Long-chain RNA Lnc012227 for inhibiting transmission of salmonella enteritidis ovary and application of long-chain RNA Lnc012227 in prevention and control of salmonella enteritidis infection

Abstract

The invention relates to the technical field of genetic engineering, in particular to a long-chain RNALnc012227 for inhibiting transmission of salmonella enteritidis ovary and application of the long-chain RNALnc012227 in prevention and control of salmonella enteritidis infection. The invention relates to a long-chain RNA (Ribonucleic Acid) Lnc012227 for inhibiting transmission of salmonella enteritidis ovary. The Lnc012227 provided by the invention can be used for indirectly regulating the expression of MAP3K8, activating NF-kappa B and MAPK signal channels and enhancing the inflammatory response of a host, so that S.Enteridis infection is controlled. The discovery not only provides a new understanding of molecular level for understanding the infection mechanism of salmonella in the duck body, but also provides a potential target spot for developing a new treatment strategy, and is helpful for reducing egg-laying duck ovarian infection and duck egg pollution caused by salmonella.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a long-chain RNA Lnc_012227 for inhibiting the ovarian transmission of Salmonella enteritidis and an application thereof in preventing and controlling Salmonella enteritidis infection. Background Art

[0002] Salmonella Enteritidis (S. Enteritidis) is a foodborne pathogen widely found in poultry. It can colonize in the preovulatory follicles of poultry follicles, resulting in reduced egg production and increasing the risk of salmonellosis in humans through consumption of contaminated eggs. Vertical transmission of Salmonella and environmental pollution are the main pathways of Salmonella contamination in the egg-laying duck industry, posing a serious threat to the breeding industry and public health safety. At present, traditional methods for controlling Salmonella infection mainly include antibiotic treatment and vaccination, but these methods have problems such as the development of drug resistance and limited vaccine protection. Studies have confirmed that Salmonella Enteritidis is prone to latent infection and colonization in tissues such as the ovaries of adult poultry, which not only causes a decrease in egg production, but also easily causes direct contamination and vertical transmission of poultry eggs, making it difficult to eliminate and prevent and control. Therefore, it is particularly important to find new and effective strategies to control Salmonella infection and transmission.

[0003] In recent years, the role of non-coding RNA (ncRNA), especially long non-coding RNA (lncRNA), in regulating host-pathogen interactions has been gradually recognized. lncRNAs participate in regulating a variety of biological processes, including immune response and pathogen infection, by interacting with miRNAs or affecting gene expression. Studies have shown that specific lncRNAs can affect the infection efficiency and spread of pathogens by regulating signaling pathways in host cells. In recent years, it has been found that lncRNANEAT1 can interact with the Rev protein of HIV-1, affect the nuclear export and translation of viral mRNA, and regulate the viral replication cycle; lncRNAH19 participates in regulating the host's metabolism and inflammatory response, affecting the efficiency of pathogen infection; lncRNAMALAT1 regulates the host's immune response to influenza virus by binding to miR-1246; lncRNA GAS5 regulates the glucocorticoid signaling pathway and affects the host's inflammatory response; lncRNA PVT1 interacts with the X protein of HBV to promote viral replication; lncRNAMEG3 affects the viral life cycle by regulating the apoptosis pathway of host cells. The regulatory roles of these lncRNAs reflect their complexity and diversity in host-pathogen interactions and provide potential targets for the development of new therapeutic strategies.

[0004] However, there are relatively few studies on the transmission mechanism of Salmonella Enteritidis infection, especially in the ovaries of laying ducks, and the related long noncoding RNA (lncRNA). Therefore, it is urgent to deepen the research on lncRNA in duck ovaries, especially those lncRNAs that may be involved in regulating Salmonella infection. By improving the knowledge and understanding of these specific lncRNAs, it will not only help us to deeply understand the immune regulatory mechanism of duck ovaries against Salmonella Enteritidis infection, but also provide theoretical support for the development of new strategies to inhibit the ovarian spread of Salmonella and reduce duck egg contamination, thereby improving the reproductive performance and public health safety of laying ducks. Summary of the invention

[0005] The purpose of the present invention is to provide a specific long non-coding RNA (lncRNA) Lnc_012227, which plays an important role in inhibiting Salmonella enteritidis infection, ovarian transmission and reducing duck egg contamination.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a long-chain RNA Lnc_012227 for inhibiting the ovarian transmission of Salmonella enteritidis. The nucleotide sequence of cDNA encoded by the long-chain RNA Lnc_012227 is shown in SEQ ID NO: 1.

[0008] The present invention also provides the use of the long-chain RNA Lnc_012227 in preventing and controlling Salmonella enteritidis infection.

[0009] Preferably, the prevention and control of Salmonella enteritidis infection is the prevention and control of Salmonella infection in the ovaries of laying ducks.

[0010] The present invention also provides an expression vector, comprising an initial vector and the long-chain RNA Lnc_012227.

[0011] Preferably, the type of the expression vector is an overexpression vector.

[0012] Preferably, the initial vector is pcDNA3.1.

[0013] Preferably, the nucleotide sequence of the expression vector is shown in SEQ ID NO:6.

[0014] The present invention also provides a host transformed or transfected with the expression vector; the host is a microorganism.

[0015] The present invention also provides application of the expression vector or the host in preventing and controlling Salmonella enteritidis infection.

[0016] Preferably, the prevention and control of Salmonella enteritidis infection is the prevention and control of Salmonella infection in the ovaries of laying ducks.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The present invention reveals the role of a specific long noncoding RNA (lncRNA) Lnc_012227 in the ovarian tissue of ducks infected with Salmonella enteritidis, providing a new molecular mechanism to understand and control Salmonella infection in the ovaries of laying ducks. Lnc_012227 can compete with miR-let-7g-5p, indirectly regulate the expression of MAP3K8, activate the NF-κB and MAPK signaling pathways, and enhance the host's inflammatory response, thereby controlling S. Enteritidis infection. This discovery not only provides new molecular insights into the infection mechanism of Salmonella in ducks, but also provides potential targets for the development of new therapeutic strategies, which will help reduce ovarian infection and duck egg contamination caused by Salmonella in laying ducks.

[0019] (2) The present invention provides a new molecular marker by identifying the expression pattern of Lnc_012227 in duck ovarian tissue infected with Salmonella enteritidis. By using the designed specific fluorescent quantitative PCR detection primer pair and kit, the present invention provides a new molecular marker that can be used to diagnose and monitor the infection of Salmonella in duck ovaries by identifying the significant increase in the expression of Lnc_012227 in duck ovarian tissue infected with Salmonella enteritidis. This characteristic can be used as a reference for evaluating the resistance potential of offspring, providing new strategies and tools for the prevention and control of Salmonella infection in the egg duck industry, and helping to improve the reproductive performance of egg ducks and the safety of duck eggs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0021] Figure 1 The relative quantitative expression results of the laying duck long RNA Lnc_012227 gene in the fluorescent quantitative PCR detection primer pair and the detection kit provided in Example 2 of the present invention. The expression amount of Lnc_012227 when uninfected, infected with MOI=1:10, and infected with MOI=1:50.

[0022] Figure 2These are the anatomical diagrams of the ovarian susceptible individual (A) and the ovarian non-susceptible individual (B) in Example 3.

[0023] Figure 3 The fluorescent quantitative PCR detection primer pair and detection kit of the laying duck long RNA Lnc_012227 gene in Example 3 were used to detect the expression level of Lnc_012227 in ovarian non-susceptible VS ovarian susceptible individuals in the infected population.

[0024] Figure 4 This is a schematic diagram of the structure of the pcDNA3.1 vector in the egg-laying duck long RNA Lnc_012227 gene overexpression vector provided in Example 4.

[0025] Figure 5 This is a colony PCR electrophoresis result diagram of the egg-laying duck long-chain RNA Lnc_012227 gene overexpression vector provided in Example 4; description of the accompanying drawings, lane M in the figure is DL2000 DNA marker, and lanes 1 and 2 are amplified fragments of the long-chain RNA Lnc_012227 overexpression vector bacterial solution.

[0026] Figure 6 The expression changes of the long-chain RNA Lnc_012227 gene in the overexpression plasmid group and the empty vector group after the laying ducks were transfected with the long-chain RNA Lnc_012227-pcDNA3.1 (overexpression plasmid group) and pcDNA3.1 (empty vector group) in Example 4.

[0027] Figure 7 This is a comparison of the amount of intracellular bacterial invasion in the overexpression plasmid group and the empty vector group after overexpression of the long-chain RNA Lnc_012227 in Example 5.

[0028] Figure 8 The expression changes of MAP3K8, a key gene of NF-κB and MAPK signaling pathway, pro-inflammatory genes TNF-α, IL-1β, IL-6 and anti-inflammatory key gene IL-10 mRNA in the overexpression vector group and the empty vector group after overexpression of the laying duck long-chain RNA Lnc_012227 in Example 5. Compared with the empty vector transfection group, the mRNA expression of MAP3K8, a key gene of NF-κB and MAPK signaling pathway, pro-inflammatory genes TNF-α, IL-1β, IL-6 in cells overexpressing the laying duck long-chain RNA Lnc_012227 increased significantly, and the mRNA expression of the anti-inflammatory gene IL-10 decreased significantly.

[0029] Fig. 9Validation of RNA miR-let-7g-5p binding target with MAP3K8-UTR or long RNA Lnc_012227. (A) Validation of potential binding sites of miR-let-7g-5p on MAP3K8-UTR. Blue letters indicate wild-type sites, and red letters indicate mutant sites in the pMir-report luciferase reporter vector. Luciferase experiments were performed in cells co-transfected with pMir-report-MAP3K8-UTR-WT (wild-type) and miR-let-7g-5p mimics or pMir-MAP3K8-UTR-MUT (mutant) and miR-let-7g-5p mimics. The results showed that miR-let-7g-5p could bind to MAP3K8-3'UTR and reduce luciferase activity, while mutating this site had no effect. (B) Potential binding sites of miR-let-7g-5p on long RNA Lnc_012227. Blue letters indicate wild-type sites, and red letters indicate mutant sites in the pMir-report luciferase reporter vector. Luciferase experiments were performed in cells co-transfected with pMir-LNC_012227-WT (wild-type) and miR-let-7g-5p mimics or pMir-LNC_012227-MUT (mutant) and miR-let-7g-5p mimics. Results miR-let-7g-5p can bind to the long RNA Lnc_012227 and reduce luciferase activity, while mutating this site has no effect. DETAILED DESCRIPTION

[0030] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0031] Example 1: Cloning and sequence verification of Lnc_012227 gene

[0032] The cDNA sequence corresponding to the egg-laying duck long chain Lnc_012227 described in this embodiment is shown in SEQ ID NO: 1. The egg-laying duck long chain Lnc_012227 of the present invention is a new LncRNA molecule obtained by a large number of bioinformatics analysis and screening of the sequencing results of follicle granulosa cell samples at different time points (0hpi, 3hpi, 6hpi, 9hpi) based on the whole transcriptome sequencing results of duck follicle granulosa cells infected with Salmonella enteritidis completed by the applicant in the early stage. The applicant named it egg-laying duck long chain Lnc_012227, and the length of the cDNA sequence corresponding to the egg-laying duck long chain Lnc_012227 is 402bp.

[0033] The specific method is: collect ovarian tissue samples of laying ducks infected with Salmonella enteritidis, and use the traditional TRIzol and chloroform method to extract total RNA from follicle tissue. Use NanoDrop 1000 micro-spectrophotometer to detect RNA sample concentration and OD value, and use 1% agarose gel electrophoresis to detect RNA integrity. Use Vazyme's reverse transcription kit HiScript IIIRT SuperMix for qPCR (+gDNA wiper) for reverse transcription to obtain cDNA template. According to the full-length fragment of the Lnc_012227 gene sequence in the whole transcriptome sequencing results, design primers:

[0034] Lnc_012227-F:aagctggctagttaagcttATGAGTAATATCTCTGGGCTCGCT;

[0035] SEQ ID NO: 2;

[0036] Lnc_012227-R:tagtcgaagggccctctagaTTATCCTCTGCCAGTGCTGAAA;

[0037] SEQ ID NO: 3;

[0038] The restriction sites were Hind III and Xba I, and PCR amplification was performed. The obtained PCR product was purified and sent for sequencing to verify the correctness of the sequence. The results showed that the length of the cDNA sequence corresponding to the long chain Lnc_012227 was 402bp, and the sequencing results were completely consistent with expectations.

[0039] SEQ ID NO: 1

[0040] >LNC_012227

[0041] ATGAGTAATATCTCTGGGCTCGCTGTGCTAACATTAGGTCTAGGGAGAACTAATCTCTTGAAGGAGAACGTGATCCGAGCAGAGCTGCCCTTCCCCAAACAAAAGCCCCGCTCGAACGTGGCACAGAGCACTGACGTGAGCTTGCTTCTGTTTGCTGACAGTGCACTAAATTCACTAAATATCCGGGCCTCTTCCCGGCAC AGGGCTGCACAGGCCTGGAGGAGACCAGCATTGACATGCACTTCATTTATGCCCTGTAATAAGGTGAGAAGAGTGGGGTGGCTCCGGGTCATCTGCAACAAAGCCTGCATGGCAAAACTGACCCCCAGGAAGGTTTGGCTGGTGTGCATGCAGGGCAGGCCAGGCGGGGAGCTGTATTTCAGCACTGGCAGAGGATAA

[0042] Example 2: Fluorescence quantitative PCR detection of Lnc_012227 gene in granulosa cells of laying duck follicles at different infection times

[0043] 1. Isolation and culture of granulosa cells of laying duck follicles:

[0044] (1) Treatment of female ducks: Laying ducks at the peak of egg-laying period were selected and killed by bleeding from the jugular vein; the entire ovarian tissue was removed and placed in a sterile culture dish filled with pre-cooled PBS; and the pre-ovulatory follicles with a diameter of 12 to 15 mm were removed.

[0045] (2) Follicle preparation: The extracted follicles were placed in a container containing 1% double-antibody PBS buffer and transferred to the intercellular space within 4 hours.

[0046] (3) Peeling off the vascular membrane: Cut off the intact preovulatory follicles and place them individually in a culture dish containing 1% double-antibody DPBS solution. Tear off the outermost vascular membrane to obtain a single intact preovulatory follicle, which is then transferred to a clean culture dish.

[0047] (4) Release the yolk and granulosa cells: Use ophthalmic scissors to cut the yolk membrane to let the yolk flow out, then use forceps to pick up the remaining membrane layer and place it in a culture dish containing 1% double-antibody PBS, shake and rinse out the white granulosa cell layer, and continue to rinse the white granulosa cell layer twice with 1% double-antibody PBS solution.

[0048] (5) Digestion and resuspension: The rinsed granulosa cell layer was transferred to a 1.5 mL centrifuge tube, and the granulosa cell layer was cut into pieces with ophthalmic scissors. The granulosa cell layer was digested with 0.25% trypsin at 4°C for 2.5 minutes. After the digestion was terminated, the granulosa cell layer was resuspended.

[0049] (6) Filtration and adjustment of cell density: Filter with a cell sieve, collect the filtered cell suspension to detect the particle cell density, and then adjust its density to 1×10 7 ~3×10 7 Pieces / mL.

[0050] (7) Cell labeling and sorting: Add FSHR direct-labeled antibody at a volume ratio of 1:200 to the cell suspension at 37°C, incubate, and perform flow cytometry sorting to sort out positive cells.

[0051] (8) Cell culture: Treat the bottom of the culture dish with 0.15 mg / mL poly-lysine solution, pipette 1 mL of cell suspension into each dish, add 1 mL of culture medium with 5% fetal bovine serum, and transfer to 37°C, 5% CO 2 Culture in a constant temperature chamber.

[0052] (9) Observation and identification: After 24 hours of culture, the cell culture dish was taken out and the cell morphology was observed under an inverted microscope. HE staining and indirect immunofluorescence were performed to identify the specificity of granulosa cells. If qualified, the cells were digested and cultured in a medium containing 10% fetal bovine serum.

[0053] 2. Detection of Lnc_012227 gene in granulosa cells of laying duck follicles at different SE infection times by fluorescence quantitative PCR

[0054] The egg-laying duck follicle granulosa cells were plated on a 24-well plate, with a cell volume of 5×10 5 After the cells adhered overnight, Salmonella enteritidis resuspended in PBS was added to each well at MOI=1:10 or MOI=1:50. After 3 hours of infection, the cells were digested with Trizol, and the total RNA in the cells was extracted according to the total RNA extraction method in Example 1, and reverse transcription was performed using the reverse transcription kit HiScript III RTSuperMix for qPCR (+gDNA wiper) to obtain a cDNA template.

[0055] Design fluorescent quantitative PCR detection primer pairs according to the Lnc_012227 gene sequence:

[0056] qLnc_012227-F:CTGCCCTTTCCCCAAACAA

[0057] qLnc_012227-R:AGCCACCCACTCTTCTCAC

[0058] As shown in SEQ ID NOs: 4 and 5.

[0059] The configuration includes 2×ChamQ SYBR Color qPCR Mix 10μL, 10μM upstream primer 0.4μL, 10μM downstream primer 0.4μL, template 2.0μL, ddH 2 O 7.2μL, total volume 20μL. Set the reaction conditions as 95℃, 30s, 1 cycle; 95℃, 10s, 60℃, 30s, 40 cycles; 95℃, 60s; 55℃, 30s, 95℃, 30s, 1 cycle. After the reaction is completed, export the data and use 2- ΔΔCT The results were analyzed using GraphPad Prism software.

[0060] Results: The expression results of the long-chain Lnc_012227 gene in the granulosa cells of laying duck follicles treated with different amounts of Enteritidis Salmonella for 3 h are shown in Figure 2. Figure 1 It can be seen that the expression response of the long-chain Lnc_012227 gene in the granulosa cells of the egg-laying duck follicles under the action of high concentrations of Salmonella Enteritidis is significantly increased compared with the expression of the Lnc_012227 gene under low concentrations of Salmonella Enteritidis infection. It can be seen that within a certain range, the long-chain Lnc_012227 gene has an important correlation with the infection amount of Salmonella Enteritidis.

[0061] Example 3: Study on the expression pattern of Lnc_012227 gene in duck ovary tissue infected with Salmonella enteritidis

[0062] Ovarian tissue samples of laying ducks infected with Salmonella Enteritidis and those that did not were collected were collected and stored in liquid nitrogen or -80°C freezer immediately after collection to maintain RNA integrity. Total RNA was extracted from ovarian tissue samples using TRIzol reagent according to the manufacturer's instructions. RNase contamination was ensured to be avoided during the entire extraction process. The concentration and purity (A260 / A280 ratio) of RNA were determined using NanoDrop 1000 micro-spectrophotometer, and the integrity of RNA was assessed using agarose gel electrophoresis. Total RNA was reverse transcribed into cDNA using high-fidelity reverse transcriptase. To eliminate the interference of genomic DNA, gDNAEraser was used for pretreatment. Fluorescence quantitative PCR was used to detect the primer pairs: as shown in SEQ ID NOs: 4 and 5. Fluorescence quantitative PCR was performed using the SYBRGreen method to evaluate the expression difference of the Lnc_012227 gene in samples infected with Salmonella Enteritidis and those that did not. 2- ΔΔCTMethods The relative expression of Lnc_012227 gene was calculated, and GraphPadPrism software was used for statistical analysis. The correlation between the expression of Lnc_012227 gene and the degree of ovarian tissue lesions was analyzed to evaluate the potential of Lnc_012227 gene as a biomarker for Salmonella Enteritidis infection. The expression results of long-chain Lnc_012227 gene in ovarian tissue of laying ducks without and with Salmonella Enteritidis are shown in Figure 2. Figure 3 It can be seen that the expression level of the long-chain Lnc_012227 gene in the ovarian tissue of laying ducks infected with Salmonella Enteritidis was significantly increased, and the long-chain Lnc_012227 gene was significantly correlated with the Salmonella Enteritidis infection in the ovarian tissue of laying ducks.

[0063] Example 4: Construction of Lnc_012227 gene overexpression vector and cell transfection

[0064] The pcDNA3.1(+) vector was selected and double digested with restriction endonucleases Hind III and XbaI. The PCR product was purified and double digested with the same restriction endonucleases. The Lnc_012227 gene fragment after digestion was connected to the vector and transformed into competent E. coli cells. Colony PCR identification and sequencing verification were performed on the transformed cells to confirm the construction of the recombinant vector ( Figure 4 and Figure 5 ). The sequencing result is shown in SEQ ID NO: 6; the individual with correct colony PCR and sequencing results is the successfully constructed recombinant vector, named 012227-pcDNA3.1.

[0065] SEQ ID NO: 6:

[0066]

[0067] SEQ ID NO: 7; F: CGCCATATGATCACTGGGCGATGTATTAAAT (enzyme cleavage site NheI)

[0068] SEQ ID NO: 8; R: TGCTCTAGACTCAGCTGTTTGGACAAGAGGT (restriction site XbaI)

[0069] Referring to the isolation and culture method of laying duck follicle granulosa cells in Example 2, laying duck follicle granulosa cells were plated on a 24-well plate, with 5×10 cells per well. 5 After the cells adhered overnight, the constructed overexpression vector was transfected into the granulosa cells of the egg-laying duck follicle. After 24 hours of transfection, the two cells transfected with pcDNA3.1 and 012227-pcDNA3.1 were digested with Trizol in Example 2, and the total RNA in the cells was extracted according to the total RNA extraction method in Example 1. Reverse transcription and SYBR Green method were used for fluorescence quantitative PCR. 2- ΔΔCT Methods The relative expression of Lnc_012227 gene was calculated, and GraphPadPrism software was used for statistical analysis to evaluate the expression effect of Lnc_012227 gene after transfection. The expression of long-chain Lnc_012227 gene in two cells transfected with pcDNA3.1 and transfected with 012227-pcDNA3.1 was shown in Figure 6 It can be seen that the long-chain Lnc_012227 was efficiently expressed in cells transfected with 012227-pcDNA3.1, which was significantly higher than that in cells transfected with empty vector pcDNA3.1.

[0070] Example 5: Effect of Lnc_012227 gene overexpression on ovarian transmission of Salmonella enteritidis

[0071] Laying duck follicle granulosa cells were cultured, and 012227-pcDNA3.1 and pcDNA3.1 plasmids were transfected into the cells. After 24 hours of culture, 100 μL of PBS resuspension of Salmonella Enteritidis was added (MOI = 1:10). After 3 hours of co-culture, the load of Salmonella Enteritidis in the transfected cells was measured to evaluate the effect of Lnc_012227 gene overexpression on the intracellular bacterial load. Results are shown in Figure 7It can be seen that the bacterial load in cells transfected with 012227-pcDNA3.1 is significantly lower than that in cells transfected with the pcDNA3.1 empty vector group, and the overexpression of the Lnc_012227 gene indicates that it has an inhibitory effect on bacterial proliferation. At the same time, the total RNA extraction method in Example 1 was used to extract the blank group (untransfected cells), cells transfected with 012227-pcDNA3.1, and cells transfected with pcDNA3.1, respectively, and the total RNA in these three groups of cells was extracted. Reverse transcription and SYBR Green methods were used for fluorescence quantitative PCR to detect the mRNA expression of key genes MAP3K8, TNF-α, IL-1β, IL-6, and IL-10 in the MAPK signaling pathway. The primers of the genes in the key pathway are as follows:

[0072] MAP3K8 gene fluorescence quantitative primers:

[0073] qMAP3K8-F:GGAGCCCCTCAGACTGCTA

[0074] qMAP3K8-R:GATGGATCGTCTCGTCCCAC

[0075] TNF-α gene fluorescence quantitative primers:

[0076] qTNF-α-F:ACAGGACAGCCTATGCCAAC

[0077] qTNF-α-R:ACAGGAAGGGCAACACATCT

[0078] IL-1β gene fluorescence quantitative primers:

[0079] qIL-1β-F:TGGGCATCAAGGGCTACAAG

[0080] qIL-1β-R:GCTGTCGATGTCCCTCATGAC

[0081] IL-6 gene fluorescence quantitative primers:

[0082] qIL-6-F:AAAGCATCTGGCAACGAC

[0083] qIL-6-R:GAGGAGGGATTTCTGGGT

[0084] IL-10 gene fluorescence quantitative primers:

[0085] IL-10-F:AGCAGCGAGCACCACCA

[0086] IL-10-R: TGCCGTTTCCGTTCATCTTT

[0087] Internal reference gene β-actin fluorescence quantitative primers:

[0088] β-actin-F:ATGTCGCCCTGGATTTCG

[0089] β-actin-R: CACAGGACTCCATACCCAAGAA

[0090] As shown in SEQ ID NOs: 9-20.

[0091] Set up 2×ChamQ SYBR Color qPCRMix 10 μL, 10 μM upstream primer 0.4 μL, 10 μM downstream primer 0.4 μL, template 2.0 μL, ddHO 2 O 7.2μL, total volume 20μL reaction system. Set the reaction conditions as 95℃, 30s, 1 cycle; 95℃, 10s, 60℃, 30s, 40 cycles; 95℃, 60s; 55℃, 30s, 95℃, 30s, 1 cycle. After the reaction is completed, export the data and use 2- ΔΔCT The results were analyzed using GraphPad Prism software. Figure 8 .

[0092] In order to verify that the long-chain RNA Lnc_012227 can compete with the non-coding small RNA miR-let-7g-5p, thereby indirectly regulating the expression of MAP3K8 mRNA, the dual luciferase reporter system was used to verify that RNA Lnc_012227 can compete with the non-coding small RNA miR-let-7g-5p to regulate the expression of MAP3K8 mRNA:

[0093] 1. Construction of reporter gene plasmid: Use the primers with restriction sites shown in SEQ ID NO: 7 and 8, which are NheI and XbaI, and perform PCR amplification to amplify the sequence containing the potential binding site of miR-let-7g-5p on Lnc_012227 and clone it into the 3'UTR region of the firefly luciferase reporter gene vector. At the same time, construct a plasmid containing the same sequence but with a mutation in the miR-let-7g-5p binding site as a control.

[0094] 2. Co-transfected cells: The constructed wild-type and mutant reporter gene plasmids were co-transfected with miR-let-7g-5pmimics (miR-let-7g-5p mimics synthesized in vitro to simulate the function of endogenous miR-let-7g-5p. By transfecting mimics into cells, the level of miR-let-7g-5p can be increased to study its role in cells) into egg-laying duck follicle granulosa cells with a confluence of more than 80%. At the same time, a plasmid containing Renilla luciferase was transfected as an internal reference to standardize the experimental results.

[0095] MAP3K83'UTR-MUT 5'-ATGACATGTTAAAACTATTGCCA-3'

[0096] MAP3K83'UTR-WT 5'-ATCTGTACATAAAACTATTGCCA-3'

[0097] let-7g-5p 3'-UGACAUGUUUGAUGAUGGAGU-5'

[0098] LNC_012227-MUT 5'-GCCGACATGTTGAACCCGTGTGGGA-3'

[0099] LNC_012227-WT 5'-GCCCTGTACAAGAACCCGTGTGGGA-3'

[0100] let-7g5p 3'-UGACAUGUUUGAUGAUGGAGU-5'

[0101] LNC_012227-MUT 5'-TGGACATGTCAAAGAGGAATCG-3'

[0102] LNC_012227-WT 5'-TGCTGTACACAAAGAGGAATCG-3'

[0103] let-7g-5p 3'-UGACAUGUUUGAUGAUGGAGU-5'

[0104] As shown in SEQ ID NOs: 21-27.

[0105] 3. Luciferase activity detection: About 48 hours after transfection, the dual luciferase reporter gene detection system was used to detect the activity of firefly luciferase and Renilla luciferase. The regulatory effect of miR-let-7g-5p on Lnc_012227 was evaluated by comparing the changes in firefly luciferase activity among the groups.

[0106] 4. Data analysis: Calculate the ratio of Firefly Luciferase / Renilla Luciferase (F / R) in each well to correct the deviation in the experiment. Compare the luciferase activity of the miR-let-7g-5p mimics treatment group with that of the control group to determine whether miR-let-7g-5p can specifically bind to Lnc_012227 and affect the expression of its luciferase reporter gene.

[0107] 5. Verify the regulation of MAP3K 8 mRNA expression: qPCR was used to detect the expression levels of MAP3K 8 mRNA and protein to verify the indirect regulatory effect of Lnc_012227 on MAP3K8 by competing with miR-let-7g-5p. This will evaluate the effect of Lnc_012227 gene overexpression on NF-κB and MAPK signaling pathways and its regulatory role in the host inflammatory signal response.

[0108] Results Fig. 9 It can be seen that the luciferase activity of the miRNA-let-7g-5p mimics transfection group of Lnc_012227 and MAP3K8 was significantly lower than that of the NC mimics of Lnc_012227 and MAP3K8 (P < 0.01); when the miRNA-let-7g-5p binding sites on Lnc_012227 and MAP3K8 were mutated, there was no difference in the luciferase activity between the mutated Lnc_012227 and mutated MAP3K8 miRNA-let-7g-5p mimics transfection group and the mutated Lnc_012227 and mutated MAP3K8 NC mimics. This indicates that miR-let-7g-5p interacts with the target genes Lnc_012227 and MAP3K8, that is, Lnc_012227 indirectly regulates MAP3K 8 by competing with miR-let-7g-5p.

[0109] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A long RNA Lnc_012227 that inhibits the ovarian spread of Salmonella enteritidis, characterized in that: The nucleotide sequence of the cDNA encoded by the long-chain RNA Lnc_012227 is shown in SEQ ID NO:

1.

2. Use of the long-chain RNA Lnc_012227 according to claim 1 in preventing and controlling Salmonella enteritidis infection.

3. The use according to claim 2, characterized in that: The control of enteritidis salmonella infection is the control of salmonella infection in the ovaries of laying ducks.

4. An expression vector, characterized in that: It comprises an initial vector and the long-chain RNA Lnc_012227 as claimed in claim 1.

5. The expression vector according to claim 4, characterized in that The type of the expression vector is an overexpression vector.

6. The expression vector according to claim 4, characterized in that The initial vector is pcDNA3.

1.

7. The expression vector according to claim 4, characterized in that The nucleotide sequence of the expression vector is shown in SEQ ID NO:

6.

8. A host, characterized in that The host is transformed or transfected with the expression vector according to any one of claims 3 to 7; the host is a microorganism.

9. Use of the expression vector according to any one of claims 3 to 7 or the host according to claim 8 in preventing and controlling Salmonella enteritidis infection.

10. The use according to claim 9, characterized in that: The control of enteritidis salmonella infection is the control of salmonella infection in the ovaries of laying ducks.

Images