGA1, DGA2, HsLRAT, RnLRAT, and RBP1 genes were inserted downstream of the UT8 promoter of the pKi-HYG plasmid to obtain pKi1-HYG-DGA1, pKi1-HYG-DGA2, pKi1-HYG-HsLRAT, pKi1-HYG-RnLRAT, and pKi1-HYG-RBP1 plasmids, respectively; the HsLRAT gene and RBP1 gene were inserted downstream of the UT8 promoter of the pKi-HYG plasmid through GGGGS flexible linker fusion to obtain the pKi1-HYG-HsLRATRBP1 plasmid.

[0082] Example 2 Construction of the retinol-producing Yarrowia lipolytica engineered strain VA11

[0083] 1. Yarrowia lipolytica T3GI12VC-ΔCLA4 / MHY1 strain was cultured overnight and transformed with linearized plasmid pKi1-TRP-BLH-RDH12 based on non-homologous recombination (NHEJ) to obtain VA1-3 strain.

[0084] The specific method is as follows: (1) Yarrowia lipolytica T3GI12VC-ΔCLA4 / MHY1 was cultured overnight in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose), and then the competent cells were prepared using the conventional yeast lithium acetate competent cell preparation method. (2) 1-5 μg of pKi1-TRP-BLH-RDH12 plasmid linearized with NdeI restriction endonuclease was added to 40 μL of competent cells, and then 2-5 μL of salmon sperm DNA was added, and incubated at 30°C for 15 minutes. (3) 280 μL of 50% PEG4000, 70 μL of 0.5M lithium acetate (pH 6.0) and 16 μL of 1M DTT (final concentration 40 mM) were added to the above system, and incubated at 30°C for 1 hour. (4) Add 40 μL DMSO (final concentration of about 10%) to the above system and heat shock at 39°C for 10 min. (5) Add 600 μL 0.1 M lithium acetate (pH 6.0) and incubate at 30°C for 1 h. (6) Collect the bacteria by centrifugation, spread on a culture medium containing the corresponding antibiotics or a nutrient-deficient culture medium screening plate, and culture at 30°C for 2-3 days. (7) Randomly select 12 to 24 transformants, inoculate them in YPD culture medium supplemented with 10% dodecane and culture for 96 h, and detect the retinoid production in the transformants. In brief, the retinoid detection method is as follows: take the dodecane layer, dilute it by an appropriate multiple, filter it with a 0.22 μm organic filter membrane, and transfer it to a liquid phase vial for liquid chromatography quantitative detection. For the fermentation liquid layer, take 50 μL of fermentation liquid, centrifuge at 12000 rpm for 10 min, discard the supernatant, wash the bacteria with 1 mL of deionized water, centrifuge at 12000 rpm for 10 min, discard the supernatant; add appropriate amount of glass beads and 700 μL of DMSO, vortex to resuspend the bacteria, grind at 60 Hz for 10 min in a fast grinder, and then place in a 55°C metal bath for 10 min; add 750 μL of acetone, oscillate and mix, place in a 50°C metal bath for 10 min, and then centrifuge at 12000 rpm for 10 min. Aspirate the extract, filter with a 0.22 μm organic filter membrane, and transfer to a liquid phase vial for quantitative detection by liquid chromatography. The liquid chromatography detection procedure is as follows: using a chromatographic column Shim-pack GISTC18 (5 μm, 4.6×150 mm), mobile phase A is 2% acetic acid aqueous solution, mobile phase B is acetonitrile, and the total flow rate is 1.5 mL / min; the detector is a diode array detector; the column oven is 40° C.; the total program time is 35 min.

[0085] Compared with the original strain T3GI12VC-ΔCLA4 / MHY1, the VA1-3 strain became significantly lighter, successfully constructed the retinol synthesis pathway, and produced some retinol.

[0086] 2. To further strengthen the upstream pathway, the Yarrowia lipolytica VA1-3 strain was cultured overnight and the linearized plasmid AtoB-HMGS-HMGR-ERG12 was transformed based on non-homologous recombination (NHEJ) to obtain the VA10 strain. The transformation and detection methods were the same as the above steps.

[0087] 3. In order to balance the metabolic intensity of the upstream pathway, the Yarrowia lipolytica VA10 strain was cultured overnight, and the linearized plasmid 113-LEU-HpGGPPs-CarRP was transformed by non-homologous recombination (NHEJ) to obtain the VA11 strain. The transformation method and detection method were the same as the above steps. The obtained VA11 strain accumulated 583 mg / L retinol at 96 h of fermentation.

[0088] Example 3: Fed-batch fermentation culture of VA11 strain

[0089] The high-retinol-producing Yarrowia lipolytica VA11 genetically engineered as described in Example 2 was subjected to a fed-batch fermentation experiment in a 5-L fermenter.

[0090] The initial culture medium used in the nitrogen-rich glucose fermentation method of this embodiment is 2% peptone, 1% yeast extract, 5% glucose, 1.5 mM Zn 2+ , 2% BHT and 20% dodecane, working volume 3L. The bacterial liquid was inoculated into YPD medium and cultured for a period of time. A single clone was obtained and the seed liquid was obtained by shaking flask culture at 30℃ and 200rpm and then connected to the fermenter. The fermentation temperature was 30℃, pH was natural, and the ventilation / agitation rate parameters were 2.0 / 600~900vvm / rpm. When the glucose in the fermentation liquid was exhausted, feed medium (80% glucose, 8% peptone, 4% yeast extract, 1.5mM Zn 2+ , 2% BHT and 20% dodecane). Samples were taken every 24 hours to detect the retinoids in the fermentation broth and the biomass of the bacteria. Figure 3 The fermentation results showed that the retinol production reached 5.89 g / L at 168 h of fermentation, and the yield reached 0.013 g / g glucose, and maintained a trend of continued accumulation, which is the highest retinol yield reported in biosynthesis so far.

[0091] The initial culture medium and fermentation conditions used in the nitrogen-limited glucose fermentation method of this embodiment are the same as those described above. When the glucose in the fermentation broth is exhausted, feed medium (80% glucose, 1.5 mM Zn 2+ , 2% BHT and 20% dodecane). Samples were taken every 24 hours to detect the retinoids in the fermentation broth and the biomass of the bacteria. Figure 4 The fermentation results showed that the retinyl ester production reached 8.18 g / L at 168 h of fermentation, and the yield reached 0.015 g / g glucose, and maintained a trend of continued accumulation, which is the highest retinyl ester production reported in biosynthesis so far.

[0092] This engineered strain has excellent prospects for industrial application, and through conditional control, it allows the production of retinol to be converted into the production of retinyl esters, avoiding the subsequent processing step of converting alcohol into esters, and has excellent reference value.

[0093] Example 4 Construction of the engineered Yarrowia lipolytica strain VA15 producing retinol palmitate

[0094] 1. To achieve the specific synthesis of retinol palmitate, different oil carbon sources were replaced for VA11 strain fermentation, including oleic acid, palmitic acid, palm oil, peanut oil, and olive oil. Yarrowia lipolytica VA11 strain was cultured overnight and transferred to a shake flask containing 2% peptone, 1% yeast extract, 5% carbon source, and 10% dodecane for fermentation for 96 hours, and palmitic acid was determined to be the specific carbon source for producing retinol palmitate in this example.

[0095] 2. In order to further improve the synthesis of esters, the Yarrowia lipolytica VA11 strain was cultured overnight, and the linearized plasmids pKi1-HYG-DGA1, pKi1-HYG-DGA2, pKi1-HYG-HsLRAT, pKi1-HYG-RBP1, pKi1-HYG-HsLRATRBP1 and pKi1-HYG-RnLRAT were transformed by non-homologous recombination (NHEJ) to obtain VA11-VA17 strains. The transformation method and detection method were the same as the above steps. The retinyl ester production of the obtained strains was improved to varying degrees, among which the VA15 engineered strain with the best effect of introducing RBP1 had accumulated 809 mg / L retinyl esters at 96 h of fermentation.

[0096] 3. The high-retinol-producing Yarrowia lipolytica VA15 constructed by genetic engineering described in Example 4 was subjected to a fed-batch fermentation experiment in a 5-L fermenter.

[0097] The initial culture medium selected for the fermentation method in this embodiment is 2% peptone, 1% yeast extract, 20% palmitic acid and 30% dodecane, and the working volume is 3 L. The bacterial liquid is inoculated in YPD medium and cultured for a period of time, and a single clone is obtained and cultured in a shake flask at 26°C and 200rpm to obtain a seed liquid and access a fermenter, the fermentation temperature is 26°C, the pH is natural, and the ventilation / agitation rate parameters are 2.0 / 600-900vvm / rpm. When the palmitic acid in the fermentation liquid is exhausted, 5% palmitic acid is added, and a feed medium (40% peptone, 20% yeast extract, and 30% dodecane) is added at a low speed. Samples are taken every 24h and the retinoids in the fermentation liquid and the biomass of the bacteria are detected. Figure 7 The fermentation results show that the yield of retinol palmitate reached 4.53 g / L at 168 h of fermentation, the yield reached 0.018 g / g palmitic acid, and maintained a trend of continued accumulation, which is the highest retinol palmitate yield reported in biosynthesis. The engineered strain is also and possibly more suitable for the method of conditionally controlling the production of retinol or retinyl esters, and has excellent prospects for industrial application. The strain has been deposited in the China Center for Type Culture Collection, abbreviated as CCTCC, on December 16, 2024, with the address: Wuhan University, Wuhan, China, and its biological deposit number is: CCTCC NO: M 20242815.

[0098] Nucleotide sequence information involved in this application

[0099] SEQ ID NO: 1

[0100] AtoB

[0101] ATGAAGAACTGTGTCATCGTGTCCGCCGTGCGAACCGCCATCGGCTCCTTCAACGGTTCCTGG

[0102] CCTCCACCTCCGCCATTGACCTGGGCGCCACCGTCATTAAGGCCGCCATCGAGCGAGCCAAGAT

[0103] CGACTCCCAGCACGTGGACGAGGTCATTATGGGTAACGTCCTGCAGGCCGGCCTGGGTCAGAAC

[0104] CCCGCTCGACAGGCCCTGCTGAAGTCCGGCCTGGCCGAGACCGTCTGTGGTTTCACCGTGAAC

[0105] AAGGTGTGCGGCTCCGGTCTGAAGTCCGTCGCCCTGGCCGCCCAGGCTATCCAGGCTGGACAG

[0106] GCCCAGTCCATCGTGGCCGGCGGAATGGAGAACATGTCCCTGGCCCCCTACCTGCTGGACGCCA

[0107] AGGCCCGATCCGGCTACCGACTGGGCGACGGTCAGGTGTACGACGTGATTCTGCGAGACGGTCT

[0108] GATGTGTGCCACCCACGGTTACCACATGGGCATCACCGCCGAGAACGTCGCCAAGGAGTACGGT

[0109] ATCACCCGAGAGATGCAGGACGAGCTGGCCCTGCACTCCCAGCGAAAGGCCGCCGCTGCCATC

[0110] GAGTCCGGTGCCTTCACCGCCGAGATTGTCCCCGTCAACGTCGTGACCCGAAAGAAGACCTTCG

[0111] TCTTCTCCCAGGACGAGTTCCCCAAGGCCAACTCTACCGCCGAGGCCCTGGGCGCTCTGCGACC

[0112] TGCTTTCGACAAGGCCGGTACCGTGACCGCCGGTAACGCCTCCGGTATTAACGACGGCGCCGCC

[0113] GCCCTGGTCATTATGGAGGAGTCCGCCGCCCTGGCCGCTGGTCTTACCCCTCTGGCCCGAATCAA

[0114] GTCTTACGCCTCTGGTGGCGTGCCCCCCGCCCTTATGGGCATGGGTCCCGTGCCCGCCACCCAG

[0115] AAGGCCCTTCAGCTGGCCGGTCTGCAGCTGGCCGACATTGACCTGATCGAGGCCAACGAGGCC

[0116] TTCGCCGCCCAGTTCCTGGCCGTCGGAAAGAACCTGGGTTTCGACTCTGAGAAGGTCAACGTG

[0117] AACGGCGGTGCCATCGCCCTGGGCCACCCTATCGGCGCTTCCGGAGCCCGAATCCTGGTCACCC

[0118] TGCTGCACGCCATGCAGGCCCGAGACAAGACCCTGGGCCTGGCCACCCTGTGTATTGGTGGCGG

[0119] CCAGGGTATTGCCATGGTCATTGAGCGACTGAACTAA

[0120] SEQ ID NO:2

[0121] HMGR

[0122] ATGTCTACCGACGCCAAGAACTCTCGAATTTCTGGTTTCCACAAGGACGACATCCCCACCCGAC

[0123] TGGCCCGAGTCGCCGCTTTCGCCGGTCTGGACGACGAGACCGTGCAGCACCTGGCCAACATGG

[0124] GTAACCTGGACCCCCAGCTGGCCGACCGACTGATTGAGAACGTGGTGGCCACCCTGAACGTCC

[0125] CCATTGGCATCGCCACCAACATGAAGGTCGACGGTGAGGACGTGCTGGTCCCCATGGCCACCGA

[0126] GGAGTCCTCCGTCGTGGCCGCTGTGTGCAACGCCGCCCGACAGTGTTACGACCAGGGCGGTTTC

[0127] ACCACCTCTATGTCCGGTTCCCTGATGATTGCCCAGGTCCAGCTGGTCGACGTCCCCGACGCCGC

[0128] TCACGCTCGAATGCGAATTCTGGAGCACAAGGCCGAGGTCAAGGCCCTGTGCGACGACTGTGA

[0129] CCCCCTGCTGGTCAAGCTGGGTGGTGGTCTGCAGGACGTGGAGGTCCGAATCGTCGACGCCGC

[0130] CGGTGGTCCCATGGTGGTCACCCACCTGATCGTGGACACCCGAGACGCCATGGGTGCCAACGCC

[0131] GTCAACTCCATGGCCGAGAAGCTGGCCCCCCACATCGAGTCCTGGACCGGCGGTCGAGTGTACC

[0132] TGCGAATCCTGTCCAACCTGGCCGACCGACGACTGGCCCGAGCCCGAGCTGTCTGGACCTGTG

[0133] ACGCCATCGGTGGCGCCTCTGTGCGAGACGGTATTATCTCCGCCTACCGATTCGCCGCCGCCGAC

[0134] CCTTACCGAGCCGCTACTCACAACAAGGGTATTATGAACGGCGTGTCCGCCGTGGTGCTGGCCA

[0135] CCGGTAACGACACCCGAGCCGTGGAGGCCGGCGCTCATGCTTACGCCGCCCGAAAGGGTTGGT

[0136] ACTCCTCTCTGACCGACTGGGAGGTCACCGCCGAGGGCCACCTGGCTGGAACCCTGGAGATGC

[0137] CCATGGCCGTGGGTCTGGTGGGCGGTGCTACCAAGCTGCACCCCACCGCCCGAGCCTGCCTGAA

[0138] GATCCTGGGCGTGTCCACCGCCGAGCGACTGGCTCGACTGATCGCCGCCGTCGGCCTGGCTCAG

[0139] AACTTCTCTGCCCTGAAGGCCCTGGCCACCACCGGCATTCAGAAGGGTCACATGTCCCTGCACG

[0140] CCCAGAACATCGCCATGATGGCCGGTGCCGTGGGTGACGAGATCGAGCCCGTCGCCAAGGCCCT

[0141] GGTCGCCCAGGGTGCTGTCCGAGTGGACGTCGCCGAGGCCGAGCTGGCTCGACTCCGAGGTCA

[0142] GGGCTAA

[0143] SEQ ID NO:3

[0144] CarRP

[0145] ATGCTGCTGACCTACATGGAGGTCCACCTGTACTACACCCTGCCCGTCCTGGGCGTCCTGTCTTG

[0146] GCTGTCCCGACCCTACTACACCGCCACCGACGCCCTGAAGTTCAAGTTCCTGACCCTGGTGGCC

[0147] TTCACCACCGCCTCCGCTTGGGACAACTACATTGTCTACCACAAGGCCTGGTCCTACTGCCCCAC

[0148] CTGCGTGACCGCCGTCATTGGTTACGTGCCCCTGGAGGAGTACATGTTCTTCATCATTATGACCCT

[0149] GCTGACCGTGGCCTTCACTAACCTGGTCATGCGATGGCACCTGCACTCTTTCTTCATCCGACCCG

[0150] AGACCCCCGTGATGCAGTCTGTCCTGGTGCGACTGGTCCCCATCACCGCCCTGCTGATCACCGC

[0151] CTACAAGGCCTGGCACCTGGCCGTCCCTGGTAAACCCCTGTTCTACGGCTCTTGCATTCTGTGGT

[0152] ACGCCTGCCCCGTGCTGGCCCTTCTGTGGTTCGGCGCTGGCGAGTACATGATGCGACGACCCCT

[0153] GGCCGTCCTGGTGTCTATTGCCCTGCCCACCCTGTTCCTGTGCTGGGTCGACGTGGTCGCCATTG

[0154] GCGCCGGAACCTGGGACATCTCCCTGGCTACCTCCACCGGCAAGTTCGTGGTGCCCCACCTGCC

[0155] CGTGGAGGAGTTCATGTTCTTCGCCCTGATCAACACCGTGCTGGTGTTCGGTACCTGCGCCATCG

[0156] ACCGAACCATGGCCATTCTGCACCTGTTCAAGAACAAGTCCCCCTACCAGCGACCCTACCAGCA

[0157] CTCTAAGTCCTTCCTGCACCAGATCCTGGAGATGACCTGGGCCTTCTGTCTGCCCGACCAGGTCC

[0158] TGCACTCTGACACCTTCCACGACCTGTCCGTCTCTTGGGACATCCTGCGAAAGGCCTCCAAGTC

[0159] TTTCTACACCGCCTCTGCCGTCTTCCCCGGCGACGTTCGACAGGAGCTGGGTGTCCTGTACGCCT

[0160] TCTGCCGAGCCACCGACGACCTGTGCGACAACGAGCAGGTGCCCGTCCAGACCCGAAAGGAGC

[0161] AGCTGATCCTGACCCACCAGTTCGTCTCCGACCTGTTCGGCCAGAAGACCTCCGCCCCCACCGC

[0162] TATTGACTGGGACTTCTACAACGACCAGCTGCCCGCCTCCTGCATTTCCGCCTTCAAGTCCTTCA

[0163] CCCGACTGCGACACGTCCTGGAGGCCGGAGCTATTAAGGAGCTGCTGGACGGTTACAAGTGGG

[0164] ACCTGGAGCGACGATCCATTCGAGACCAGGAGGACCTGCGATACTACTCCGCCTGCGTGGCCTC

[0165] CTCTGTCGGCGAGATGTGCACCCGAATCATTCTGGCCCACGCCGACAAGCCCGCCTCCCGACAG

[0166] CAGACTCAGTGGATCATCCAGCGAGCCCGAGAGATGGGTCTGGTCCTGCAGTACACCAACATCG

[0167] CCCGAGACATTGTCACCGACTCCGAGGAGCTGGGCCGATGTTACCTGCCCCAGGACTGGCTGAC

[0168] CGAGAAGGAGGTGGCCCTGATCCAGGGCGGTCTGGCTCGAGAGATTGGCGAGGAGCGACTGCT

[0169] GTCTCTGTCTCACCGACTGATCTACCAGGCCGACGAGCTGATGGTCGTCGCCAACAAGGGCATT

[0170] GACAAGCTGCCCTCCCACTGCCAGGGTGGCGTGCGAGCTGCTTGCAACGTCTACGCCTCCATCG

[0171] GCACCAAGCTGAAGTCCTACAAGCACCACTACCCCTCCCGAGCCCACGTGGGAAACTCTAAGC

[0172] GAGTGGAGATCGCCCTGCTGTCTGTCTACAACCTGTACACCGCCCCCATTGCCACCTCTTCCACC

[0173] ACCCACTGTCGACAGGGTAAAATGCGAAACCTGAACACCATCTAASEQ ID NO:4

[0174] HpGGPPs

[0175] ATGATCCGAGCGATGCACAACCGAGCCCCGACGCCTAGAACAAGGGTATCGCATCCCAGAAGTC

[0176] ACAGAGCCCTTGCCCACGTGTCAGCCGTTGCTACTGCCGGACAAGTTGCTGAGGTCCATTCTGC

[0177] TCCGGCCTTCGACTTTGAAATGTACATGAGAGACCGAGCCGAGATGGTCAACAAGGCGCTCGAC

[0178] GCTGCGCTCCCATCTCGGTACCCCGAGGTTTTAGTGGATTCCATGCGATATTCGGTCCTAGCCGGT

[0179] GGCAAGCGAGTGCGACCCGCACTGACTCTTGCAGCTTGCGACCTGGTCGGCGGCGACATGGCC

[0180] ACAGCCCTGCCTACGGCTTGCGCCATGGAAATGATTCATACCATGTCGCTCATCCACGACGATTT

[0181] GCCAGCCATGGACAACGACGACTTCCGACGAGGACGGCCCACCAATCACAAGGTCTACGGCGA

[0182] AGATATAGCCATTCTGGCTGGAGATGCCCTTTTGAGCTTTGCCTTTGAGCACATCGCACGTGATA

[0183] CCAAGGGCGTGCCTGCTGATGCAGTCCTCAAGGTGATCATGGAACTGGGCCGTGCCGTGGGAG

[0184] CTCAGGGCTTGTCTGCTGGTCAAGCCGTCGACATCAAGTCCGAGGGTCAGGAGGTGGGGCTAG

[0185] AAGTGCTCGAGTACATCCATCACCACAAAACAGCTGCTCTGCTGGAAGCAGCAGTGGTGTGTGG

[0186] TGCTCTGGTTGGAGGAGCCGACACTGCTACGGTTGAGAAGCTGCGGAAGTACGCCCTCAACATT

[0187] GGTCTCGCGTTCCAGGTCATTGATGACATTTTGGACGTCACCCAGACCACCGAGACTCTGGGAA

[0188] AGACCGCGGCCAAGGACTTGGCAGTTAATAAAACCACTTATCCCAAGCTCCTTGGTCTGGAGGC

[0189] CTCCCGCAAAGTGGCCGATGATCTTATTCGAGAGGCTATCGCCCAGCTCGACGAGTTCGAGCCT

[0190] GCCCGAAAGGCTCCCATGGTTGCACTGGCTCATCTGATTGGCTACCGGAAGAACTGASEQ ID NO:5

[0191] BLH

[0192] ATGGGCCTGATGCTGATCGACTGGTGCGCCCTGGCCCTGGTCGTCTTTATCGGCCTGCCCCACGG

[0193] TGCTCTGGACGCCGCTATCTCGTTCTCGATGATCTCCTCCGCCAAGCGAATCGCCCGACTGGCCG

[0194] GCATCCTGCTTATCTACCTCCTGCTCGCCACCGCCTTCTTCCTCATCTGGTACCAGCTGCCCGCCT

[0195] TTTCCCTTCTTATTTTCCTGCTGATCTCCATCATCCACTTCGGCATGGCCGATTTCAACGCCTCCCC

[0196] CTCCAAGCTCAAGTGGCCCCATATCATCGCCCACGGCGGCGTCGTCACCGTCTGGCTTCCCCTGA

[0197] TCCAGAAGAACGAGGTCACCAAGCTGTTCTCCATCCTCACCAACGGACCCACTCCCATCCTCTG

[0198] GGACATCCTCCTCATCTTCTTCCTGTGCTGGTCCATCGGTGTCTGCCTGCATACCTACGAGACCCT

[0199] GCGATCCAAGCACTACAACATCGCCTTCGAGCTCATCGGCCTGATCTTCCTGGCCTGGTACGCCC

[0200] CCCCCCTCGTCACTTTCGCCACCTACTTCTGCTTTATCCACTCCCGACGACACTTCTCCTTCGTCT

[0201] GGAAGCAGCTTCAGCACATGTCCTCCAAGAAGATGATGATCGGCTCCGCCATCATCCTCTCCTGC

[0202] ACCTCCTGGCTGATTGGCGGTGGCATCTACTTTTTCCTCAACTCCAAGATGATCGCTTCCGAGGC

[0203] CGCCCTGCAGACTGTCTTCATCGGCCTGGCCGCTCTTACCGTCCCCCACATGATTCTGATCGACT

[0204] TCATCTTCCGACCCCACTCCTCCCGAATCAAGATCAAGAACTAA

[0205] SEQ ID NO:6

[0206] RDH12

[0207] ATGCTGGTCACCCTGGGCCTGCTGACCTCCTTCTTCTCCTTCCTGTACATGGTCGCCCCCTCCATC

[0208] CGAAAGTTCTTCGCCGGCGGCGTGTGCCGAACCAACGTCCAGCTGCCCGGCAAGGTCGTTGTC

[0209] ATCACTGGCGCCAACACCGGCATCGGCAAGGAGACCGCCCGAGAGCTCGCCTCCCGAGGAGCT

[0210] CGAGTTTACATTGCTTGCCGAGACGTCCTGAAGGGCGAGAGCGCCGCCTCCGAGATCCGAGTCG

[0211] ACACCAAGAACAGCCAGGTGCTGGTCCGAAAGCTGGACCTTTCCGATACTAAGTCCATCCGAGC

[0212] CTTCGCCGAGGGCTTCCTCGCCGAGGAGAAGCAGCTGCACATTCTGATCAACAACGCCGGAGT

[0213] CATGATGTGTCCCTACTCCAAGACCGCCGACGGCTTCGAGACCCACCTGGGAGTTAACCACCTG

[0214] GGACACTTCCTTCTGACCTACCTCCTGCTCGAGCGACTGAAGGTCTCTGCTCCCGCCCGAGTCG

[0215] TCAACGTCTCCTCCGTTGCCCACCACATTGGCAAGATCCCCTTCCACGACCTGCAGTCCGAGAA

[0216] GCGATACTCCCGAGGCTTCGCCTACTGCCACTCCAAGCTCGCCAACGTCCTCTTCACCCGAGAG

[0217] CTGGCCAAGCGACTCCAGGGCACCGGCGTCACCACCTACGCCGTCCACCCCGGAGTCGTCCGAT

[0218] CCGAGCTTGTCCGACACTCCTCCCTGCTCTGCCTGCTGTGGCGACTGTTCTCCCCCTTTGTCAAG

[0219] ACCGCCCGAGAGGGCGCCCAGACCTCCCTTCATTGCGCTCTCGCCGAGGGCCTCGAGCCCCTTT

[0220] CCGGTAAGTACTTCTCCGACTGCAAGCGAACCTGGGTTTCCCCCCGAGCCCGAAACAACAAGA

[0221] CCGCTGAGCGACTGTGGAACGTCTCCTGCGAGCTGCTGGGTATCCGATGGGAGTAASEQ ID NO:7

[0222] HsLRAT

[0223] ATGAAGAACCCTATGCTGGAGGTCGTGTCTCTGCTTCTGGAGAAGCTGCTGCTGATCTCTAACTT

[0224] CACTCTGTTCAGCTCTGGTGCTGCTGGTGAAGATAAGGGCCGAAACTCTTTCTACGAAACCTCT

[0225] TCTTTCCACCGAGGTGATGTGCTGGAAGTGCCTCGAACTCACCTGACTCACTACGGCATCTACCT

[0226] GGGAGACAACCGAGTCGCACACATGATGCCTGACATTCTGCTGGCTCTGACCGACGACATGGGT

[0227] CGAACACAGAAGGTCGTCTCTAACAAGCGACTGATTCTGGGTGTCATCGTGAAGGTGGCCTCTA

[0228] TTCGAGTGGACACTGTCGAAGATTTCGCTTACGGAGCCAACATTCTGGTCAACCATCTGGACGA

[0229] GTCTCTGCAGAAGAAGGCTCTGCTGAACGAGGAGGTTGCCAGAAGAGCCGAGAAACTGCTGG

[0230] GCTTCACACCTTACTCTCTGCTGTGGAACAACTGCGAGCACTTCGTCACCTACTGCCGATACGGC

[0231] ACACCTATCTCTCCACAGTCCGACAAGTTCTGCGAAACCGTGAAGATCATCATCCGAGATCAGC

[0232] GATCTGTGCTGGCTTCCGCCGTTCTGGGACTGGCTTCCATCGTGTGCACAGGCCTCGTCTCTTAC

[0233] ACCACTCTGCCTGCCATCTTCATCCCTTTCTTTCTGTGGATGGCTGGCTAASEQ ID NO:8

[0234] RnLRAT

[0235] ATGAAGAACTCCATGCTGGAGGCTGCCTCTCTTCTGCTGGAGAAGCTGCTTCTGATCTCCAACTT

[0236] CAAGATTTTCTCCGTTTGTGCTCCAGGTGGTGGTACTGGCAAGAAGCATCCATACGAGATCAACT

[0237] CGTTTCTGCGAGGTGATGTGCTGGAGGTGTCTCGAACTCACTTCACTCACTACGGCATCTACCTG

[0238] GGTGACAACCGAGTTGCACACCTGATGCCTGACATTCTGCTGGCTCTGACCTCTGACAAAGAGC

[0239] GAACACAGAAGGTCGTCTCCAACAAGCGACTGCTGCCTGGTGTCATCTGCAAGGTCGCTTCTAT

[0240] CCGAGTTGACACCGTTGAGGACTTCGCCTACGGTGCCGACATTCTGGTCAACCATCTGGACGAG

[0241] ACACTGAAGAAGAAGTCTCTGCTGAACGAAGAGGTTGCCAGAAGAGCTGAGCAGCAGCTTGG

[0242] TCTGACACCTTACTCTCTGCTGTGGAACAACTGCGAGCACTTCGTCACCTACTGCCGATACGGTT

[0243] CGCCTATCTCGCCTCAAGCTGAGAAGTTCCACGAGACTGTCAAGATTCTGATCCGAGATCAGCG

[0244] ATCTTGCCTGGCTTCTGCTGTTCTGGGTCTTGTCTCCATCATCTACACCGGTCTGGCTTCTTACAT

[0245] GACTCTGCCTGCTGTCTGCATCCCTTTCTGCCTGTGGATGATGTCCGGCTAASEQ ID NO: 9

[0246] RBP1

[0247] ATGCCTGTCGATTTCACCGGATACTGGAAGATGCTGGTCAACGAGAACTTCGAAGAGTACCTGC

[0248] GAGCACTGGATGTTAACGTGGCTCTGCGAAAGATCGCCAACCTTCTGAAGCCTGACAAAGAGAT

[0249] CGTCCAAGACGGTGACCACATGATTATCCGAACTCTCTCCACCTTCCGAAACTACATCATGGACT

[0250] TCCAGGTCGGCAAAGAGTTCGAGGAGGACCTCACCGGTATTGACGACCGAAAGTGCATGACCA

[0251] CCGTTTCTTGGGATGGAGACAAACTTCAGTGCGTCCAGAAGGGTGAGAAAGAGGGACGAGGCT

[0252] GGACTCAGTGGATTGAGGGCGACGAGCTTCACCTGGAGATGCGAGTGGAGGGTGTCGTCTGTA

[0253] AGCAGGTGTTCAAGAAGGTCCAGTAA

[0254] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An engineered strain of Yarrowia lipolytica for producing retinol, retinyl esters and their derivatives, characterized in that: The Yarrowia lipolytica engineered bacteria at least expresses β-carotene 15,15'-oxygenase and retinol dehydrogenase; The β-carotene 15,15'-oxygenase is derived from the uncultured marine bacterium 66A03, and its encoding gene is BLH (GenBank: AAY68319.1); the retinol dehydrogenase is derived from Homo sapiens, and its encoding gene is RDH12 (GenBank: NP_689656.2).

2. The engineered Yarrowia lipolytica producing retinol, retinyl esters and their derivatives according to claim 1, characterized in that: The coding gene BLH is codon optimized, and the optimized nucleotide sequence of BLH is shown in SEQ ID NO: 5; the coding gene RDH12 is codon optimized, and the optimized nucleotide sequence of RDH12 is shown in SEQ ID NO:

6.

3. The engineered Yarrowia lipolytica strain producing retinol, retinyl esters and their derivatives according to claim 1, characterized in that: The starting strain Yarrowia lipolytica is specifically Yarrowia lipolytica T3GI12VC-ΔCLA4 / MHY1, and its genotype is MatA, leu2-270, ura3-302, xpr2-322, axp-2, trp1::FBAp-GGS1 / EXPp-CarRP / TEFp-CarB, TEFp-AtoB / GPDp-HMGS / FBAp-HMGR / EXPp-ERG12, FBAp-ERG20 / EXPp-IDI / TEFp-ERG19 / GPDp-ERG8, hyg / GPDp-IDI / TEFp-ERG12 / GPDp-GPS, leu2 / EXPp-VHb / GPDp-ERG8 / TEFp-ERG19, ura3 / GPDp-CarRP / TEFp-GGS1, ΔMHY1, ΔCLA4.

4. The engineered Yarrowia lipolytica producing retinol, retinyl esters and their derivatives according to claim 1, characterized in that: The engineered Yarrowia lipolytica strain also expresses one or more of acetyl-CoA acetyltransferase, NADH-dependent HMG-CoA reductase, HMG-CoA synthetase, and mevalonate kinase.

5. The engineered Yarrowia lipolytica strain producing retinol, retinyl esters and their derivatives according to claim 4, characterized in that: The acetyl-CoA acetyltransferase is derived from Escherichia coli, and the encoding gene of the acetyl-CoA acetyltransferase is AtoB (GenBank: b2224); further preferably, the encoding gene AtoB is codon optimized, and the nucleotide sequence of the optimized AtoB is shown in SEQ ID NO: 1; The NADH-dependent HMG-CoA reductase is derived from Bordetella petrii, and the encoding gene of the NADH-dependent HMG-CoA reductase is HMGR (GenBank: Bpet3342). Further preferably, the encoding gene HMGR is codon-optimized, and the nucleotide sequence of the optimized HMGR is shown in SEQ ID NO: 2; The HMG-CoA synthetase is derived from Yarrowia lipolytica, and the gene encoding the HMG-CoA synthetase is HMGS (GenBank: YALI0_F30481g); The mevalonate kinase is derived from Yarrowia lipolytica, and the gene encoding the mevalonate kinase is ERG12 (GenBank: YALI0_B16038g).

6. The engineered Yarrowia lipolytica strain producing retinol, retinyl esters and their derivatives according to claim 1, characterized in that: The engineered Yarrowia lipolytica strain also expresses any one or both of GGPP synthase and phytoene synthase / lycopene cyclase; Further, the GGPP synthase is derived from Haematococcus pluvialis, and its encoding gene is HpGGPPs (GenBank: KP759940.1). More preferably, the encoding gene HpGGPPs is codon optimized, and the nucleotide sequence of the optimized HpGGPPs is shown in SEQ ID NO: 4; Furthermore, the phytoene synthase / lycopene cyclase is derived from Rhizomucor circinelloides, and its encoding gene is CarRP (GenBank: AJ250827.1); more preferably, the encoding gene CarRP is codon optimized, and the nucleotide sequence of the optimized CarRP is shown in SEQ ID NO:

3.

7. The engineered Yarrowia lipolytica strain producing retinol, retinyl esters and their derivatives according to claim 1, characterized in that: The Yarrowia lipolytica engineered bacteria also express at least one of diacylglycerol acyltransferase 1, diacylglycerol acyltransferase 2, lecithin retinol acyltransferase and retinol binding protein 1; Further, the diacylglycerol acyltransferase 1 is derived from Yarrowia lipolytica, the diacylglycerol acyltransferase 1 is DGA1 (GenBank: YALI0_E32769g), the diacylglycerol acyltransferase 2 is derived from Yarrowia lipolytica, and the diacylglycerol acyltransferase 2 is DGA2 (GenBank: YALI0_D07986g); Further, the lecithin retinol acyltransferase is derived from Homo sapiens or Rattus norvegicus, and its encoding gene is HsLRAT (GenBank: AF071510) or RnLRAT (GenBank: AF255060); further preferably, the encoding gene HsLRAT or RnLRAT is codon optimized, and the optimized nucleotide sequences of HsLRAT and RnLRAT are shown in SEQ ID NO: 7 and SEQ ID NO: 8; The retinol binding protein 1 is derived from Homo sapiens, and its encoding gene is RBP1 (GenBank: M11433). Further preferably, the encoding gene RBP1 is codon optimized, and the optimized nucleotide sequence of RBP1 is shown in SEQ ID NO:

9.

8. An engineered strain of Yarrowia lipolytica for producing retinol, retinyl esters and their derivatives, characterized in that: The Yarrowia lipolytica engineered bacteria is specifically Yarrowia lipolytica VA15, which has been deposited in the China Center for Type Culture Collection on December 16, 2024, and its biological deposit number is: CCTCC NO:M 20242815.

9. Use of the engineered Yarrowia lipolytica according to any one of claims 1 to 8 in the preparation and production of retinol, retinyl esters and their derivatives; The derivatives include retinol, retinal, retinoic acid and / or retinyl esters.

10. A method for industrial production of retinol, retinyl esters and their derivatives, characterized in that: The method comprises: fermenting and culturing the Yarrowia lipolytica engineered bacteria according to any one of claims 1 to 8, and separating and purifying to obtain the retinol and its derivatives; Further, the retinol and its derivatives include retinol, retinal, retinoic acid and / or retinyl esters; Further, the method includes a control strategy for the fermentation culture to change the ratio of the products retinol and retinyl esters and their derivatives; Furthermore, the fermentation culture is selected from batch fed fermentation culture; Furthermore, in the fermentation culture, the oil carbon source includes oleic acid, palmitic acid, palm oil, peanut oil, olive oil and rapeseed oil.

Images