PDCoV JS2021-LX strain NS7 gene mutation recombinant virus and construction method thereof

Abstract

The invention discloses a PDCoV JS2021-LX strain NS7 gene mutation recombinant virus and a construction method thereof, based on a PDCoV infectious clone successfully constructed by a BAC system, the upstream and downstream of the NS7 gene are cut by adopting a CRISPR / Cas9 technology, then the original NS7 gene segment is replaced by a homologous recombination mode to obtain an NS7 gene mutation recombinant plasmid, and the recombinant plasmid is subjected to NS7 gene mutation to obtain the NS7 gene mutation recombinant virus. And after the LLC-PK1 cell is transfected, the recombinant virus of the mutant NS7 protein is rescued. The recombinant virus with the PDCoV NS7 gene mutation is successfully rescued, the virus replication level of the recombinant virus and the virus is rescued in the in-vivo and in-vitro aspects, and pig body challenge experiment results show that the recombinant virus has infectivity to a pig body, the toxicity of the recombinant virus is equivalent to that of a wild virus, and the recombinant virus can be used as a candidate virus strain for marking an inactivated vaccine.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a PDCoV JS2021-LX strain NS7 gene mutation recombinant virus and a construction method thereof. Background Art

[0002] Porcine Delta coronavirus (PDCoV) belongs to the genus Delta coronavirus of the family Coronavirus. It is a newly popular enteric coronavirus in recent years. It can infect pigs of all ages, especially piglets, causing diarrhea, coughing, vomiting, dehydration, lethargy, and even death in newborn piglets. Its clinical symptoms and pathological changes are very similar to those of porcine epidemic diarrhea (PEDV) and transmissible gastroenteritis virus (TGEV), and it is difficult to distinguish them clinically. PDCoV is often co-infected with PEDV, TGEV, and porcine rotavirus (PRoV), which brings great difficulties to the prevention and control of enteric diarrhea diseases in pigs and huge losses to the pig farming industry. Studies have shown that PDCoV has obvious intestinal pathogenicity. It can cause severe vomiting and diarrhea symptoms in suckling piglets clinically, but it is often not fatal in adult pigs, showing transient infection; autopsy shows characteristic intestinal lesions, mainly concentrated in the jejunum and ileum, showing villous atrophy and. In addition, PDCoV can be transmitted across species, and there are reports that calves and poultry can be infected as hosts, with calves that have been orally vaccinated with PDCoV showing continuous fecal excretion, and chickens infected with PDCoV showing mild diarrhea symptoms. Although there are currently no reports of PDCoV infecting humans, a 2021 transcriptomic report on PDCoV infection of pig and human intestinal epithelial cells showed that human cells showed more differential genes in response to PDCoV infection than pig-derived cells, so it is speculated that humans may be a new host for PDCoV.

[0003] Reverse genetics operating system refers to the construction of viral infectious molecular clones and the in vitro artificial modification of viral cDNA molecules to study the biological functions of viruses. Bacterial artificial chromosome (BAC) is a bacterial chromosome cloning vector constructed based on F-plasmid, which can be used to clone DNA of about 150kb-300kb. The establishment of a reverse genetics operating system for viruses includes the cloning and modification of full-length cDNA of the genome, including gene mutation, deletion and insertion. On the one hand, the function of the corresponding viral protein can be studied through gene deletion or mutation, and the virus's natural immune response escape strategy can be explored; on the other hand, the viral genome can be modified through site-directed mutagenesis to obtain vaccine candidate strains. At present, a variety of coronaviruses have successfully obtained the construction of infectious cloning vectors through the BAC reverse genetics system. The BAC system has become a mature reverse genetics construction system and an important means and technology for studying the pathogenic mechanism of viruses.

[0004] Different types of coronaviruses encode different accessory proteins. Accessory proteins are a type of protein with special functions. There are great differences in the accessory proteins encoded by coronaviruses of different species. Although accessory proteins are not essential for the proliferation of coronaviruses, they play an important role in regulating the host's natural immunity and viral replication. PDCoV has three accessory proteins, namely NS6, NS7 and NS7a. NS6 is located between the M gene and the N gene, NS7 is located inside the N gene, and NS7a is also located inside the N gene and is smaller than NS7. At present, the function of PDCoV's accessory proteins is not thoroughly studied, but the accessory proteins of most coronaviruses have been shown to participate in the host's innate immune response, regulate the production of viral interferon, and thus affect the replication and proliferation of the virus. In 2017, Fang et al.

[18] It was found that NS7a can inhibit the IFN-β promoter activity induced by Sendai virus, but the effect of the auxiliary protein NS7 on the pathogenicity of PDCoV remains to be studied. Therefore, based on the previously constructed porcine deltacoronavirus infectious clone plasmid, our research group used CRISPR / Cas9 technology to transform it, constructed a recombinant porcine deltacoronavirus infectious clone plasmid with NS7 gene mutation, obtained recombinant virus by transfection, and evaluated its virulence and pathogenicity through in vitro cell tests and pig tests. Summary of the invention

[0005] The object of the present invention is to provide a PDCoV JS2021-LX strain NS7 gene mutation recombinant virus and a construction method thereof.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] In the first aspect, the present invention claims a method for constructing a recombinant virus with a NS7 gene mutation of the PDCoV JS2021-LX strain, the method comprising the following steps:

[0008] (1) Construction of ΔNS7-sgRNA:

[0009] A pair of gRNAs were designed upstream and downstream of the NS7 gene. The gRNAs were annealed with scaffold oligo to form double strands as transcription templates for sgRNA-ΔNS7a and sgRNA-ΔNS7b, and then transcribed in vitro by T7 transcriptase to obtain sgRNAs with recognition ability.

[0010] (2) Linearization of pBAC-PDCoV vector:

[0011] The pBAC-PDCoV vector was cut using Cas9 endonuclease and sgRNA to remove the NS7 gene and obtain the linearized vector pBAC-PDCoV.

[0012] (3) Amplification of the overlap fragment containing the NS7 mutant gene:

[0013] Primers were designed to amplify NS7-up, NS7 mutant gene fragments and NS7-down fragments respectively, and homology arms were added at the same time. The three fragments were then connected together by overlap PCR to obtain an overlap product containing the NS7 mutant gene;

[0014] (4) Construction of pBAC-PDCoV-ΔNS7 vector:

[0015] The linearized vector pBAC-PDCoV was connected to the overlap fragment containing the NS7 mutant gene by homologous recombination, and the connection product was transfected into LLC-PK1 cells to rescue the NS7 gene mutant recombinant virus.

[0016] Furthermore, the gRNA described in step (1) includes PD-ΔNS7a and PD-ΔNS7b, the nucleotide sequence of the PD-ΔNS7a is shown in SEQ ID NO.1, the nucleotide sequence of the PD-ΔNS7b is shown in SEQ ID NO.2; the nucleotide sequence of the scaffold oligo is shown in SEQ ID NO.3.

[0017] PD-ΔNS7a:

[0018] TTCTAATACGACTCACTATAGG CTCACACCAGTCGTTAAGCA GTTTTAGAGCTAGA (SEQ ID NO. 1)

[0019] PD-ΔNS7b:

[0020] TTCTAATACGACTCACTATAGG TAGGTGTAGCAGTCGCCCAG GTTTTAGAGCTAGA (SEQ ID NO. 2)

[0021] Scaffold oligo:

[0022] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC(SEQ ID NO.3)

[0023] Furthermore, the primers used to amplify the NS7-up fragment in step (3) are shown as SEQ ID NO.4 and SEQ ID NO.5; the primers used to amplify the NS7-down fragment are shown as SEQ ID NO.6 and SEQ ID NO.7; the primers used to amplify the NS7 mutant gene fragment are shown as SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequence of the NS7 mutant gene is shown as SEQID NO.10.

[0024] NS7-up-F:CTCACACCAGTCGTTAAGCA(SEQ ID NO.4)

[0025] NS7-up-R:TGCCACGAAACTGAGGATGAGTAG(SEQ ID NO.5)

[0026] NS7-down-F:CCAGACATGTGCCTGGTGTTC(SEQ ID NO.6)

[0027] NS7-down-R:CTAGTTGGCGCTTTCCCACTG(SEQ ID NO.7)

[0028] ΔNS7-F:CTCAGTTCGTGGCAACGGAGTTCCGCTTAAC(SEQ ID NO.8)

[0029] ΔNS7-R:CAGGCACATGTCTGG CTAGAGCCATGATGCGAG (SEQ ID NO.9)

[0030] NS7 mutant gene: ACG GAG TTC CGC TTAACT CCG CCA TCAAAC CCG TTG AAAACC ACGGCT ACT GGC TGC GTTACA CCA GAC AAAAGC CAG GTG GTA CTC CGA TTCCTC CAT CCT ACGCCT TTT ATT ATA CTG GCA CAG GTC CCA GAG GAA ATC TTAAGT ACG GTG AAC TCC CTCCTA CTG ACA CCC CAG CAA CCA CTC GTG TTA CTTGGG TTAAGG GTT CGG GAG CTG ACA CTTCTA TTAAGC CTC ACG TTG CCAAACGCA ACC CCA ACA ATC CTA AAC ATC AGC TGC TAC CTCTCC GAT TCC CAA CCGGAG ACG GCC CAG CTC AAG GTT TCA GAG TTG ACC CCT TCAACG CTAGAG GAAGAC CTC AGG AGC GTG GAA GTG GCC CAA GAT CTC AAT CTG TTAACT CCA GAGGCACAG GCAATC AGC CCA GGAAAC GCG ACC AAT CTG CAC CCG CTG CGG TACGTC GTAAGA CCCAAC ATC AAG CTC CCAAGC GGA CTT TAC CCAAGG GTAAAACCA TTT CTC AGG TAT TTG GCAACC GGT CTC GCA CTG GTG CCAACG TCG GCTCTG CAG ACA CTG AGAAGA CGG GTA TGG CTGATC CTC GCA TCA TGG CTC TAG (SEQ ID NO. 10).

[0031] Furthermore, the transcription system for in vitro transcription using T7 transcriptase in step (1) is: sgRNA transcription template 75 ng; NTPs MIX 5 μL; T7 transcriptase 1 μL; RNase free water is added to 15 μL, and transcription is carried out at 37°C overnight.

[0032] Furthermore, the enzyme digestion system for positioning and cutting the pBAC-PDCoV vector using cas9 endonuclease and sgRNA in step (2) is: 10xBuffer 5μL; sgRNA 2μL each; pBAC-PDCoV plasmid 5ug, RNase free water to 50μL, and enzyme digestion at 37°C overnight.

[0033] Further, the pBAC-PDCoV vector is a vector constructed by the following steps:

[0034] (1) The full-length gene of PDCoV is divided into 5 fragments: A, B, C, D, and E, and three restriction sites BmtI, BstBI and MluI are selected to determine the length of the 5 fragments. Each fragment is amplified by an overlap PCR method from a smaller fragment. The small fragments are divided into 10 fragments: A1, A2, B1, B2, C1, C2, D1, D2, E1, and E2. In order to distinguish the parent virus from the rescued virus, a mutation site T→A is introduced at position 17843 as a genetic molecular marker for the rescued virus. The primer sequences used to amplify the 10 fragments A1, A2, B1, B2, C1, C2, D1, D2, E1, and E2 are as follows:

[0035] PD-A1-F:ATGTAGTCTCCATGCTCAACCTGAT(SEQ ID NO.16)

[0036] PD-A1-R: TTGGGTGGCACTACATGCAAGATGCA (SEQ ID NO.17)

[0037] PD-A2-F:CATCTTGCATGTAGTGCCACCCAAAG(SEQ ID NO.18)

[0038] PD-A2-R: TGAAATGCACACATGCGCATTTTG (SEQ ID NO.19)

[0039] PD-B1-F: GTCGTTGCTCGCGCAATGCATAA (SEQ ID NO.20)

[0040] PD-B1-R: TCTAGCATCAACAGTCAGTAAGTGTGC (SEQ ID NO.21)

[0041] PD-B2-F:ACACTTACTGACTGTTGATGCTAGACC(SEQ ID NO.22)

[0042] <h2 style=";text-align:left;direction:ltr">PD-B2-R:CGTTGTAGCATTCCTCCTCGATTTCG(SEQ ID NO.23)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0043] <h2 style=";text-align:left;direction:ltr"> PD-C1-F:ACTTTGTTACTAAGCAGTGTGCAGCTA(SEQ ID NO.24)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0044] <h2 style=";text-align:left;direction:ltr"> PD-C1-R:GCTCTGCTAACACAGTATGCTGTG(SEQ ID NO.25)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0045] <h2 style=";text-align:left;direction:ltr"> PD-C2-F:ACAGCATACTGTGTTAGCAGAGCATG(SEQ ID NO.26)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0046] <h2 style=";text-align:left;direction:ltr"> PD-C2-R:ACTCTGAACATAGGTGCGACACG(SEQ ID NO.27)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0047] <h2 style=";text-align:left;direction:ltr"> PD-D1-F:GTTCCTAACACGTGACGCGTG(SEQ ID NO.28)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0048] <h2 style=";text-align:left;direction:ltr"> PD-D1-R:CATGGGTACTTGGGTCGATGTCAGTATACGT(SEQ ID NO.29)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0049] <h2 style=";text-align:left;direction:ltr"> PD-D2-F:CTGACATCGACCCAAGTACCCATGTTGTCCTCT(SEQ ID NO.30)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0050] <h2 style=";text-align:left;direction:ltr"> PD-D2-R:AGTTTATGTAAGAAGCGATGTGCACC(SEQ ID NO.31)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0051] <h2 style=";text-align:left;direction:ltr"> PD-E1-F:ATGATCTACTCGATTTGCTAACGTC(SEQ ID NO.32)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0052] <h2 style=";text-align:left;direction:ltr"> PD-E1-R:CCTCAGAAGTTTGATGGATGGCATGATT(SEQ ID NO.33)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0053] <h2 style=";text-align:left;direction:ltr"> PD-E2-F:CATGCCATCCATCAAACTTCTGAGG(SEQ ID NO.34)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0054] <h2 style=";text-align:left;direction:ltr"> PD-E2-R:AGCTTTGAGCACCTGAAACCAAGAC(SEQ ID NO.35);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0055] (2) pBAC vector transformation: The pBAC vector was transformed by inserting the CMV promoter as shown in SEQ ID NO.11, the 1499 bp bases at the 5' end of PDCoV as shown in SEQ ID NO.14, the BstBI restriction site, the 1409 bp bases at the 3' end of PDCoV as shown in SEQ ID NO.15, 25 A tail (poly) sequences, the hepatitis D nuclease sequence (HDV) as shown in SEQ ID NO.12, and the BGH transcription termination sequence as shown in SEQ ID NO.13 into the pBAC vector in sequence to obtain an intermediate vector pBAC-M containing transcriptional regulatory elements;

[0056] (3) Linearization of pBAC-M and ligation of pBAC-AB vector: The intermediate vector pBAC-M was linearized through the two restriction sites BmtⅠ and BstBI, and the A and B fragments were ligated with the linearized vector pBAC-M by homologous recombination to obtain the pBAC-AB vector;

[0057] (4) Linearization of pBAC-AB vector and ligation of pBAC-PDCoV vector: The pBAC-AB vector was linearized through the two restriction sites of MluⅠ and BstBI, and the C, D, and E fragments were ligated with the linearized pBAC-AB vector by homologous recombination to obtain the pBAC-PDCoV vector.

[0058] In the second aspect, the present invention seeks protection for the NS7 gene mutation recombinant virus of the PDCoV JS2021-LX strain constructed by the above method.

[0059] In the third aspect, the present invention seeks to protect the use of the above-mentioned PDCoV JS2021-LX strain NS7 gene mutation recombinant virus in the preparation of porcine delta coronavirus inactivated vaccine.

[0060] In the fourth aspect, the present invention claims protection for an inactivated porcine deltacoronavirus vaccine, which is an inactivated vaccine marked with the aforementioned PDCoV JS2021-LX strain NS7 gene mutant recombinant virus.

[0061] Porcine Delta coronavirus (PDCoV) is a newly prevalent enteric coronavirus in recent years, which can cause diarrhea, coughing, vomiting, dehydration, lethargy, and even death in newborn piglets. The accessory protein of coronavirus is not a component of the virus particle, but plays an important role in regulating the escape from the host's natural immunity and viral replication. In order to clarify the effect of the accessory protein NS7 on viral replication, this study successfully constructed an infectious clone of PDCoV based on the BAC system, used CRISPR / Cas9 technology to cut the upstream and downstream of its NS7 gene, and then replaced the original NS7 gene fragment by homologous recombination to obtain a recombinant plasmid with NS7 gene mutation. After transfection of LLC-PK1 cells, the recombinant virus with mutant NS7 protein was rescued, and the virulence and pathogenicity of the recombinant virus were evaluated by in vitro cell tests and pig tests. The results of the virus growth curve test showed that compared with the rescued PDCoV (rPDCoV), the recombinant virus with NS7 gene mutation had a lower virus titer at 12h and 24h, but after reaching the peak of virus titer at 36h, there was no significant difference with the rescued virus; in addition, the plaque morphology of the NS7 gene mutant virus on LLC-PK1 was slightly smaller than that of the rescued virus, but the difference was not obvious. The results of the piglet pathogenicity test showed that the piglets in the NS7 gene mutant recombinant virus group and the rescued virus group showed similar clinical symptoms and pathological lesions. Through the detection of the viral load of anal swabs collected within 5 days and various tissues after autopsy, it was found that the two groups of piglets had similar levels of virus excretion within 5 days, and the virus also showed similar distribution in the body. The above results show that the NS7 gene mutant recombinant virus can replicate normally in vivo and in vitro, and the replication level and proliferation efficiency are similar to those of the rescued PDCoV virus.

[0062] Beneficial effects of the present invention:

[0063] The present invention successfully rescued a recombinant virus with a PDCoVNS7 gene mutation, and evaluated the viral replication levels of the recombinant virus and the rescued virus both in vivo and in vitro. The results of the pig challenge experiment showed that the recombinant virus was infectious to pigs and had a virulence equivalent to that of the wild virus. The recombinant virus can be used as a candidate strain for a labeled inactivated vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Schematic diagram of the full-length gene segmentation of PDCoV.

[0065] Figure 2 It is a segmented amplification of the full-length gene of PDCoV;

[0066] Among them, (A) the results of gene amplification of 10 PDCoV fragments; (B) the results of amplification of the five full-length fragments of PDCoVA, B, C, D, and E; (C) the sequencing results of pBAC-PDCoV 10 fragments; (D) the mutation site T→A was successfully introduced at position 17843.

[0067] Figure 3 The double restriction enzyme linearization result of the intermediate vector pBAC-M.

[0068] Figure 4 This is the identification result of the pBAC-AB vector;

[0069] Among them, (A) and (B) are the results of PCR identification of pBAC-AB bacterial solution; (C) is the result of enzyme digestion identification of pBAC-AB plasmid.

[0070] Figure 5 The linearization result of double restriction enzyme digestion of pBAC-AB.

[0071] Figure 6 is the identification result of pBAC-PDCoV;

[0072] Among them, (A)(B)(C) are the PCR identification results of pBAC-PDCoV bacterial solution; (D) is the enzyme digestion identification result of pBAC-PDCoV plasmid.

[0073] Figure 7 36 hours after pBAC-PDCoV transfection, the cells became enlarged and rounded, and other pathological phenomena appeared.

[0074] Figure 8 for virus rescue and identification;

[0075] Among them, (A) the rescued virus was infected with LLC-PK1 for IFA verification; (B) the rescued virus was infected with LLC-PK1 for Western Blot verification (C) the genetic molecular marker sequencing results of the rescued virus.

[0076] Fig. 9 Schematic diagram of the construction strategy for NS7 gene mutant virus.

[0077] Fig.10 The linearization identification results of the gRNA fusion product for knocking out the NS7 gene and the pBAC-PDCOV vector;

[0078] Among them, (A) sgRNA fusion PCR amplification results; (B) pBAC-PDCoV vector linearization results using cas9 endonuclease.

[0079] Fig.11 This is the identification result of the overlap fragment containing the NS7 mutant gene;

[0080] Among them, (A) the amplification results of NS7-up fragment, NS7 mutant gene and NS7-down fragment; (B) the overlap fusion fragment results of the three fragments.

[0081] Fig.12 This is the identification result of pBAC-PDCoV-ΔNS7;

[0082] Among them, (A) is the PCR identification result of pBAC-PDCoV-ΔNS7 bacterial solution; (B) is the sequencing result of suspected positive clone.

[0083] Fig.13 48 hours after pBAC-PDCoV-ΔNS7 transfection, the cells became enlarged and rounded, and other pathological phenomena appeared.

[0084] Fig.14 This is the identification result of the recombinant virus rPDCoV-ΔNS7;

[0085] Among them, (A) IFA identification results of rPDCoV-ΔNS7; (B) Western Blo identification results of rPDCoV-ΔNS7; (C) sequencing results of rPDCoV-ΔNS7 gene mutation sequence.

[0086] Fig.15 This is the sequencing result of the NS7 gene mutant virus at the 20th generation.

[0087] Fig.16 Comparison results of in vitro biological characteristics; among them, (A) TCID50 comparison results (B) CPE comparison results.

[0088] Fig.17 Results of pathogenicity test in piglets; (A) clinical symptoms of infected piglets; (B) pathological anatomy results.

[0089] Fig.18 The results of virus load detection and virus distribution in piglets after virus infection; (A) anal swabs were collected for 5 consecutive days after virus infection to detect virus load results; (B) samples from various organs and intestinal parts were collected after autopsy to detect virus distribution.

[0090] Fig.19 This is the HE staining result of pathological section of small intestine of piglets after virus attack. DETAILED DESCRIPTION

[0091] The method of the present invention is described below by means of specific examples, but the present invention is not limited thereto, and any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0092] Example 1 Construction of pBAC-PDCoV vector

[0093] 1. Test materials

[0094] 1.1 Strains and cells

[0095] The PDCOV JS2021-LX strain was isolated and preserved by our laboratory (GeneBank accession number: OQ473581), and LLC-PK1 cells were purchased from American Type Culture Collection (ATCC).

[0096] 1.2 Enzymes and main reagents:

[0097] BstBI, MluI, and BmtI-HF restriction endonucleases were purchased from NEB, DNA polymerase (SuperFi Green PCR Master Mix) was purchased from Thermo Fisher Scientific, pBeloBAC11 vector (i.e., pBAC vector) was purchased from Shanghai Hewu Biotechnology Co., Ltd., RNA extraction kit was purchased from Omega, and RNA reverse transcription kit ( III 1st Strand cDNA Synthesis Kit), homologous recombination kit (ClonExpress Ultra One Step Cloning Kit), and DNA molecule marker were purchased from Novozymes Biotech Co., Ltd., plasmid extraction kit was purchased from MACHEREYNAGEL, and DH10B competent cells were purchased from Ang Yu Biotech.

[0098] 1.3 Antibodies and transfection reagents

[0099] The PDCoVN protein polyclonal antibody was prepared and stored by our laboratory using the conventional method disclosed in the prior art. CoraLite 488-labeled goat anti-mouse IgG was purchased from peoteintech, goat anti-mouse IgG (H+L)-HRP was purchased from Bio-Technology Co., Ltd., and liposome transfection reagent Lipofectamine TM 3000 was purchased from Thermo Fisher Scientific.

[0100] 1.4 Other related reagents

[0101] DNA agarose gel recovery kit was purchased from BioVo Medical Technology Co., Ltd., DMEM culture medium and fetal bovine serum were purchased from Corning Biotechnology Co., Ltd., DNA15000 Marker, 180KDa Prestained Protein Marker and protein precast gel were purchased from Nanjing Novozymes Biotech Co., Ltd., and protease inhibitor (PMSF) was purchased from Beyotime Biotech Co., Ltd.

[0102] 2 Research Methods

[0103] 2.1PDCoV virus proliferation

[0104] The PDCoV cell virus solution was inoculated into LLC-PK1 cells with a confluent monolayer at an MOI of 0.01, adsorbed at 37°C for 2 h, the supernatant discarded, washed three times with PBS, and then added with DMEM medium containing 8 μg / mL trypsin. The cells were cultured at 37°C and 5% CO2 until most obvious lesions were produced. The cells were frozen and thawed three times at -80°C, and then centrifuged at 8000 rpm for 10 min at 4°C. The supernatant was collected and stored at -80°C.

[0105] 2.2 PDCoV RNA extraction and reverse transcription

[0106] The PDCoV virus solution was taken out from -80℃, and RNA was extracted according to the method in the kit (Omega Total RNA Kit), and then RNA was reverse transcribed according to the method in the RNA reverse transcription kit (Novozyme III 1st Strand cDNA

[0107] cDNA was obtained by using the PCR amplification kit (PCR amplification kit).

[0108] 2.3PDCoV gene segment amplification

[0109] According to the whole genome sequencing results of PDCoV, the full-length sequence and restriction sites were analyzed, and the full-length gene was divided into 5 fragments: A (4418bp), B (5838bp), C (4634bp), D (3236bp), and E (4674bp). The three restriction sites BmtI, BstBⅠ and MluⅠ were selected to determine the length of the 5 fragments, as shown in the figure. Figure 1As shown. Each fragment was obtained by amplifying smaller fragments by overlapPCR method. The small fragments can be divided into 10 fragments A1, A2, B1, B2, C1, C2, D1, D2, E1, E2 (primer sequences are shown in Table 1), and sent to Qingke Company for sequencing by connecting to Blunt vector. At the same time, in order to distinguish the parental virus from the rescued virus, the mutation site T→A was introduced at position 17843 as a genetic molecular marker for the rescued virus.

[0110] Table 1 Primer sequences

[0111]

[0112] 2.4pBAC vector transformation

[0113] In order to facilitate the subsequent construction, the pBAC vector needs to be modified first, and the CMV promoter (as shown in SEQ ID NO.11), 1499bp bases at the 5' end of PDCoV (as shown in SEQ ID NO.14), BstBI restriction site, 1409bp bases at the 3' end of PDCoV (as shown in SEQ ID NO.15), 25 A tail (poly) sequences, hepatitis D nuclease sequence (HDV) (as shown in SEQ ID NO.12) and BGH transcription termination sequence (as shown in SEQ ID NO.13) are inserted into the vector in sequence to obtain an intermediate vector containing transcriptional regulatory elements, named pBAC-M. The specific sequence of the inserted fragment is shown in the appendix, and the inserted fragment was synthesized by Nanjing GenScript Biotech Co., Ltd.

[0114] 2.5pBAC-M linearization and identification

[0115] The intermediate vector pBAC-M was linearized through two restriction sites, BmtⅠ (reaction conditions: 37℃) and BstBI (reaction conditions: 65℃). The restriction system was: 10×Buffer 5μL, pBAC-M plasmid 3μg, BmtⅠ and BstBI 1μL each, and sterile water was added to make up to 50μL. It was first incubated in a 37℃ water bath for 5h, and then incubated in a 65℃ water bath for 5h. The restriction effect was detected by nucleic acid electrophoresis, and the linearized product pBAC-M was recovered.

[0116] 2.6pBAC-AB vector ligation and identification

[0117] The A and B fragments with correct sequencing results were connected to the linearized vector pBAC-M by homologous recombination, and the connection products were transformed into DH10B competent cells. The monoclonal colonies on the plate were picked for bacterial liquid PCR verification, the monoclonal clones with correct identification results were inoculated into fresh LB medium for expansion and plasmids were extracted for enzyme digestion verification, and the plasmids with correct enzyme digestion results were sent to Qingke Biotechnology Company for sequencing to verify the correctness of the sequence, and the plasmids with correct verification results were named pBAC-AB.

[0118] 2.7pBAC-AB vector linearization and identification

[0119] pBAC-AB was linearized through two restriction sites, MluⅠ (reaction conditions: 37℃) and BstBI (reaction conditions: 65℃). The restriction system was: 10×Buffer 5μL, pBAC-AB plasmid 3μg, MluⅠ and BstBI 1μL each, and sterile water was added to make up to 50μL. It was first incubated in a 37℃ water bath for 5h, and then incubated in a 65℃ water bath for 5h. The restriction effect was detected by nucleic acid electrophoresis, and the linearized product pBAC-AB was recovered.

[0120] 2.8pBAC-PDCoV vector ligation and identification

[0121] The C, D, and E fragments with correct sequencing results were connected to the linearized vector pBAC-AB by homologous recombination, and the connection products were transformed into DH10B competent cells. The monoclonal colonies on the plate were picked for bacterial liquid PCR verification, and the monoclonal clones with correct identification results were inoculated into fresh LB medium for expansion and plasmids were extracted for double enzyme digestion verification. The plasmids with correct double enzyme digestion results were sent to Qingke Biotechnology Company for sequencing to verify the correctness of the sequence, and the plasmids with correct verification results were named pBAC-PDCoV.

[0122] 2.9 Transfection of recombinant plasmid pBAC-PDCoV

[0123] LLC-PK1 cells were seeded in a six-well plate and cultured in a 37°C, 5% CO2 incubator until the density reached 70-80%. Transfection was performed according to Lipofectamine TM The cells were operated according to the instructions of 3000 transfection reagent, with a transfection volume of 2.5 μg / well. 10 h after transfection, the culture medium was changed to DMEM medium containing 10 μg / mL trypsin and the cell lesions were observed.

[0124] 2.10 Indirect immunofluorescence assay (IFA)

[0125] 24 hours after virus infection, the culture medium was discarded and the cells were washed three times with PBS; fixed with pre-cooled anhydrous methanol at room temperature for 5 minutes and washed three times with PBS; blocked with 5% (g / 100ml) BSA solution (dissolved in PBS) at room temperature for 45 minutes; incubated with N polyclonal antibody diluted in PBS solution containing 1% (g / 100ml) BSA at 4°C overnight, washed three times with PBS, incubated with CoraLite 488-labeled goat anti-mouse IgG diluted 1:300 (dissolved in PBS solution containing 1% BSA) at room temperature for 2 hours, washed three times with PBS, stained with DAPI for 5 minutes, washed three times with PBS, and observed under an inverted fluorescence microscope.

[0126] 2.11 Western blotting (WB)

[0127] After 24 hours of virus infection, the culture medium was discarded, the cells were washed with PBS three times, and the protein samples were collected and subjected to 5× SDS-PAGE. Add Loading Buffer to the protein sample in proportion, beat and mix, and boil in 100℃ boiling water bath for 5min to denature the protein; prepare separation gel and concentration gel for SDS-PAGE, voltage is 120V, time is 90min; after the electrophoresis, use "wet transfer method" for membrane transfer, current is 280mA, time is 90min; after the transfer, prepare 5% (g / 100ml) skim milk to block the PVDF membrane, block at room temperature for 2h; discard the blocking solution, wash the membrane 3 times with 1×PBST, add 1:1000 diluted N protein primary antibody, incubate at 4℃ overnight; recover the primary antibody the next day, wash the membrane 3 times with 1×PBST, add 1:5000 diluted HRP labeled secondary antibody, incubate at room temperature for 2h; wash the membrane 3 times with 1×PBST, place the PVDF membrane in the imager, add the prepared substrate color development solution for color development, and observe the results.

[0128] 3 Research results

[0129] 3.1 Construction of pBAC-PDCoV plasmid

[0130] 3.1.1 PDCoV gene segment amplification

[0131] The amplification and sequencing results of the 10 small fragments of PDCoV, A1 (2173 bp), A2 (2269 bp), B1 (2886 bp), B2 (2977 bp), C1 (2247 bp), C2 (2410 bp), D1 (1652 bp), D2 (1608 bp), E1 (2355 bp), and E2 (2344 bp), are shown in the figure. Figure 2 As shown in A and C in the figure, the results are correct. At the same time, the mutation site T→A was successfully introduced at position 17843 as a genetic molecular marker for rescuing the virus (such as Figure 2Then, overlap PCR was used to obtain the amplification results of A (4418 bp), B (5838 bp), C (4634 bp), D (3236 bp), and E (4674 bp). Figure 2 As shown in B, the band sizes are correct.

[0132] 3.1.2 Linearization of pBAC-M intermediate vector

[0133] The intermediate vector pBAC-M was double-digested with BmtⅠ and BstBI and then electrophoresed to obtain Figure 3 The results shown showed that the band size was 11191 bp, and the purified fragment was recovered.

[0134] 3.1.3 Identification of pBAC-AB vector

[0135] The linearized vector pBAC-M was connected to the A and B fragments by homologous recombination, and the suspected positive clones were subjected to bacterial liquid PCR and restriction enzyme digestion identification. The results were as follows Figure 4 As shown, Figure 4 A and B in the figure are the PCR results of the bacterial solution of pBAC-AB monoclonal. Figure 4 The C in the figure is the result of restriction enzyme digestion after plasmid extraction from pBAC-AB. The above results indicate that colony No. 13 of pBAC-AB is a positive clone and is named pBAC-AB.

[0136] 3.1.4pBAC-AB linearization

[0137] The vector pBAC-AB was double-digested with MluⅠ and BstBI and then electrophoresed to obtain Figure 5 The results shown showed that the band size was 21334 bp, and the purified fragment was recovered.

[0138] 3.1.5 Identification of pBAC-PDCoV

[0139] The linearized vector pBAC-AB was connected to the C, D, and E fragments by homologous recombination, and the suspected positive clones were subjected to bacterial liquid PCR and restriction enzyme digestion identification. The results were as follows Figure 6 As shown, Figure 6 AC in the figure is the PCR result of the bacterial solution of pBAC-PDCoV monoclonal. Figure 6 D in the figure is the result of restriction enzyme digestion after plasmid extraction from pBAC-PDCoV. The above results indicate that the pBAC-PDCoV vector was successfully constructed.

[0140] 3.2 Virus rescue and identification

[0141] 3.2.1 pBAC-PDCoV plasmid transfection

[0142] The pBAC-PDCoV plasmid was transfected into LLC-PK1 monolayer cells at 80% density, and the DMEM medium containing 10 μg / mL trypsin was replaced 10 h after transfection. The results showed that LLC-PK1 cells became larger, rounder, transparent, aggregated, and began to fall off 36 h after transfection, which was similar to the lesions produced when the wild-type PDCoV strain infected LLC-PK1 (such as Figure 7 The rescued virus was named rPDCoV.

[0143] 3.2.2 Identification of rescued viruses

[0144] The rPDCoV virus was serially passaged to F3 and then infected with LLC-PK1. After 24 hours, indirect immunofluorescence (IFA) and protein immunoblotting (Western Blot) were performed, and the N protein polyclonal antibody was used for identification. Figure 8 As shown in Figure 2, obvious N protein fluorescence was observed in LLC-PK1 cells infected with both the parental virus PDCoV and the recombinant virus rPDCoV. At the same time, an N protein of approximately 40 KDa was identified in the collected LLC-PK1 cell samples infected with rPDCoV (Figure 2). Figure 8 ), indicating that the rescued virus rPDCoV can replicate in LLC-PK1 cells.

[0145] At the same time, in order to further confirm rPDCoV, RNA was extracted and reverse transcribed from the third-generation rPDCoV, and the fragments containing genetic molecular markers were amplified and sequenced. Figure 8 As shown in C, except for the 17843th base position T→A, the other bases are consistent with the parent virus. The above results indicate that the PDCoV reverse genetics system based on the BAC system was successfully established.

[0146] Example 2

[0147] 1. Materials

[0148] 1.1 Virus strains, cells, and experimental animals

[0149] The PDCOV JS2021-LX strain was isolated and preserved by our laboratory (GeneBank accession number: OQ473581), LLC-PK cells were purchased from American Type Culture Collection (ATCC), and PEDV, TGEV, PRoV, and PDCoV antigen-antibody negative piglets were purchased from a pig farm in Guizhou.

[0150] 1.2 Antibodies and transfection reagents

[0151] The polyclonal antibodies of PDCoVN protein and NS7 protein were prepared and stored by our laboratory using the conventional methods disclosed in the prior art. CoraLite 488 and CoraLite 594 labeled goat anti-mouse IgG were purchased from peoteintech, goat anti-mouse IgG (H+L)-HRP was purchased from Bio-Technology Co., Ltd., and liposome transfection reagent Lipofectamine TM 3000 was purchased from Thermo Fisher Scientific.

[0152] 1.3 Enzymes and main reagents:

[0153] Crispr Cas9 endonuclease and T7 RNA transcriptase were purchased from NEB, and DNA polymerase (SuperFi Green PCR Master Mix) was purchased from Thermo Fisher Scientific. RNA extraction kit was purchased from Omega, and RNA reverse transcription kit ( III 1st Strand cDNA Synthesis Kit), homologous recombination kit (ClonExpress Ultra One Step Cloning Kit), and DNA molecule marker were purchased from Novazonic Biotechnology Co., Ltd., the plasmid extraction kit was purchased from MACHEREY NAGEL, and DH10B competent cells were purchased from Ang Yu Biotechnology Co., Ltd.

[0154] 1.4 Other related reagents

[0155] DNA agarose gel recovery kit was purchased from BioVo Medical Technology Co., Ltd., DMEM culture medium and fetal bovine serum were purchased from Corning Biotechnology Co., Ltd., DNA15000, 2000, 5000 Marker, 180KDa Prestained Protein Marker and protein premix were purchased from Nanjing Novozymes Biotech Co., Ltd., and protease inhibitor (PMSF) was purchased from Beyotime Biotech Co., Ltd.

[0156] 2. Research Methods

[0157] 2.1 Strategy for constructing NS7 gene mutant virus

[0158] The full-length sequence of PDCoV was analyzed using the online website https: / / www.benchling.com / and a pair of gRNAs were designed upstream and downstream of the NS7 gene. They were annealed with scaffold oligo to form double strands as transcription templates for sgRNA-ΔNS7a and sgRNA-ΔNS7b, and then transcribed in vitro with T7 transcriptase to obtain sgRNAs with recognition ability. Afterwards, sgRNA guided cas9 endonuclease to cut the upstream and downstream sequences of the NS7 gene to remove the NS7 gene, such as Fig. 9 a in the figure, and then the fragment containing the NS7 gene mutation was connected to the infectious clone plasmid pBAC-PDCoV containing the full-length cDNA of porcine delta coronavirus by PCR amplification and homologous recombination to replace the NS7 gene, such as Fig. 9 b, and finally the PDCoV recombinant BAC plasmid with NS7 mutant gene was obtained, such as Fig. 9 c in , thereby completing the deletion of the NS7 gene.

[0159] 2.2 Construction of ΔNS7-sgRNA

[0160] A pair of gRNAs were designed using the online website https: / / www.benchling.com / . The specific sequences are shown in Table 2 and synthesized by Nanjing Qingke Biotechnology Co., Ltd. The synthesized gRNAs were annealed with scaffold oligo to form double-stranded structures, and sgRNA-ΔNS7a and sgRNA-ΔNS7b with recognition ability were generated after in vitro transcription by T7 transcriptase. The transcription system is: sgRNA transcription template 75ng; NTPs MIX 5μL; T7 transcriptase 1μL; RNase free water is added to 15μL, and the transcription is carried out at 37℃ overnight. The transcription product is the constructed sgRNA, which is stored at -80℃.

[0161] 2.3 Linearization of pBAC-PDCoV vector

[0162] The pBAC-PDCoV plasmid was extracted using the MACHEREY NAGEL plasmid high-dose extraction kit, and then the pBAC-PDCoV vector was positioned and cut using cas9 endonuclease and sgRNA to remove the NS7 gene. The enzyme digestion system was: 10xBuffer 5μL; sgRNA 2μL each; pBAC-PDCoV plasmid 5ug, RNase free water was added to 50μL, and enzyme digestion was carried out at 37℃ overnight.

[0163] 2.4 Amplification of the overlap fragment containing the NS7 mutant gene

[0164] RNA was extracted from the cell virus fluid of the PDCOV JS2021-LX strain and reverse transcribed into cDNA. Primers were designed using this cDNA as a template to amplify the NS7-up and NS7-down fragments with homology arms respectively; the synthetic NS7 gene mutation fragment was used as a template to amplify the NS7 gene mutation fragment with homology arms, and then the three fragments were connected together by overlapPCR to form an overlap product containing the NS7 mutant gene. The primer sequences and NS7 gene mutation sequences are shown in Table 2 and were synthesized by Nanjing Qingke Biological Company.

[0165] Table 2 Primer sequences and NS7 mutant gene sequences

[0166]

[0167]

[0168] 2.5 PCR identification of bacterial liquid of pBAC-PDCoV-ΔNS7 vector

[0169] The linearized vector pBAC-PDCoV was connected to the overlap fragment containing the NS7 mutant gene by homologous recombination, and the connection product was transformed into DH10B competent cells. The monoclonal colonies on the plate were picked for bacterial liquid PCR verification, and the monoclonal clones with correct identification results were sent to Qingke Biotechnology Company for sequencing, and the monoclonal clones with correct sequencing results were expanded for plasmid extraction.

[0170] 2.6 Transfection of recombinant plasmid pBAC-PDCoV-ΔNS7

[0171] LLC-PK1 cells were seeded in a six-well plate and cultured in a 37°C, 5% CO2 incubator until the density reached 70-80%. Transfection was performed according to Lipofectamine TM The cells were operated according to the instructions of 3000 transfection reagent, with a transfection volume of 2.5 μg / well. 10 h after transfection, the culture medium was changed to DMEM medium containing 10 μg / mL trypsin and the cell lesions were observed.

[0172] 2.7 Indirect immunofluorescence assay (IFA)

[0173] 24 hours after virus infection, the culture medium was discarded and the cells were washed three times with PBS; fixed with pre-cooled anhydrous methanol at room temperature for 5 minutes and washed three times with PBS; blocked with 5% (g / 100ml) BSA solution (dissolved in PBS) at room temperature for 45 minutes; incubated with NS7 polyclonal antibody diluted in PBS solution containing 1% BSA at 4°C overnight, washed three times with PBS, incubated with CoraLite 549-labeled goat anti-mouse IgG diluted 1:300 (dissolved in PBS solution containing 1% BSA) at room temperature for 2 hours, washed three times with PBS, stained with DAPI for 5 minutes, washed three times with PBS, and observed under an inverted fluorescence microscope.

[0174] 2.8 Western Blotting (WB)

[0175] After 24 hours of virus infection, the culture medium was discarded, the cells were washed with PBS three times, and the protein samples were collected and subjected to 5× SDS-PAGE. Add Loading Buffer to the protein sample in proportion, beat and mix, and boil in 100℃ boiling water bath for 5min to denature the protein; prepare separation gel and concentration gel for SDS-PAGE, voltage is 120V, time is 90min; after the electrophoresis, use "wet transfer method" for transfer, current is 280mA, time is 90min; after the transfer, prepare 5% (g / 100ml) skim milk to block the NC membrane, block at room temperature for 2h; discard the blocking solution, wash the membrane 3 times with 1×PBST, add 1:1000 diluted N protein primary antibody or NS7 protein primary antibody, incubate at 4℃ overnight; recover the primary antibody the next day, wash the membrane 3 times with 1×PBST, add 1:5000 diluted HRP-labeled secondary antibody, incubate at room temperature for 2h; wash the membrane 3 times with 1×PBST, place the NC membrane in the imager, add the prepared substrate color development solution for color development, and observe the results.

[0176] 2.9 Pathogenicity test of rescued virus rPDCoV and recombinant virus rPDCoV-ΔNS7 in piglets

[0177] Piglets with negative antigen and antibody tests for PEDV, TGEV, PRoV, PDCoV, etc. were selected for animal pathogenicity tests, and the specific grouping and challenge doses were implemented according to Table 3.

[0178] Table 3 Grouping of rescued virus rPDCoV and recombinant virus rPDCoV-ΔNS7 piglet pathogenicity test

[0179]

[0180] The piglets' mental state, eating status, and diarrhea symptoms were observed daily. Anal swabs were collected from the piglets every day starting 24 hours after infection and soaked in sterile PBS solution and frozen at -80°C until the fifth day after infection. After that, qPCR was used to detect viral load and monitor detoxification. In addition, autopsies were performed when piglets showed obvious clinical symptoms, and tissues such as the duodenum, jejunum, ileum, cecum, colon, rectum, heart, liver, spleen, lung, and kidney were collected to detect the distribution of the virus.

[0181] 2.10 Detection of PDCoV viral load by real-time quantitative PCR (qRT-PCR)

[0182] The PBS solution soaked in the anal swab was fully vortexed, and 200 μL was taken to extract RNA according to the instructions of the Omega RNA extraction kit. The collected tissue samples were repeatedly frozen and thawed three times at -80°C and then fully ground using a tissue grinder, then centrifuged at 12000 rpm for 5 minutes, and 200 μL of the supernatant was taken to extract RNA according to the instructions of the Omega RNA extraction kit.

[0183] After RNA extraction, the RNA was reverse transcribed into cDNA according to the instructions of the Novozyme reverse transcription kit, and the conserved region in the PDCoV M gene was amplified using the SybrGreen method. The following Table 4 shows the sequences of fluorescent quantitative PCR amplification primers, which were synthesized by Nanjing Qingke Biological Company.

[0184] Table 4 Fluorescence quantitative PCR amplification primer sequences

[0185]

[0186] 2.11 Pathological sections

[0187] The collected intestinal samples were fixed in 4% paraformaldehyde solution for at least 24 h before continuing with the following operations.

[0188] (1) Tissue trimming and flushing: Trim the tissue fixed with formalin solution as thinly as possible and make the section neat. Then rinse the trimmed tissue block under running tap water for 10-16 hours to remove the formaldehyde in the tissue.

[0189] (2) Dehydration: The repaired tissue blocks are placed in 70%, 80%, 90%, 95% (v / v) and 100% (I and II) gradient alcohol for dehydration. The specific procedure and time for dehydration are: 70% alcohol 2h (can be overnight) → 80% alcohol 2h → 90% alcohol 2h → 95% alcohol 1h (can be extended appropriately) → anhydrous ethanol (100%) I 45min → anhydrous ethanol (100%) II 45min (anhydrous ethanol is strictly carried out according to the time, which can be short but not too long).

[0190] (3) Transparent and wax dipping: Open the wax box and melt the wax at the beginning of dehydration. After the tissue blocks are completely dehydrated, they are immersed in xylene for transparentization. The specific transparent time varies depending on the thickness of the tissue blocks. Place the transparent tissue blocks in a constant temperature box at about 60℃ and dip them in wax for 2-4 hours.

[0191] (4) Embedding: First, place the small beaker containing the 60℃ tissue block in a 70℃ incubator for 15 minutes. Then pour the 70℃ melted paraffin into the iron embedding frame, arrange the tissue blocks neatly, mark them, and trim them after a period of time.

[0192] (5) Slicing: First adjust the slicer to 3 mm thickness and start slicing.

[0193] (6) Spreading and sticking slices: Take the cut tissue slices and place them in 45°C warm water, and then use 60%-70% alcohol to spread them out.

[0194] (7) Baking: Place the removed tissue slices in a 37°C incubator and bake for 2 hours or overnight (if time is tight, place them in a 60°C incubator for half an hour).

[0195] (8) HE staining: Follow the following time and sequence. First, xylene I for 15 min → xylene II for 10-15 min → alcohol / xylene for 3-5 min → anhydrous ethanol for 3-5 min → 95% alcohol for 3-5 min → 85% alcohol for 3-5 min → 75% alcohol for 3-5 min → distilled water for 4-6 min → hematoxylin staining solution for 3-5 min → rinse with tap water for about 3-4 times until the water does not turn blue → 1% hydrochloric acid alcohol for 4-5 s → rinse with running tap water for 10-15 min → 90% alcohol for 2-4 s → 1% eosin staining solution for 3-6 s → 95% alcohol I for 3 s → 95% alcohol II for 1-2 min → anhydrous ethanol I for 2-4 min → anhydrous ethanol II for 5 min → xylene I for 20-30 min.

[0196] (9) Sealing: Use tweezers to place a coverslip washed with xylene on the tissue section to which a drop of neutral resin (an appropriate amount of xylene may be added), bake it dry in a 37°C incubator (2-4 h), and observe under an optical microscope.

[0197] 4 Research results

[0198] 4.1 Construction of ΔNS7-sgRNA

[0199] The two pairs of gRNA fusion products for knocking out the NS7 gene are as follows Fig.10As shown in A, 1 is a double-stranded structure generated by the fusion of PD-ΔNS7a and scaffold oligo scaffold structure, and 2 is a double-stranded structure generated by the fusion of PD-ΔNS7b and scaffold oligo scaffold structure, both of which are about 130 bp in size.

[0200] 4.2 Linearization of pBAC-PDCOV vector

[0201] The vector pBAC-PDCoV was obtained by electrophoresis after Cas9 digestion. Fig.10 As shown in the result B in the figure, in addition to the linearized vector, a fragment of about 1900bp containing the NS7 gene cut by Cas9 can also be seen, indicating that the pBAC-PDCoV vector was successfully linearized.

[0202] 4.3 Amplification of the overlap fragment containing the NS7 mutant gene

[0203] The amplification results of NS7-up fragment, NS7 gene mutation fragment and NS7-down fragment are as follows Fig.11 As shown in A in FIG, the size of the overlap fusion fragment of the three fragments is also in line with expectations, about 2100 bp, as shown in FIG. Fig.11 As shown in B.

[0204] 4.4 Identification of pBAC-PDCoV-ΔNS7

[0205] The linearized vector pBAC-PDCoV was connected to the EGFP overlap fragment by homologous recombination, and the suspected positive clones were identified by bacterial liquid PCR. The results were as follows Fig.12 As shown in A in the figure, a suspected positive result was identified. The suspected positive monoclonal clone was sent to a sequencing company for sequencing. The result is as follows Fig.12 B in the figure shows that the original NS7 gene was successfully replaced.

[0206] 4.5pBAC-PDCoV-ΔNS7 plasmid transfection results

[0207] The pBAC-PDCoV-ΔNS7 plasmid was transfected into LLC-PK1 monolayer cells at 80% density, and the DMEM medium containing 10 μg / mL trypsin was replaced 10 h after transfection. The results showed that LLC-PK1 cells became larger, rounder, transparent, aggregated, and began to fall off 48 h after transfection (e.g. Fig.13 The virus collected at this time was named rPDCoV-ΔNS7, which was similar to the lesions produced when the wild-type PDCoV strain infected LLC-PK1.

[0208] 4.6 Identification of NS7 gene mutant viruses

[0209] The gene-mutated recombinant virus rPDCoV-ΔNS7 was used to infect LLC-PK1, and 24 hours later, indirect immunofluorescence (IFA) and protein immunoblotting (Western Blot) were performed to identify the N protein and NS7 polyclonal antibodies. Fig.14 As shown in A: Obvious N protein fluorescence can be observed in LLC-PK1 cells infected with rescued virus rPDCoV and rPDCoV-ΔNS7. At the same time, NS7 protein fluorescence can also be seen in the rescued virus rPDCoV group, while no NS7 protein can be detected in the rPDCoV-ΔNS7 infection group; Western Blot also obtained the same result ( Fig.14 The above results indicate that the NS7 gene mutant recombinant virus can replicate in LLC-PK1 cells.

[0210] At the same time, in order to further confirm rPDCoV-ΔNS7, RNA was extracted from the viral supernatant and reverse transcribed, and the fragment containing the NS7 mutant gene was amplified and sequenced. Fig.14 As shown in C, the NS7 gene was successfully mutated. The above results indicate that the NS7 gene mutant virus based on the BAC system was successfully constructed.

[0211] 4.7 Identification of genetic stability of NS7 gene mutant viruses

[0212] The rescued NS7 gene mutant virus was subcultured to the 20th generation, the viral fluid RNA was extracted and reverse transcribed, and the mutant NS7 gene fragment was sequenced to verify its stability. The results are as follows Fig.15 As shown, the NS7 gene mutant fragment exists stably.

[0213] 4.8 Comparison of biological characteristics of different viruses in vitro

[0214] The TCID50 and CPE tests were used to compare the virulence differences between the rescued virus rPDCoV and the NS7 gene mutant virus rPDCoV-ΔNS7. Fig.16 As shown in A, the growth curves of the two viruses at 12h, 24h, 36h, 48h, and 60h all showed a trend of first rising and then falling, and the virus titer reached the highest at 36h. However, compared with the rescued virus rPDCoV, the virus titer of rPDCoV-ΔNS7 was significantly reduced at 12h and 24h, and the plaque morphology also became smaller.

[0215] 4.9 Analysis of pathogenicity test in piglets

[0216] In order to study the effect of the auxiliary protein NS7 on the replication and pathogenicity of PDCoV in vivo, rescued virus rPDCoV and gene mutant virus rPDCoV-ΔNS7 were used for virus challenge experiments. Each group was fed with 10^7TCID50 / head virus solution, and the control group was fed with the same volume of maintenance solution. The clinical symptoms of the piglets were observed and recorded. The results showed that except for the control group, the piglets in these two groups showed depression and decreased appetite 24 hours after the virus challenge. Some pigs showed symptoms of softened stool and diarrhea about 40 hours after the virus challenge, such as Fig.17 As shown in A in the figure, the symptoms were alleviated about 96 hours later. In addition, on the third day after the challenge (when obvious clinical symptoms appeared), the piglets in each group were autopsied to observe the pathological changes in the intestine. The results showed that the small intestine of the rPDCoV group and rPDCoV-ΔNS7 had obvious flatulence and thinning of the intestinal wall, especially the jejunal lesions, as shown in Figure 1. Fig.17 Middle B.

[0217] In order to monitor the excretion of virus in piglets after infection, the fluorescent quantitative PCR method was used to detect the content of viral RNA in piglet anal swabs. The results showed that there was no significant difference in the number of RNA copies in anal swabs of piglets infected with the rescued virus rPDCoV and the NS7 gene mutant virus rPDCoV-ΔNS7. A small amount of viral RNA was detected in the anal swabs collected from these two groups of piglets at 24 hours. As the infection time prolonged, the viral load also increased. Fig.18 A in the middle. Afterwards, in order to clarify the distribution of the virus in the body, the fluorescent quantitative PCR method was also used to detect the viral RNA content in the tissues. The results showed that the rescued virus rPDCoV and the gene mutant virus rPDCoV-ΔNS7 were both detected in the heart, liver, spleen, lung, kidney, large intestine and small intestine of piglets, and the viral RNA content in the intestine, especially in the jejunum, was significantly higher than that in other organs, such as Fig.18 As shown in Figure B, this is consistent with the results of the pathological autopsy.

[0218] In order to further understand the degree of damage to the intestine caused by the virus, the duodenum, jejunum and ileum were pathologically sectioned and stained with HE. The results showed that the duodenum, jejunum and ileum of the piglets in the rPDCoV group and rPDCoV-ΔNS7 group showed shortening, atrophy and even rupture of the intestinal villi, and vacuolization of the intestinal epithelial cells (such as Fig.19 shown).

[0219] 5 Discussions

[0220] Porcine Delta coronavirus (PDCoV) is a new enteric coronavirus that has become prevalent in recent years. It can cause diarrhea, coughing, vomiting, dehydration, lethargy, and even death in newborn piglets. At present, there is no effective commercial vaccine for PDCoV, so it is very important to understand its viral characteristics and virulence characteristics to clarify its pathogenic mechanism for the future development of effective antiviral drugs and vaccines. The accessory proteins of coronavirus are important non-structural proteins. Although they are not the main components of packaging complete virus particles, they are crucial for the adsorption, proliferation, and escape of the host's natural immune response of the virus. In order to better study the effect of auxiliary gene NS7 on viral replication, this study used the PDCoV reverse genetic platform successfully built in the laboratory in the early stage - the full-length cDNA clone plasmid of PDCoV gene based on BAC system, and on this basis, used Crispr Cas9 technology for transformation, and successfully rescued the NS7 gene mutant virus. Then, the proliferation characteristics of the rescued virus and the NS7 gene mutant virus were compared by TCID50 growth curve and plaque test. The results showed that the virus titer of NS7 gene mutant virus was lower than that of rescued virus at 12h and 24h, but this difference disappeared after 36h. It has been reported that NS7a in NS7 gene is an interferon antagonist, which can inhibit the production of IFN-β by destroying the binding of IKKε with TRAF3 and IRF3, which may be the reason why the mutation of NS7 gene affects the early infection of the virus. The results of piglet pathogenicity test also found that the virus load level in piglets of NS7 gene mutant virus group and rescued virus group was consistent, and the clinical symptoms and intestinal pathological damage were similar, indicating that NS7 gene is not an essential gene for PDCoV replication, nor is it an important virulence gene for PDCoV replication.

[0221] In summary, this study successfully rescued a recombinant virus with a mutation in the PDCoVNS7 gene. The viral replication levels of the recombinant virus and the rescued virus were evaluated both in vivo and in vitro. The results of the pig challenge experiment showed that the recombinant virus was infectious to pigs and had comparable virulence to the wild virus. The recombinant virus can be used as a candidate strain for a marker inactivated vaccine.

[0222] appendix

[0223] CMV sequence (5'→3') (SEQ ID NO.11):

[0224] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0225] HDV sequence (5’→3’)(SEQ ID NO.12):

[0226] GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGAGCCA

[0227] BGH sequence (5’→3’)(SEQ ID NO.13):

[0228] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG

[0229] 1499 bp base sequence at the 5' end of PDCoV (5'→3') (SEQ ID NO.14):

[0230]

[0231] PDCoV 3' end 1409bp base sequence (5'→3') (SEQ ID NO.15):

[0232]

Claims

1. A method for constructing a recombinant virus with NS7 gene mutation of PDCoV JS2021-LX strain, characterized in that: The method comprises the following steps: (1) Construction of ΔNS7-sgRNA: A pair of gRNAs were designed upstream and downstream of the NS7 gene. The gRNAs were annealed with scaffold oligo to form double strands as transcription templates for sgRNA-ΔNS7a and sgRNA-ΔNS7b, and then transcribed in vitro by T7 transcriptase to obtain sgRNAs with recognition ability. (2) Linearization of pBAC-PDCoV vector: The pBAC-PDCoV vector was cut using Cas9 endonuclease and sgRNA to remove the NS7 gene and obtain the linearized vector pBAC-PDCoV. (3) Amplification of the overlap fragment containing the NS7 mutant gene: Primers were designed to amplify NS7-up, NS7 mutant gene fragments and NS7-down fragments respectively, and homology arms were added at the same time. The three fragments were then connected together by overlap PCR to obtain an overlap product containing the NS7 mutant gene; (4) Construction of pBAC-PDCoV-ΔNS7 vector: The linearized vector pBAC-PDCoV was connected to the overlap fragment containing the NS7 mutant gene by homologous recombination, and the connection product was transfected into LLC-PK1 cells to rescue the NS7 gene mutant recombinant virus.

2. The method according to claim 1, characterized in that The gRNA described in step (1) includes PD-ΔNS7a and PD-ΔNS7b, the nucleotide sequence of the PD-ΔNS7a is shown in SEQ ID NO.1, the nucleotide sequence of the PD-ΔNS7b is shown in SEQ ID NO.2; the nucleotide sequence of the scaffold oligo is shown in SEQ ID NO.

3.

3. The method according to claim 1, characterized in that The primers used to amplify the NS7-up fragment in step (3) are shown in SEQ ID NO.4 and SEQ ID NO.5; The primers used to amplify the NS7-down fragment are shown in SEQ ID NO.6 and SEQ ID NO.7; The primers used to amplify the NS7 mutant gene fragment are shown in SEQ ID NO.8 and SEQ ID NO.9, and the nucleotide sequence of the NS7 mutant gene is shown in SEQ ID NO.

10.

4. The method according to claim 1, characterized in that: The transcription system for in vitro transcription using T7 transcriptase in step (1) is: sgRNA transcription template 75 ng; NTPs MIX 5 μL; T7 transcriptase 1 μL; RNase free water to make up to 15 μL, and transcribe at 37°C overnight.

5. The method according to claim 1, characterized in that The enzyme digestion system for positioning and cutting the pBAC-PDCoV vector using cas9 endonuclease and sgRNA in step (2) is: 10xBuffer 5μL; sgRNA 2μL each; pBAC-PDCoV plasmid 5ug, RNase free water to 50μL, 37°C overnight enzyme digestion.

6. The method according to claim 1 or 5, characterized in that: The pBAC-PDCoV vector is constructed by the following steps: (1) The full-length gene of PDCoV is divided into 5 fragments: A, B, C, D, and E, and three restriction sites BmtI, BstBI and MluI are selected to determine the length of the 5 fragments. Each fragment is amplified by an overlap PCR method from a smaller fragment. The small fragments are divided into 10 fragments: A1, A2, B1, B2, C1, C2, D1, D2, E1, and E2. In order to distinguish the parent virus from the rescued virus, a mutation site T→A is introduced at position 17843 as a genetic molecular marker for the rescued virus. The primer sequences used to amplify the 10 fragments A1, A2, B1, B2, C1, C2, D1, D2, E1, and E2 are as follows: PD-A1-F:ATTGTAGTCTTCCATGCTCAACCTGAT PD-A1-R: TTGGGTGGCACTACATGCAAGATGCA PD-A2-F: CATCTTGCATGTAGTGCCACCCAAAG PD-A2-R:TGAAATGCACACATGCGCATTTTG PD-B1-F:GTCGTTGCTCGCGCAATGCATAA PD-B1-R:TCTAGCATCAACACAGTCAGTAAGTGTGC PD-B2-F: ACACTTACTGACTGTTGATGCTAGACC PD-B2-R:CGTTGTAGCATCCTCCTCGATTTCG PD-C1-F: ACTTTGTTACTAAGCAGTGTGCAGCTA PD-C1-R: GCTCTGCTAACACAGTATGCTGTG PD-C2-F:ACAGCATACTGTGTTAGCAGAGCATG PD-C2-R:ACTCTGAACATAGGTGCGACACG PD-D1-F: GTTCCTAACACGTGACCGTG PD-D1-R: CATGGGTACTTGGGTCGATGTCAGTATACGT PD-D2-F: CTGACATCGACCCAAGTACCCATGTTGTCCTCT PD-D2-R: AGTTTATGTAAGAAGCGATGTGCACC PD-E1-F: ATGATCTACTCGATTTGCTAACCGTCC PD-E1-R: CCTCAGAAGTTTGATGGATGGCATGATT PD-E2-F: CATGCCATCCATCAAACTTCTGAGG PD-E2-R: AGCTTTGAGCACCTGAAACCAAGAC; (2) pBAC vector transformation: The pBAC vector was transformed by inserting the CMV promoter as shown in SEQ ID NO.11, the 1499 bp bases at the 5' end of PDCoV as shown in SEQ ID NO.14, the BstBI restriction site, the 1409 bp bases at the 3' end of PDCoV as shown in SEQ ID NO.15, 25 A tail (poly) sequences, the hepatitis D nuclease sequence (HDV) as shown in SEQ ID NO.12, and the BGH transcription termination sequence as shown in SEQ ID NO.13 into the pBAC vector in sequence to obtain an intermediate vector pBAC-M containing transcriptional regulatory elements; (3) Linearization of pBAC-M and ligation of pBAC-AB vector: The intermediate vector pBAC-M was linearized through the two restriction sites BmtⅠ and BstBI, and the A and B fragments were ligated with the linearized vector pBAC-M by homologous recombination to obtain the pBAC-AB vector; (4) Linearization of pBAC-AB vector and ligation of pBAC-PDCoV vector: The pBAC-AB vector was linearized through the two restriction sites of MluⅠ and BstBI, and the C, D, and E fragments were ligated with the linearized pBAC-AB vector by homologous recombination to obtain the pBAC-PDCoV vector.

7. A recombinant virus with NS7 gene mutation of the PDCoV JS2021-LX strain constructed by the method described in any one of claims 1 to 6.

8. Use of the NS7 gene mutant recombinant virus of the PDCoV JS2021-LX strain according to claim 7 in the preparation of an inactivated porcine deltacoronavirus vaccine.

9. An inactivated porcine deltacoronavirus vaccine, characterized in that: The vaccine is an inactivated vaccine marked with the NS7 gene mutated recombinant virus of the PDCoVJS2021-LX strain as described in claim 7.

Images