Efficient biodegradation method of high-concentration dichloromethane and engineering bacteria

Abstract

The invention discloses an efficient biodegradation method of high-concentration dichloromethane and an engineering bacterium. Mixed thalli of recombinant escherichia coli for heterologous expression of DCM dehalogenase and recombinant escherichia coli for heterologous expression of formaldehyde dehydrogenase or wet thalli of recombinant escherichia coli for co-expression of DCM dehalogenase and formaldehyde dehydrogenase are adopted as a catalyst for catalytic degradation of dichloromethane, and DCM within 500 mg / L can be completely degraded within 8 h. Compared with recombinant escherichia coli singly adopting the DCM-containing dehalogenase gene, the time for degrading 500mg / L of DCM is shortened from 22h to 8h, the degradation rate reaches 0.781 mM / h, and the substrate concentration and efficiency are obviously improved. The invention establishes a dichloromethane degradation treatment method which is easy to operate, low in cost and high in efficiency.

Description

(I) Technical field

[0001] The invention belongs to the field of environmental biotechnology, and particularly relates to a high-efficiency biodegradation method and engineering bacteria for high-concentration dichloromethane. (II) Background technology

[0002] Dichloromethane (DCM) is widely used in biomedicine, chemical industry, materials, petroleum and other industries. It is a widely used organic solvent, which is highly volatile, basically insoluble in water, and easily soluble in organic reagents such as aldehydes, ketones, ether and ethanol. Because it contains halogen atoms, its stability is greatly increased, making it difficult to degrade. DCM has strong carcinogenic, teratogenic and mutagenic effects.

[0003] At present, the treatment of DCM pollution mainly includes physical, chemical and biological methods. There are some shortcomings in the treatment of DCM in the environment by physical and chemical methods, such as high operating costs, high energy consumption, and easy formation of secondary pollution. In contrast, biological treatment of DCM has the advantages of low operating costs, low energy consumption, no secondary pollution and easy operation, and has attracted much attention. Methylobacterium rhodesianum H13 is currently reported to be a strain with good DCM degradation effect. The key to its degradation of DCM is that it contains DCM dehalogenase, which belongs to glutathione transferase. In the presence of coenzyme glutathione, DCM dehalogenase can catalyze the degradation of DCM to produce formaldehyde. Wild-type DCM-degrading bacteria, including Methylobacterium rhodesianum H13, often have problems such as long culture cycle, low biomass, and low amount of intracellular enzymes. These unfavorable factors will affect the degradation of DCM. To this end, Liu Liang heterologously expressed the DCM dehalogenase from Methylobacterium rhodesiensis H13 in Escherichia coli BL21 (DE3), and purified the recombinant DCM dehalogenase, and found that its degradation rate of DCM was 0.479mM / h. However, this reaction not only requires the preparation of pure enzymes, but also the addition of coenzyme glutathione to the catalytic system. The degradation concentration of DCM is only 25mg / L and loses its degradation activity after 180min (Liu Liang. Study on the cloning, expression and characteristics of DCM dehalogenase genes. Master's thesis of Zhejiang University of Technology, 2015.). In addition, the preparation of pure enzymes is often cumbersome, costly, and easy to inactivate.

[0004] The formaldehyde produced by the catalytic degradation of dichloromethane may be toxic to cells such as Escherichia coli, which will limit the efficient biodegradation of dichloromethane, especially for the biodegradation of high-concentration dichloromethane. Therefore, it is necessary to find a biological method that can efficiently degrade high-concentration DCM. (III) Summary of the invention

[0005] The purpose of the present invention is to provide a high-concentration dichloromethane efficient biodegradation method and engineering bacteria. The present invention uses a mixed cell of a recombinant Escherichia coli heterologously expressing a DCM dehalogenase and a recombinant Escherichia coli heterologously expressing a formaldehyde dehydrogenase or a wet cell of a recombinant Escherichia coli co-expressing a DCM dehalogenase and a formaldehyde dehydrogenase as a catalyst to catalyze the degradation of dichloromethane. First, the whole cell containing the DCM dehalogenase catalyzes the biodegradation of dichloromethane and simultaneously produces formaldehyde as a byproduct; then the wet cell containing the formaldehyde dehydrogenase FADH can catalyze the biodegradation of formaldehyde, a byproduct of dichloromethane degradation, and can achieve one-step efficient degradation of high-concentration dichloromethane. The method solves the problems of the byproduct formaldehyde in the existing method of biocatalytic degradation of dichloromethane being toxic to cells such as Escherichia coli, limiting the degradation of high-concentration dichloromethane, long catalytic time, and low efficiency.

[0006] The technical solution adopted by the present invention is:

[0007] The invention provides a method for efficiently degrading high-concentration dichloromethane. The method comprises the following steps: using a mixed cell obtained by mixing wet cells of a recombinant Escherichia coli containing a DCM dehalogenase gene and a recombinant Escherichia coli containing a formaldehyde dehydrogenase gene, or wet cells of a recombinant Escherichia coli co-expressing the DCM dehalogenase gene and the formaldehyde dehydrogenase gene as a catalyst, using dichloromethane as a substrate, forming a reaction system in a buffer solution of pH 6-8, and reacting at 20-30° C. and 100-300 rpm (preferably 25° C. and 150 rpm) to achieve efficient degradation of dichloromethane.

[0008] Furthermore, the DCM dehalogenase gene is derived from Methylobacterium rhodesianum H13, and the nucleotide sequence is shown in SEQ ID NO.1.

[0009] Further, the formaldehyde dehydrogenase gene is derived from Pseudomonas aeruginosa PAO1, and the nucleotide sequence is shown in SEQ ID NO.2; or the formaldehyde dehydrogenase gene is derived from Methylobacterium rhodesianum H13, and the nucleotide sequence is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0010] Furthermore, the recombinant Escherichia coli used for expressing DCM dehalogenase gene and formaldehyde dehydrogenase gene alone or together in the present invention all use pET28a plasmid as the basic vector and Escherichia coli BL21 (DE3) as the host bacteria.

[0011] Furthermore, the wet cell mass ratio of the recombinant Escherichia coli containing the DCM dehalogenase gene and the recombinant Escherichia coli containing the formaldehyde dehydrogenase gene in the mixed cells is 1:0.2-5, preferably 1:1; the final concentration of the mixed cells or the co-expression wet cells is 10-100 g / L, preferably 26.89 g / L.

[0012] Furthermore, the dichloromethane is added to a final concentration of 100-500 mg / L.

[0013] Furthermore, the buffer is a PB buffer with a pH of 7.2 and 100 mM.

[0014] Furthermore, glutathione is added to the reaction system at a final concentration of 1-5 mM, preferably 2 mM.

[0015] Further, the wet cells are prepared as follows:

[0016] The recombinant E. coli was inoculated into LB solid medium containing 50 mg / L kanamycin and cultured at 37°C for 12 h; the colony was inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured at 37°C and 150 rpm overnight to obtain seed solution; the seed solution was inoculated into a new LB liquid medium containing 50 mg / L kanamycin at an inoculum concentration of 1% by volume and cultured at 37°C and 150 rpm until OD 600 =0.4-0.6, then add IPTG to a final concentration of 0.2mM, and culture at 20°C, 150rpm shaking for 10h. The culture solution was centrifuged at 8000rpm for 5min, and the precipitate was washed and centrifuged three times with pH=7.2, 100mM PB buffer to collect the wet cells.

[0017] The invention also provides a recombinant Escherichia coli containing a DCM dehalogenase gene for efficiently degrading dichloromethane.

[0018] The present invention also provides a recombinant Escherichia coli containing a formaldehyde dehydrogenase gene for efficiently degrading formaldehyde generated in the process of degrading dichloromethane.

[0019] The invention also provides a recombinant Escherichia coli for co-expressing a DCM dehalogenase gene and a formaldehyde dehydrogenase gene for efficiently degrading dichloromethane.

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] (1) The concentration and efficiency of dichloromethane degradation by the method of the present invention are significantly improved.

[0022] The present invention uses a mixed cell obtained by mixing wet cells of a recombinant Escherichia coli containing a DCM dehalogenase gene and a recombinant Escherichia coli containing a formaldehyde dehydrogenase gene after induction culture or wet cells obtained by co-expression as a catalyst to degrade dichloromethane, and can completely degrade DCM within 500 mg / L within 8 hours. Compared with the recombinant Escherichia coli containing the DCM dehalogenase gene alone, the time for degrading 500 mg / L of DCM is shortened from 22 hours to 8 hours, the degradation rate reaches 0.781 mM / h, and the substrate concentration and efficiency are significantly improved.

[0023] (2) The method of the present invention is low-cost, simple and easy to operate.

[0024] The system provided by the present invention does not require complex operations such as cell disruption and purification, and the cells are easy to culture and prepare. The glutathione of Escherichia coli itself can catalyze the conversion of formaldehyde, a toxic byproduct in the degradation process of dichloromethane, into formic acid. The additional addition of glutathione can further improve the degradation efficiency and finally convert it into a substantially non-toxic metabolite. The present invention establishes an easy-to-operate, low-cost, and highly efficient dichloromethane degradation treatment method. (IV) Description of the drawings

[0025] Figure 1 This is a colony PCR verification diagram of the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm expressing DCM dehalogenase, M represents 2K Marker; 1-4 represent colony PCR products.

[0026] Figure 2 The figure shows the SDS-PAGE of the supernatant and purified solution of recombinant Escherichia coli BL21(DE3) / pET28a-dcm after induced expression and cell disruption; 1 represents the total cell lysate of Escherichia coli BL21(DE3) / pET28a containing an empty plasmid; 2 and 3 represent protein markers; 4-7 represent the supernatant of recombinant Escherichia coli BL21(DE3) / pET28a-dcm cell disruption and 200, 300, and 400 mM imidazole-nickel column protein purification solutions.

[0027] Figure 3 This is a curve chart showing the degradation of different concentrations of DCM by whole cells after induced expression of recombinant Escherichia coli BL21(DE3) / pET28a-dcm.

[0028] Figure 4This is a curve diagram of formaldehyde inhibiting the degradation of dichloromethane by recombinant Escherichia coli BL21 (DE3) / pET28a-dcm whole cells; DCM+HCHO represents the addition of 250 mg / L formaldehyde to the reaction solution of recombinant Escherichia coli BL21 (DE3) / pET28a-dcm whole cells degrading dichloromethane; DCM represents the addition of no formaldehyde to the reaction solution of recombinant Escherichia coli BL21 (DE3) / pET28a-dcm whole cells degrading dichloromethane.

[0029] Figure 5 This is the colony PCR verification image of the recombinant Escherichia coli BL21 (DE3) / pET28a-fadh expressing the formaldehyde dehydrogenase FADH derived from Pseudomonas aeruginosa PAO1; M represents the 2K Marker; 1-5 represent the colony PCR products (1739 bp).

[0030] Figure 6 This is the colony PCR verification image of the recombinant Escherichia coli expressing the endogenous formaldehyde dehydrogenase FADH of Methylobacterium rhodesiense; M represents the 2K Marker; 1-3 represent the colony PCR products of BL21(DE3) / pET28a-fadh1(1712bp), BL21(DE3) / pET28a-fadh2(1715bp) and BL21(DE3) / pET28a-fadh3(1712bp), respectively.

[0031] Figure 7 The figure is the SDS-PAGE image of the cell lysate after the recombinant Escherichia coli expressing formaldehyde dehydrogenase FADH was induced and the cells were broken; M represents protein marker; 1 represents the cell lysate of Escherichia coli BL21(DE3) / pET28a containing an empty plasmid; 2 represents the cell lysate of BL21(DE3) / pET28a-fadh1; 3 represents the cell lysate of BL21(DE3) / pET28a-fadh2; 4 represents the cell lysate of BL21(DE3) / pET28a-fadh3; 5 represents the cell lysate of BL21(DE3) / pET28a-fadh.

[0032] Figure 8 This is a curve chart of the co-catalytic degradation of 500 mg / L dichloromethane by whole cells of BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh(DCM+FADH) containing formaldehyde dehydrogenase of Pseudomonas aeruginosa PAO1, BL21(DE3) / pET28a-fadh1(DCM+FADH1) containing formaldehyde dehydrogenase of Methylobacterium rhodesiense H13, BL21(DE3) / pET28a-fadh2(DCM+FADH2), and BL21(DE3) / pET28a-fadh3(DCM+FADH3) containing formaldehyde dehydrogenase of Methylobacterium rhodesiense H13.

[0033] Fig. 9 This is a curve chart of the co-catalytic degradation of different concentrations of dichloromethane by whole cells of BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh bacteria.

[0034] Fig.10 The figure is a curve diagram of the effect of glutathione on the co-catalytic degradation of dichloromethane by recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh whole cells; DCM+FADH+GSH represents the exogenous addition of 2 mM glutathione to the reaction solution of the co-catalytic degradation of dichloromethane by recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh whole cells; DCM+FADH represents the absence of 2 mM glutathione in the reaction solution of the co-catalytic degradation of dichloromethane by recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh whole cells.

[0035] Fig.11 The graph shows the degradation of 500 mg / L dichloromethane by BL21(DE3) / pET28a whole cells (pET28a), BL21(DE3) / pET28a-dcm-fadh whole cells (pET28a-dcm-fadh), BL21(DE3) / pET28a-dcm / pBBR1MCS-5-fadh whole cells (pET28a-dcm / pBBR1MCS-5-fadh), and BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh double bacteria whole cells co-catalyzed (pET28a-dcm+pET28a-fadh). (V) Specific implementation methods

[0036] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0037] The Methylobacterium rhodesianum H13 used in the present invention has a deposit number of CCTCC No: M 2010121 and an invention patent publication number of CN 101993839.

[0038] Example 1: Construction of recombinant Escherichia coli BL21 (DE3) / pET28a-dcm

[0039] 1. Construction of DCM dehalogenase engineering bacteria

[0040] (1) Using the DCM dehydrogenase gene sequence of Methylobacterium rhodesiense H13 (GenBank: AIN35010.1) as a template, primers DCMF (sequence: 5'GTGAGCCCGAATCCAACG 3') and DCMR (sequence: 5'CTAAGCGACTGCCGCG3') were used for PCR amplification to obtain the DCM dehalogenase target gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0041] (2) Using plasmid pET28a as a template, reverse PCR amplification was performed with primers 28aF (sequence: 5'CGCGGCAGTCGCTTAGCAAGCTTGCGGCCGCACTCG3') and 28aR (sequence: 5'CGTTGGATTCGGGCTCACTCGACGGAGCTCGAATTCGG3') to obtain a linearized plasmid.

[0042] (3) Using a one-step cloning enzyme kit (Beijing Quanshijin Biotechnology), the two fragments of step (1) and (2) were ligated at 50°C for 5-15 min and transformed into Escherichia coli BL21 (DE3) competent cells. After molecular identification and screening, colony PCR gel electrophoresis was performed. Figure 1 As shown, recombinant Escherichia coli BL21 (DE3) / pET28a-dcm was obtained.

[0043] The same method was used to construct Escherichia coli BL21(DE3) / pET28a containing an empty plasmid.

[0044] 2. Induced expression and verification of engineered bacteria

[0045] The recombinant Escherichia coli BL21 (DE3) / pET28a-dcm was inoculated into LB solid medium containing 50 mg / L kanamycin and cultured at 37 ° C for 12 hours; the colony was inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured at 37 ° C, 150 rpm overnight to obtain seed liquid; the seed liquid was inoculated into a new LB liquid medium containing 50 mg / L kanamycin at an inoculum concentration of 1% by volume, and cultured at 37 ° C, 150 rpm until OD 600 =0.4-0.6, then add IPTG to a final concentration of 0.2mM, and culture at 20°C, 150rpm shaking for 10h. The culture solution was centrifuged at 8000rpm for 5min, and the precipitate was washed and centrifuged three times with pH=7.2, 100mM PB buffer to collect the wet cells.

[0046] The wet cells were suspended in the same volume of culture solution before centrifugation, pH = 7.2, 100mM PB buffer, 1mL of wet cell suspension was broken by 50W ultrasonic wave for 5min, working for 3s and 4s intervals, centrifuged at 12000rpm for 2min, and the supernatant and precipitate were collected respectively. The supernatant was analyzed by agarose gel electrophoresis. Figure 2 .

[0047] The supernatant collected in the previous step was purified by nickel column (Ni-IDA 6FF pre-loaded gravity column, 1 mL), the sample volume was 20 column volumes, first eluted with PB buffer containing 30 mM imidazole, pH = 7.2, 100 mM for 2 column volumes, and then eluted with PB buffer containing 200, 300, and 400 mM imidazole, pH = 7.2, 100 mM, respectively, for 5 column volumes each, and the effluent corresponding to each imidazole concentration was collected, and gel electrophoresis was performed. Figure 2 As shown, the total cell lysate of Escherichia coli BL21 (DE3) / pET28a containing an empty plasmid was used as a control, demonstrating that dichloromethane dehalogenase was successfully expressed.

[0048] Example 2: Degradation of different concentrations of dichloromethane by recombinant E. coli BL21(DE3) / pET28a-dcm whole cells

[0049] In a 50 mL vial, 10 mL of pH = 7.2, 100 mM PB buffer was added, and then the wet bacteria of the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm prepared by the method of Example 1 at a final concentration of 13.445 g / L and dichloromethane at a final concentration of 100 mg / L were added. The vial was sealed with a sealing strip and cultured on a shaker at 25 ° C and 150 rpm. The whole cell was used to efficiently catalyze dichloromethane. Every 1 hour, a sample was taken from the headspace of the vial and the residual dichloromethane was detected by gas chromatography. The results are shown in FIG. Figure 3 .

[0050] Under the same conditions, the concentration of dichloromethane was changed to 200, 300, and 500 mg / L respectively. Figure 3 It can be seen that E. coli BL21 (DE3) / pET28a-dcm whole cells can catalyze the degradation of 500 mg / L DCM within 22 hours. Theoretically, 500 mg / L of formaldehyde will be produced during the degradation of 500 mg / L dichloromethane. According to gas chromatography, the actual formaldehyde produced is 463.6 mg / L.

[0051] The conditions for gas chromatography detection of dichloromethane are as follows: the chromatographic column is SH-Rxi-17 (length 30m, inner diameter 0.32mm), the carrier gas is nitrogen, the inlet temperature is 250℃, the pressure is 110kPa, the detector temperature is 300℃, the chromatographic column temperature is 100℃, and the flow rate is 3.3mL / min.

[0052] Example 3: Formaldehyde inhibits the degradation of dichloromethane by recombinant Escherichia coli BL21(DE3) / pET28a-dcm whole cells

[0053] In a 50 mL vial, 10 mL of pH = 7.2, 100 mM PB buffer was added, and then the wet bacteria of the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm prepared by the method of Example 1 at a final concentration of 13.445 g / L and dichloromethane at a final concentration of 500 mg / L were added, and then 250 mg / L of formaldehyde (this is half the concentration of theoretical formaldehyde produced by complete degradation of 500 mg / L dichloromethane) was added. The vial was sealed with a sealing strip and cultured in a shaking table at 25 ° C and 150 rpm. Every 1 hour, a sample was taken from the headspace of the vial to detect the residual dichloromethane by gas chromatography. The reaction without adding formaldehyde under the same conditions was used as a control. The results are as follows Figure 4 As shown, the addition of formaldehyde significantly deteriorated the dichloromethane degradation effect of the reaction system, proving that the byproduct formaldehyde inhibited the efficiency of dichloromethane degradation by the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm whole cells.

[0054] Example 4: Construction and induced expression of recombinant Escherichia coli BL21 (DE3) / pET28a-fadh

[0055] 1. Construction of recombinant Escherichia coli BL21(DE3) / pET28a-fadh

[0056] (1) The formaldehyde dehydrogenase FADH gene sequence of Pseudomonas aeruginosa PAO1 (GenBank: WKE26037.1) was used as a template and primers FADHF (sequence: 5'CCGAATTCGAGCTCCGTCGAATGTCTGGCAATCGTGGTG3') and FADHR (sequence: 5'CGAGTGCGGCCGCAAGCTTGTCAGGCCGCGCGGAACAG3') were used for PCR amplification to obtain the formaldehyde dehydrogenase FADH target gene. The nucleotide sequence is shown in SEQ ID NO.2.

[0057] (2) Bioinformatics analysis showed that Methylobacterium rhodesianum H13 contains three endogenous formaldehyde dehydrogenases, namely FADH1 (gene sequence: GenBank: AP014809.1), FADH2 (gene sequence: GenBank: CP090580.1) and FADH3 (gene sequence: GenBank: CP001029.1). The gene sequences of three formaldehyde dehydrogenases FADH of Methylobacterium rhodesiense H13 were used as templates, and the primer pairs FADHF1 (sequence: 5'CCGAATTCGAGCTCCGTCGAATGAGGGCCCTCGTCTGG3') and FADHR1 (sequence: 5'CGAGTGCGGCCGCAAGCTTGTCAGGGCCGCAGCACGACC3'), primer pair FADHF2 (sequence: 5'CCGAATTCGAGCTCCGTCGAATGCGAGCGCTGGTTTGGCATG3') and FADHR2 (sequence: 5'CGAGTGCGGCCGCAAGCTTGTCAGGGTTTGAGGACGACCTTG3') and primer pair FADHF3 (sequence: 5'CCGAATTCGAGCTCCGTCGAATGAAAGCACTGTGCTGGC3') and FADHR3 (sequence: 5'CGAGTGCGGCCGCAAGCTTGTCAGTTCGGATGGAAGACGACC3') were used. 3') was amplified by PCR to obtain the target genes of formaldehyde dehydrogenase FADH of three Methylobacterium rhodesiensis H13, namely FADH1 (nucleotide sequence as shown in SEQ ID NO.3), FADH2 (nucleotide sequence as shown in SEQ ID NO.4) and FADH3 (nucleotide sequence as shown in SEQ ID NO.5).

[0058] (3) Using pET28a plasmid as template, reverse PCR amplification was performed with primers 28aF2 (sequence: 5'TCGACGGAGCTCGAATTCGG3') and 28aR2 (sequence: 5'CAAGCTTGCGGCCGCACTCG3') to obtain a linearized plasmid.

[0059] (4) The two fragments of step (1) and (3) were ligated by reacting at 50°C for 5-15 min using a one-step cloning enzyme kit (Beijing Quanshijin Biotechnology Co., Ltd.), and transformed into Escherichia coli BL21 (DE3) competent cells. After molecular identification and screening, recombinant Escherichia coli BL21 (DE3) / pET28a-fadh was obtained. The gel electrophoresis of colony PCR is shown in Figure 5 .

[0060] (5) The fragment obtained in step (2) and any fragment obtained in step (3) were ligated by reacting at 50°C for 5-15 min using a one-step cloning enzyme kit (Beijing Quanshijin Biotechnology Co., Ltd.), and transformed into Escherichia coli BL21 (DE3) competent cells. After molecular identification and screening, recombinant Escherichia coli BL21 (DE3) / pET28a-fadh1, BL21 (DE3) / pET28a-fadh2 and BL21 (DE3) / pET28a-fadh3 were obtained. The gel electrophoresis of colony PCR is shown in Figure 6 .

[0061] 2. Inducible expression of recombinant E. coli BL21(DE3) / pET28a-fadh, BL21(DE3) / pET28a-fadh1, BL21(DE3) / pET28a-fadh2 and BL21(DE3) / pET28a-fadh3

[0062] The recombinant Escherichia coli BL21(DE3) / pET28a-fadh, BL21(DE3) / pET28a-fadh1, BL21(DE3) / pET28a-fadh2 and BL21(DE3) / pET28a-fadh3 were inoculated into LB solid medium containing 50 mg / L kanamycin and cultured at 37°C for 12 h; the colonies were inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured at 37°C and 150 rpm overnight to obtain seed solution; the seed solution was inoculated into a new LB liquid medium containing 50 mg / L kanamycin at an inoculum concentration of 1% by volume, and cultured at 37°C and 150 rpm until OD 600 =0.4-0.6, then add IPTG to a final concentration of 0.2mM, and culture at 20°C, 150rpm shaking for 10h. The culture solution was centrifuged at 8000rpm for 5min, and the precipitate was washed and centrifuged three times with pH=7.2, 100mM PB buffer to collect the wet cells.

[0063] The wet cells were suspended in the same volume of culture solution before centrifugation, pH = 7.2, 100mM PB buffer, 1mL of the wet cell suspension was ultrasonically disrupted at 50W for 5min, working for 3s and 4s intervals, and centrifuged at 12000rpm for 2min. The cell lysate of Escherichia coli BL21 (DE3) / pET28a containing an empty plasmid was used as a control to compare the expression of formaldehyde dehydrogenase in the cell lysate expressing three formaldehyde dehydrogenases FADH from Methylobacterium rhodesiensis H13 and the cell lysate expressing formaldehyde dehydrogenase FADH from Pseudomonas aeruginosa PAO1. SDS-PAGE gel electrophoresis is shown in Figure 7 , all expressed the target band, proving that formaldehyde dehydrogenase was successfully expressed.

[0064] Example 5: Recombinant E. coli BL21(DE3) / pET28a-dcm degraded 500 mg / L of dichloromethane under co-catalytic conditions with BL21(DE3) / pET28a-fadh, BL21(DE3) / pET28a-fadh1, BL21(DE3) / pET28a-fadh2 and BL21(DE3) / pET28a-fadh3

[0065] The wet cells of the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm prepared by the method of Example 1 and the wet cells of the recombinant Escherichia coli BL21 (DE3) / pET28a-fadh, BL21 (DE3) / pET28a-fadh1, BL21 (DE3) / pET28a-fadh2, and BL21 (DE3) / pET28a-fadh3 prepared by the method of Example 4 were mixed in a mass ratio of 1:1 to obtain a mixed cell.

[0066] In a 50 mL vial, add mixed bacteria at a final concentration of 26.89 g / L and 10 mL of PB buffer at pH = 7.2, 100 mM, then add dichloromethane at a final concentration of 500 mg / L and glutathione at a final concentration of 2 mM. Seal with a sealing strip and culture in a shaker at 25 ° C and 150 rpm. Take samples every 1 hour and use gas chromatography to detect the residual dichloromethane. The results are shown in the table. Figure 8 The combined cells of recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh can completely degrade 500 mg / L of dichloromethane within 8 hours, with the best effect.

[0067] Example 6: Degradation of dichloromethane at different concentrations by whole cells under co-catalytic conditions of recombinant E. coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh

[0068] The Escherichia coli BL21 (DE3) / pET28a-dcm wet cells prepared by the method of Example 1 and the recombinant Escherichia coli BL21 (DE3) / pET28a-fadh wet cells prepared by the method of Example 4 were mixed in a mass ratio of 1:1 to prepare mixed cells.

[0069] In a 50 mL vial, add mixed bacteria at a final concentration of 26.89 g / L and 10 mL of pH = 7.2, 100 mM PB buffer, then add dichloromethane at a final concentration of 100, 200, 300, 500 mg / L and glutathione at a final concentration of 2 mM. Seal with a sealing strip and culture in a shaker at 25 ° C and 150 rpm. Take samples every 1 hour and use gas chromatography to detect the residual dichloromethane. The results are shown in the table. Fig. 9It can be seen that the mixed bacteria can completely degrade 100-500 mg / L of dichloromethane within 8 hours, which is 14 hours shorter than the time for the recombinant Escherichia coli BL21 (DE3) / pET28a-dcm wet bacteria to degrade 500 mg / L of dichloromethane alone, and the degradation rate reaches 0.781 mM / h.

[0070] Example 7: Effect of glutathione on whole-cell degradation of dichloromethane under co-catalytic conditions of recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh

[0071] The recombinant Escherichia coli BL21 (DE3) / pET28a-dcm wet cells prepared by the method of Example 1 and the recombinant Escherichia coli BL21 (DE3) / pET28a-fadh wet cells prepared by the method of Example 4 were mixed in a mass ratio of 1:1 to prepare a mixed cell.

[0072] In a 50 mL vial, add mixed bacteria at a final concentration of 26.89 g / L and 10 mL of pH = 7.2, 100 mM PB buffer, then add dichloromethane at a final concentration of 500 mg / L and glutathione at a final concentration of 2 mM, seal with a sealing strip, and culture in a shaker at 25 ° C and 150 rpm. Samples are taken every 1 hour and the residual amount of dichloromethane is detected by gas chromatography, and the reaction without adding glutathione is used as a control.

[0073] The results are as follows Fig.10 As shown, although the whole cells of recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh can also degrade dichloromethane under the co-catalytic conditions without the addition of glutathione (mainly using the endogenous glutathione of the recombinant Escherichia coli cells), the exogenous addition of 2mM glutathione can significantly promote the efficiency of dichloromethane degradation under the co-catalytic conditions of recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh.

[0074] Example 8: Construction and induced expression of single-cell catalytic systems of co-expressing recombinant Escherichia coli BL21 (DE3) / pET28a-dcm-fadh and co-expressing recombinant Escherichia coli BL21 (DE3) / pET28a-dcm / pBBR1MCS-5-fadh

[0075] Given that co-catalysis of BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh requires the cultivation and use of two recombinant E. coli, it was considered to express DCM dehalogenase and formaldehyde dehydrogenase FADH in the same E. coli to simplify the process.

[0076] 1. Construction of co-expression recombinant Escherichia coli BL21(DE3) / pET28a-dcm-fadh

[0077] (1) Using the pET28a-dcm plasmid prepared in Example 1 as a template, inverse PCR amplification was performed using primers 28a-dcmF (sequence: 5'AGCTTGCTAAGCGACTGCC3') and 28a-dcmR (sequence: 5'TGCGGCCGCACTCGAG3') to obtain a linearized plasmid.

[0078] (2) The formaldehyde dehydrogenase FADH gene sequence of Pseudomonas aeruginosa PAO1 was used as a template and primers FADHF4 (sequence: 5'GGCAGTCGCTTAGCAAGCTAAGGAGATATACCATGTCTGGCAATCGTGGTG3') and FADHR4 (sequence: 5'CTCGAGTGCGGCCGCATCAGGCCGCGCGGAACAG3') were used for PCR amplification to obtain the formaldehyde dehydrogenase FADH target gene.

[0079] (3) The two fragments of steps (1) and (2) were connected by reacting at 50°C for 5-15 min using a one-step cloning enzyme kit (Beijing Quanshijin Biotechnology Co., Ltd.), and transformed into Escherichia coli BL21 (DE3) competent cells. After molecular identification and screening, co-expression recombinant Escherichia coli BL21 (DE3) / pET28a-dcm-fadh was obtained.

[0080] 2. Construction of co-expression recombinant Escherichia coli BL21(DE3) / pET28a-dcm / pBBR1MCS-5-fadh

[0081] (1) Using pBBR1MCS-5 plasmid as template, inverse PCR amplification was performed with primers MCSF (sequence: 5'GGATCCACTAGTTCTAGAGCGG3') and MCSR (sequence: 5'CCGGGCTGCAGGAATTCG3') to obtain a linearized plasmid.

[0082] (2) The formaldehyde dehydrogenase FADH gene sequence of Pseudomonas aeruginosa PAO1 was used as a template and primers FADHF5 (sequence: 5'CCGCTCTAGAACTAGTGGATCCATGTCTGGCAATCGTGGTGTG3') and FADHR5 (sequence: 5'CGAATTCCTGCAGCCCGGGTCAGGCCGCGCGGAAC3') were used for PCR amplification to obtain the formaldehyde dehydrogenase FADH target gene.

[0083] (3) The two fragments of steps (1) and (2) were connected by reacting at 50°C for 5-15 min using a one-step cloning enzyme kit (Beijing Quanshijin Biotechnology Co., Ltd.), and transformed into Escherichia coli BL21 (DE3) competent cells. After molecular identification and screening, recombinant Escherichia coli BL21 (DE3) / pBBR1MCS-5-fadh was obtained.

[0084] (4) The plasmid pET28a-dcm of Escherichia coli BL21(DE3) / pET28a-dcm and the plasmid pBBR1MCS-5-fadh of recombinant Escherichia coli BL21(DE3) / pBBR1MCS-5-fadh were extracted respectively, and co-transformed into competent cells of Escherichia coli BL21(DE3). After molecular identification and screening, co-expressing recombinant Escherichia coli BL21(DE3) / pET28a-dcm / pBBR1MCS-5-fadh were obtained.

[0085] 3. Under the co-catalytic conditions of recombinant Escherichia coli BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh, recombinant Escherichia coli BL21(DE3) / pET28a-dcm-fadh whole cells and recombinant Escherichia coli BL21(DE3) / pET28a-dcm / pBBR1MCS-5-fadh whole cells degraded 500 mg / L of dichloromethane.

[0086] The wet cells of Escherichia coli BL21 (DE3) / pET28a-dcm, co-expressing recombinant Escherichia coli BL21 (DE3) / pET28a-dcm-fadh and co-expressing recombinant Escherichia coli BL21 (DE3) / pET28a-dcm / pBBR1MCS-5-fadh were prepared by the method of Example 1, and the wet cells of recombinant Escherichia coli BL21 (DE3) / pET28a-fadh were prepared by the method of Example 4.

[0087] The recombinant Escherichia coli BL21 (DE3) / pET28a-dcm wet cells and the recombinant Escherichia coli BL21 (DE3) / pET28a-fadh wet cells were mixed at a mass ratio of 1:1 to prepare mixed cells.

[0088] In a 50mL vial, add 10mL of pH=7.2, 100mM PB buffer, add mixed bacteria or co-expressed wet bacteria at a final concentration of 26.89g / L (with wet bacteria containing empty plasmid as control), dichloromethane at a final concentration of 500mg / L, and then add glutathione at a final concentration of 2mM. Seal with a sealing strip, culture at 25°C, 150rpm shaking, and use whole cells to efficiently catalyze the degradation of dichloromethane. Every 1 hour, sample the headspace of the vial and use gas chromatography to detect the residual dichloromethane. The results are as follows: Fig.11 The BL21(DE3) / pET28a-dcm and BL21(DE3) / pET28a-fadh mixed bacterial catalytic system can completely degrade 500 mg / L DCM within 8 hours, and the single recombinant Escherichia coli BL21(DE3) / pET28a-dcm-fadh can completely degrade 500 mg / L dichloromethane within 12 hours. The degradation effect of BL21(DE3) / pET28a-dcm / pBBR1MCS-5-fadh is poor, which provides another simpler strategy for the degradation of high-concentration dichloromethane.

Claims

1. A highly efficient biodegradation method for high-concentration dichloromethane, characterized in that: The method comprises the following steps: using a mixed cell obtained by mixing wet cells of a recombinant Escherichia coli containing a DCM dehalogenase gene and a recombinant Escherichia coli containing a formaldehyde dehydrogenase gene, or wet cells of a recombinant Escherichia coli co-expressing the DCM dehalogenase gene and the formaldehyde dehydrogenase gene as a catalyst, using dichloromethane as a substrate, forming a reaction system in a buffer solution of pH 6-8, and reacting at 20-30° C. and 100-300 rpm to achieve efficient degradation of dichloromethane.

2. The method according to claim 1, characterized in that The nucleotide sequence of the DCM dehalogenase gene is shown in SEQ ID NO.

1.

3. The method according to claim 1, characterized in that The nucleotide sequence of the formaldehyde dehydrogenase gene is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

4. The method according to claim 1, characterized in that The wet bacterial mass ratio of the recombinant Escherichia coli containing the DCM dehalogenase gene and the recombinant Escherichia coli containing the formaldehyde dehydrogenase gene in the mixed bacterial cells is 1:0.2-5; the final concentration of the catalyst added is 10-100 g / L.

5. The method according to claim 1, characterized in that The final concentration of the added dichloromethane is 100-500 mg / L.

6. The method according to claim 1, characterized in that The buffer solution is PB buffer solution with pH=7.2 and 100 mM.

7. The method according to claim 1, characterized in that Glutathione is added to the reaction system at a final concentration of 1-5 mM.

8. The method according to claim 1, characterized in that The wet cells are prepared as follows: The recombinant E. coli was inoculated into LB solid medium containing 50 mg / L kanamycin and cultured at 37°C for 12 h; the colony was inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured at 37°C and 150 rpm overnight to obtain seed solution; the seed solution was inoculated into a new LB liquid medium containing 50 mg / L kanamycin at an inoculum concentration of 1% by volume and cultured at 37°C and 150 rpm until OD 600 =0.4-0.6, then add IPTG to a final concentration of 0.2mM, and culture at 20°C, 150rpm shaking for 10h. The culture solution was centrifuged at 8000rpm for 5min, and the precipitate was washed and centrifuged three times with pH=7.2, 100mM PB buffer to collect the wet cells.

9. A recombinant Escherichia coli containing a DCM dehalogenase gene for efficiently degrading dichloromethane according to claim 1 or a recombinant Escherichia coli containing a formaldehyde dehydrogenase gene for efficiently degrading formaldehyde generated during the degradation of dichloromethane.

10. A recombinant Escherichia coli co-expressing a DCM dehalogenase gene and a formaldehyde dehydrogenase gene for efficiently degrading dichloromethane according to claim 1.

Images