Application of tamarind polysaccharide and parabacteroides dielsii in relieving hyperlipemia

Abstract

The invention discloses application of tamarind polysaccharide and parabacteroides dieldrii in relieving hyperlipidemia, and belongs to the field of biological medicine. The parabacteroides diels AR1098 is preserved in the general microbiological center of the China Committee for Culture Collection of Microorganisms on October 23, 2024, and the preservation number of the parabacteroides diels AR1098 is CGMCC (China General Microbiological Culture Collection Center) No. 32321. The tamarind polysaccharide is found to be capable of promoting the growth of AR1098 and enhancing the lipid-lowering function of AR1098. Specifically, the tamarind polysaccharide can cooperate with AR1098 to significantly reduce the content of triglyceride and cholesterol in the liver of a mouse and improve the change of the blood lipid level of the mouse; the liver tissue form of the mouse can be remarkably recovered, and lipid accumulation in the liver is reduced; and the relative expression quantity of the blood fat related genes can be adjusted, so that the hyperlipemia of mice can be relieved.

Description

Technical Field

[0001] The invention relates to the field of biomedicine, and in particular to application of tamarind polysaccharide in cooperation with Parabacteroides distilogenes in alleviating hyperlipidemia. Background Art

[0002] Hyperlipidemia is a lipid metabolism disorder characterized by elevated serum total cholesterol, triglycerides (TG) and low-density lipoprotein (LDL) levels and decreased high-density lipoprotein (HDL) levels. Some studies have shown that blood cholesterol levels are significantly positively correlated with intake. High fat or cholesterol content can also induce the production of free radicals, of which free radicals in the body are mainly caused by bad eating habits, while free radicals outside the body are caused by smoking, X-rays, etc. If there are a large number of free radicals in the body, it will induce oxidative stress, cause atherosclerosis, lead to coronary heart disease, stroke and myocardial infarction, and increase the incidence and mortality of cardiovascular and cerebrovascular diseases.

[0003] At present, with the change of lifestyle, the number of patients with hyperlipidemia is increasing year by year, and they are gradually becoming younger. Therefore, it is urgent to regulate lipid metabolism disorders and control the occurrence and development of hyperlipidemia. Statins, beta-blockers, niacin, resin drugs and intestinal cholesterol absorption inhibitors are the main lipid-lowering drugs in clinical practice, but they can cause varying degrees of damage and side effects to the human body. Statins can cause adverse reactions such as liver damage, rhabdomyolysis, tumors, and diabetes. Therefore, it is currently necessary to explore new treatment options to regulate lipid metabolism in patients with hyperlipidemia or reduce the side effects of lipid-lowering drugs to minimize the impact of hyperlipidemia or drug side effects.

[0004] Bacteroides are the main Gram-negative anaerobic bacteria in the intestinal microbiota, accounting for 30% of the culturable bacteria in the human intestine. They are the most numerous bacteria in the intestine of healthy people. Currently, more than 55 species of intestinal bacteria have been discovered, including Bacteroides, Parabacterioids and Prevotella. Bacteroides have a certain degree of intraspecific genetic diversity and play an important role in the synthesis of molecules that interact with other bacteria, hosts and diets. In addition, Bacteroides also has strong metabolic and colonization capabilities, making it an important microorganism that can regulate intestinal health. Many studies have found that B. thetaiotaomicron plays an important role in promoting the development of metabolic diseases such as obesity and may aggravate lipid metabolism disorders by accelerating fat absorption. In addition, supplementation with Parabacterioids distason can also change the composition of the intestinal microbiota.

[0005] Tamarind polysaccharide gum, also known as tamarind gum, is a neutral polysaccharide extracted and separated from the seed endosperm of tamarindus, a plant of the genus Tamarindus. Therefore, the ability of Bacteroides to utilize carbohydrates was used to explore the enhancement of the growth and function of Parabacteroides dieldrinii by tamarind polysaccharides. These results indicate that Bacteroides has a positive effect on host metabolism and can be used as a new active biomarker for the treatment and prevention of related metabolic diseases. Therefore, Bacteroides can synergistically enhance the ability of Bacteroides to improve the occurrence and development of hyperlipidemia with tamarind polysaccharides. Summary of the invention

[0006] The purpose of the present invention is to provide an application of tamarind polysaccharide in synergizing with Parabacteroides dieltii in alleviating hyperlipidemia, so as to solve the problems existing in the above-mentioned prior art. The present invention finds that tamarind polysaccharide can promote the growth of Parabacteroides dieltii AR1098 and enhance the lipid-lowering ability of Parabacteroides dieltii AR1098.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a strain of Parabacteroides distasonis AR1098, the preservation number of the Parabacteroides distasonis is CGMCC No.32321, the preservation date is October 23, 2024, the preservation unit is the General Microbiology Center of China National Microbiological Culture Collection Administration, and the preservation address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0009] The present invention also provides the use of tamarind polysaccharide in cooperation with Parabacteroides distiller AR1098 in preparing a drug for alleviating hyperlipidemia, wherein the preservation number of the Parabacteroides distiller AR1098 is CGMCC No.32321.

[0010] Optionally, the tamarind polysaccharide promotes the growth of the Parabacteroides dieltii AR1098 and enhances the lipid-lowering ability of the Parabacteroides dieltii AR1098.

[0011] The present invention also provides a drug for alleviating hyperlipidemia, wherein the active ingredients of the drug are tamarind polysaccharide and Parabacteroides distiliensis AR1098;

[0012] The deposit number of the Parabacteroides distichous AR1098 is CGMCC No.32321.

[0013] Optionally, the concentration of the Parabacteroides distiliensis AR1098 is 10 9 CFU / mL.

[0014] Optionally, the volume ratio of the tamarind polysaccharide to Parabacteroides dieltii AR1098 is 1:1.

[0015] Optionally, the drug further comprises pharmaceutically acceptable excipients.

[0016] Optionally, the auxiliary material includes at least one of a diluent, a filler, an excipient, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier, a lubricant and a flavoring agent.

[0017] Optionally, the dosage form of the drug includes a liquid dosage form.

[0018] Optionally, the drug may be taken orally or parenterally.

[0019] The present invention discloses the following technical effects:

[0020] The present invention found that tamarind polysaccharide can promote the growth of AR1098 and enhance its lipid-lowering function. Specifically, tamarind polysaccharide can cooperate with AR1098 to significantly reduce the triglyceride and cholesterol content in the liver of mice, improve the changes in the blood lipid level of mice; can significantly restore the liver tissue morphology of mice, reduce liver damage in mice, and reduce lipid accumulation in the liver; can upregulate the expression of genes involved in the conversion between cholesterol and bile acid, downregulate the gene expression of SREBP-1C that inhibits TG transport, and reduce fatty acid synthesis in the liver, thereby alleviating hyperlipidemia in mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The effects of tamarind polysaccharides and grapes on the growth of AR1098;

[0023] Figure 2 The changes of serum cholesterol (A), triglyceride (B), high-density lipoprotein (C) and low-density lipoprotein (D) in each group of mice;

[0024] Figure 3 Blood lipid indexes, tissue morphology, liver cell damage and liver lipid accumulation in the liver of mice in each group; A: liver morphology; B: liver HE staining; C: liver oil red O staining; D: triglyceride content in the liver; E: cholesterol content in the liver;

[0025] Figure 4are the changes in inflammation levels of mice in each group; AC are the gene expressions of TNF-α, IL-6 and IL-1β in the liver; DF are the changes in the levels of TNF-α, IL-6 and IL-1β in serum;

[0026] Figure 5 The gene expressions of CYP7A1 (A), CYP8B1 (B), SREBP-1C (C), ACC (D), PPAR-α (E) and FAS (F) in the liver of mice in each group. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The tamarind polysaccharide used in the present invention is purchased from Yunnan Maoduoli Group Food Co., Ltd.

[0033] Example 1 Isolation, cultivation and preservation of Parabacteroides distichous AR1098

[0034] Healthy human feces were collected and diluted by the concentration gradient dilution method. 100 μL of the dilution solution was spread on a BHI medium plate and cultured anaerobically at 37°C for 48 h. Colonies with different characteristics were picked onto new BHI medium plates according to their shape, size, color, etc., and separated and purified by streaking to obtain isolated strains. The DNA of the obtained strains was extracted and the 16srDNA sequence was obtained after PCR amplification using the universal primers 27F / 1492R for 16srDNA fragments. The highly homologous comparison of the strains was performed at NCBI, and the purified strain was identified as Parabacteroides distichous, which was named Parabacteroides distichous AR1098.

[0035] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO. 1);

[0036] 1492R: 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO. 2).

[0037] The above-mentioned Parabacteroides distasonis AR1098 strain was deposited at the General Microbiology Center of China Microorganism Culture Collection Administration on October 23, 2024, with the deposit number CGMCC No. 32321, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0038] Example 2 Effect of Tamarind Polysaccharide on the Growth of AR1098

[0039] This example detects the effects of tamarind polysaccharides and glucose on the growth of AR1098.

[0040] The glycogen in the BHI liquid medium was replaced with tamarind polysaccharide and glucose, respectively, and AR1098 was cultured under anaerobic conditions. The OD at different times was measured. 600 value.

[0041] The results are as follows Figure 1 As shown, compared with glucose, tamarind polysaccharide can better promote the growth of strain AR1098.

[0042] Example 3 Tamarind polysaccharide cooperates with AR1098 to relieve hyperlipidemia

[0043] 1. Solution preparation

[0044] 0.9% saline: Weigh 9 g NaCl, add 1000 mL distilled water to fully dissolve it, and then place it in an autoclave for sterilization at 121°C for 20 min.

[0045] Preparation of tamarind polysaccharide solution: a certain amount of tamarind polysaccharide is dissolved in 0.9% normal saline to prepare a 1 mmol / L tamarind polysaccharide solution.

[0046] Preparation of Parabacteroides distichous AR1098 bacterial suspension: centrifuge the third generation of bacterial suspension at 4°C, 6000rpm (inoculation volume of each generation is 3%, growth time is 16h), discard the supernatant, resuspend in 0.9% saline, repeat the above steps 3 times until the supernatant after centrifugation is colorless and transparent. 600 The relationship between the absorbance value and bacterial concentration was studied. The bacterial concentration was adjusted using a UV-visible spectrophotometer so that the final concentration of the bacterial suspension was 10 9 CFU / mL.

[0047] Preparation of the mixed solution of Parabacteroides distiliensis AR1098 bacterial suspension and tamarind polysaccharide: take tamarind polysaccharide solution and Parabacteroides distiliensis AR1098 bacterial suspension in a volume ratio of 1:1 to prepare.

[0048] 2. Animal grouping

[0049] First, C57BL / 6J male mice aged 4 weeks were selected, weighing 180g±10g. After 7 days of adaptation, they were randomly divided into 5 groups: blank control group (Control, ordinary feed), and the other four groups were fed with high-fat feed. After 5 weeks of intervention, the mice fed with high-fat feed were randomly divided into model group (Model), Bacteroides group (AR1098), tamarind polysaccharide group (TPG) and Bacteroides and tamarind polysaccharide synergistic intervention group (TPG+AR1098), and the corresponding Parabacteroides distiliensis AR1098 suspension, tamarind polysaccharide solution or Parabacteroides distiliensis AR1098 suspension and tamarind polysaccharide mixture 200μL were given by gavage. Intervention lasted for 5 weeks.

[0050] After the intervention, the mice were anesthetized, blood was collected from the eyeballs, and the blood was allowed to stand for 30 minutes, then centrifuged at 3000 rpm for 10 minutes. The serum was collected, packaged, and stored in a -80°C refrigerator. The liver was removed and photographed. A portion was placed in 4% paraformaldehyde for making slices. The rest of the liver was packaged, quickly frozen in liquid nitrogen, and stored at -80°C.

[0051] Determination of blood lipid indexes in mouse serum and liver. Observation of mouse liver tissue morphology. And determination of changes in gene expression and protein levels related to mouse inflammation level. In addition, determination of the expression of genes related to lipid-lowering by Bacteroides.

[0052] 3. Index determination

[0053] 3.1 Blood lipid index

[0054] The test kits manufactured in Nanjing were used to measure the levels of TC (cholesterol), TG (triglycerides), HDL-C (high-density lipoprotein) and LDL-C (low-density lipoprotein) in serum and liver according to the instructions.

[0055] The results are as follows Figure 2 As shown in the figure, compared with the control group, the TC, TG and LDL-C levels of the model group were significantly increased, and the HDL-C level was significantly decreased; compared with the model group, the TC and TG levels of the Bacteroides group and the Bacteroides and tamarind polysaccharide synergistic intervention group were significantly decreased, and the effect of the synergistic intervention group was more significant. For the LDL-C level, AR1098 intervention did not significantly change, while the AR1098 and tamarind polysaccharide synergistic intervention group could significantly reduce its level. For the HDL-C level, AR1098 intervention did not significantly change, while the AR1098 and tamarind polysaccharide synergistic intervention group could significantly increase its level.

[0056] 3.2 Analysis of liver pathological staining

[0057] After embedding, the liver of mice was stained with HE and Oil Red O to observe the changes of liver morphology and to determine the contents of TG and TC in the liver.

[0058] like Figure 3 As shown, strain AR1098 intervention or synergistic intervention of AR1098 and tamarind polysaccharide can restore liver morphology and significantly downregulate TC and TG contents in the liver, indicating a downward trend in lipid accumulation.

[0059] 3.3 Inflammation Level

[0060] To measure the changes in the level of inflammation in mice, the relative expression levels of TNF-α, IL-6 and IL-1β in serum and their contents in the liver were measured using the kits built in Nanjing according to the instructions.

[0061] The results are as follows Figure 4 As shown, strain AR1098 intervention or synergistic intervention of AR1098 and tamarind polysaccharide could significantly reduce the levels of TNF-α and IL-1β in liver and serum; for IL-6, strain AR1098 intervention and synergistic intervention of AR1098 and tamarind polysaccharide could significantly reduce its content in liver.

[0062] 3.4 Expression of lipid-related genes

[0063] Total RNA from liver tissue was extracted by Trizol (Thermo Fisher Scientific, Waltham, MA, USA). RNA concentration and quality were assessed by Nano Drop 2000 spectrophotometer (Thermo Scientific, USA). The extracted RNA was used to prepare cDNA according to the qPCR reagent instructions of HiScript III RT SuperMix (Vazyme, Nanjing, China), and PCR amplification was performed using the Hieff qPCR SYBR Green Master Mix reagent instructions (Yeasen Biotech, Shanghai, China). All primer sequences were synthesized by BGI Beijing Genomics Institute (Shenzhen, China), and the primer sequences are shown in Table 1. All operation steps were performed according to the manufacturer's protocol. According to 2 -ΔΔCt The relative mRNA levels were calculated to obtain the relative expression of lipid-related genes (CYP7A1, CYP8B1, SREBP-1C, ACC, PPAR-α, and FAS).

[0064] Table 1 PCR primer sequences

[0065] Gene Primer sequence (5'-3') GAPDH-F TCCTTGGAGGCCATGTGGGCCAT GAPDH-R TGATGACATCAAGAAGGTGGTGAAG CYP7A1-F AGCAACTAAACAACCTGCCAGTACTA CYP7A1-R GTCCGGATATTCAAGGATGCA CYP8B1-F GGCTGGCTTCCTGAGCTTATT CYP8B1-R ACTTCCTGAACAGCTCATCGG SREBP-1C-F GCCGGCGCCATGGACGAGCTGG SREBP-1C-R CAGGAAGGCTTCCAGAGAGGAG ACC-F GCCATCCGGTTTGTTGTCA ACC-R GGATACCTGCAGTTTGAGCCA PPAR-α-F CCTGGAAAGTCCCTTATCT PPAR-α-R GCCCTTACAGGCCTTCACAT FAS-F CTGCCACAACTCTGAGGACA FAS-R TTCGTACCTCCTTGGCAAAC

[0066] like Figure 5 As shown, the results showed that strain AR1098 intervention or synergistic intervention of AR1098 and tamarind polysaccharide could significantly upregulate the expression of genes (CYP7A1, CYP8B1 and PPAR-α) involved in the conversion between cholesterol and bile acid, and downregulate the expression of SREBP-1C, ACC and FAS that inhibit TG transport.

[0067] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Parabacteroides distasonis AR1098, characterized in that: The deposit number of the Parabacteroides distichous is CGMCC No.32321.

2. The use of tamarind polysaccharide and Parabacteroides distiliensis AR1098 in the preparation of a drug for relieving hyperlipidemia, characterized in that: The deposit number of the Parabacteroides distichous AR1098 is CGMCC No.32321.

3. The use according to claim 2, characterized in that The tamarind polysaccharide promotes the growth of the Parabacteroides dieltii AR1098 and enhances the lipid-lowering ability of the Parabacteroides dieltii AR1098.

4. A drug for alleviating hyperlipidemia, characterized in that: The active ingredients of the drug are tamarind polysaccharide and Parabacteroides distiliensis AR1098; The deposit number of the Parabacteroides distichous AR1098 is CGMCC No.32321.

5. The drug according to claim 4, characterized in that The concentration of the Parabacteroides distichum AR1098 was 10 9 CFU / mL.

6. The drug according to claim 4, characterized in that The volume ratio of the tamarind polysaccharide to the Parabacteroides dieldii AR1098 is 1:

1.

7. The drug according to claim 4, characterized in that The drug further comprises pharmaceutically acceptable excipients.

8. The drug according to claim 7, characterized in that The auxiliary materials include at least one of diluents, fillers, excipients, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, lubricants and flavoring agents.

9. The drug according to claim 4, characterized in that The dosage form of the drug includes a liquid dosage form.

10. The drug according to claim 4, characterized in that The administration method of the drug includes oral or parenteral administration.

Images