Mulberry constitutive promoter and application thereof

Abstract

The invention discloses a mulberry constitutive promoter and application thereof. The promoter is a promoter pMa08455 of which the sequence is as shown in SEQ ID NO: 1 or a promoter pMa06901 of which the sequence is as shown in SEQ ID NO: 2. According to the invention, a recombinant expression vector is constructed to drive GUS (glucuronidase) gene expression, nicotiana benthamiana and mulberry leaves are transformed by an agrobacterium transient method, and the two cloned mulberry constitutive promoters are verified in the nicotiana benthamiana and can be applied to plant genetic transformation, but the pMa08455 in the mulberry leaves shows higher transcriptional activity; a stable transformation experiment in tobacco shows that the mulberry constitutive promoter pMa08455 has higher transcriptional activity, and is stable in transcriptional activity and wide in expression, so that the mulberry constitutive promoter pMa08455 is suitable for plant genetic transformation and has important significance on establishment of a mulberry genetic transformation system and research of mulberry gene functions.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and more specifically, the invention relates to a mulberry constitutive promoter and application thereof. Background Art

[0002] With the development of biotechnology, genetic engineering technology has become an important tool in the field of gene function research and agricultural application. Promoters, as key cis-acting elements that control gene expression, play a vital role in genetic engineering. Endogenous promoters derived from the species itself have higher transcriptional activity, higher safety, and better regulatory specificity than exogenous promoters, and can reduce the gene silencing phenomenon caused by repeated use of exogenous promoters. Promoters can be divided into three categories according to their expression characteristics: constitutive promoters, inducible promoters, and spatiotemporal specific promoters. Constitutive promoters are the most widely used and earliest promoters in plant genetic engineering. Plant constitutive promoters enable genes to be continuously expressed in different tissues and at various growth stages, which is particularly important for achieving efficient and stable expression of target genes in plants.

[0003] At present, some constitutive promoters have been widely used in plant genetic engineering, such as the promoter CaMV 35S derived from cauliflower mosaic virus, the promoter ZmUbipro derived from the maize polyubiquitin protein gene, and the promoter of the nopaline synthase gene NOS derived from the Ti plasmid of Agrobacterium tumefaciens. Among them, CaMV 35S is the most widely used promoter in plant genetic transformation and can be applied to monocotyledonous and dicotyledonous plants. However, the CaMV 35S promoter is derived from a plant virus, which may cause public concerns about safety, and the CaMV35S promoter is less effective in monocotyledonous plants. Therefore, the development of new and efficient constitutive promoters, especially those derived from the species itself and with low biosafety risk characteristics, is of great significance for the study of plant gene function and the development of agricultural technology.

[0004] The "Silk Road" formed by "mulberry planting and silkworm breeding" links Eastern and Western civilizations and is a spiritual symbol of mutual exchange and cooperation between different cultures. Mulberry leaves are silkworm feed, and mulberry trees are traditional cash crops in my country with important economic value. Mulberry trees are traditional Chinese medicines in my country with important medicinal value. In addition, mulberries are popular fruits. With the publication of chromosome-level genomes, mulberry research has entered the post-genomic era. Studies on active secondary metabolites rich in mulberry trees have shown that flavonoids in mulberry trees can prevent arteriosclerosis and resist aging, and alkaloids such as 1-deoxynojirimycin (DNJ) are beneficial for lowering blood sugar and blood lipids. Genetic research and improvement of mulberry trees are of great value in improving mulberry leaf yield and quality, enhancing stress resistance, and increasing active secondary metabolites, but mulberry trees have a long juvenile period, and traditional breeding cycles and efficiency are low.

[0005] At present, most of the promoters used in the study of mulberry gene function are exogenous CaMV 35S promoters, which have lower promoter efficiency than endogenous promoters and have risks such as biosafety concerns of viral promoters. There are no reports on endogenous constitutive promoters of mulberry, so screening, development and utilization of endogenous promoters of mulberry are of great significance for the study of molecular mechanism and creation of new germplasm of mulberry. Summary of the invention

[0006] Based on this, the object of the present invention is to provide a mulberry constitutive promoter with high and stable transcriptional activity.

[0007] The technical solutions for achieving the above-mentioned invention objectives include the following.

[0008] In a first aspect of the present invention, a mulberry constitutive promoter is provided, which is the promoter pMa08455 whose sequence is shown in SEQ ID NO: 1 or the promoter pMa06901 whose sequence is shown in SEQ ID NO: 2.

[0009] The second aspect of the present invention provides a recombinant expression vector carrying the above-mentioned mulberry constitutive promoter.

[0010] The third aspect of the present invention provides an engineered bacterium transformed with the above-mentioned recombinant expression vector.

[0011] The fourth aspect of the present invention provides the use of the above-mentioned mulberry constitutive promoter, recombinant expression vector or engineered bacteria in plant genetic transformation or mulberry gene function research.

[0012] The invention clones two mulberry promoters pMa08455 and pMa06901 from the Morus altissima genome for the first time, drives the expression of GUS gene by constructing a recombinant expression vector, and transforms Nicotiana benthamiana and mulberry leaves by an Agrobacterium transient method. The two cloned mulberry promoters are verified in Nicotiana benthamiana and can be applied to plant genetic transformation, but pMa08455 exhibits higher transcription activity in mulberry leaves; stable transformation experiments in tobacco show that the mulberry promoter pMa08455 has higher transcription activity than pMa06901, and the transcription activity is stable and widely expressed; therefore, the promoter pMa08455 is an endogenous constitutive promoter of mulberry, is suitable for plant genetic transformation, and is of great significance for the establishment of a mulberry genetic transformation system and the study of mulberry gene functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the result of homology comparison between the protein encoded by the gene driven by the two mulberry constitutive promoters pMa08455 and pMa06901 in Example 1 of the present invention and the protein encoded by the Arabidopsis thaliana AtUBQ10 (AT4G05320) gene.

[0014] Figure 2 This is an analysis of the cis-acting elements of the two mulberry constitutive promoters pMa08455 and pMa06901 in Example 1 of the present invention.

[0015] Figure 3 It is a map of the recombinant expression vectors pBI121-pMa08455-GUS and pBI121-pMa06901-GUS constructed in Example 2 of the present invention, and the control expression vector pBI121-p35S-GUS.

[0016] Figure 4 The results of GUS staining of Nicotiana benthamiana leaves transiently transformed with the recombinant expression vector in Example 3 of the present invention; wherein, the left side of A is pBI121-pMa08455-GUS, and the right side is pBI121-p35S-GUS; the left side of B is pBI121-pMa06901-GUS, and the right side is pBI121-p35S-GUS.

[0017] Figure 5 This is the GUS staining result of mulberry leaf leaves transiently transformed with the recombinant expression vector in Example 3 of the present invention.

[0018] Figure 6 This is the GUS staining result of the regenerated leaves obtained by stably transforming the tobacco leaf disc with the recombinant expression vector in Example 4 of the present invention.

[0019] Figure 7 This is the GUS staining result of the F1 generation seedlings obtained by stably transforming the large tobacco leaf disc with the recombinant expression vector in Example 4 of the present invention.

[0020] Figure 8 These are the GUS staining results of various tissues of the F1 generation plants obtained by stably transforming tobacco leaf discs with the recombinant expression vector in Example 4 of the present invention. DETAILED DESCRIPTION

[0021] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0022] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0023] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual (2013), or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0024] The invention is based on homology comparison of Arabidopsis thaliana ubiquitin protein AtUBQ (AT3G52590), screens two mulberry ubiquitin proteins from Morus altissima genome, uses Morus altissima genome DNA as a template, adopts a PCR method to clone its promoter sequence, obtains two mulberry constitutive promoters for the first time, constructs a recombinant expression vector using the screened mulberry endogenous promoter to drive GUS gene expression, transforms Nicotiana benthamiana and mulberry leaves by Agrobacterium transient method, performs GUS histochemical staining analysis on the leaves, and the results show that compared with CaMV 35S (cauliflower mosaic promoter) commonly used in plant gene function research, the transcription efficiency of mulberry constitutive promoters pMa08455 and pMa06901 in Nicotiana benthamiana leaves is not significantly different, and both can be applied to plant genetic transformation, but pMa08455 exhibits higher transcription activity in mulberry leaves. To eliminate the interference of bacterial solution on staining and verify the transcriptional activity of the selected promoter in the progeny, the stable transformation of tobacco leaf discs mediated by Agrobacterium was further tested. The GUS staining analysis of the leaves of the positive tobacco plants regenerated after transformation showed that the promoter pMa08455 had a strong staining site and pMa06901 had a weak GUS expression activity. When the positive transgenic seedlings obtained by transformation were strong enough, they were transferred from the tissue culture environment to the outdoors, and the seeds were harvested after flowering and self-pollination, and the seeds were sown to obtain the F1 generation. The seedlings of the F1 generation were stained after 10 days of growth. The results showed that all tissues of the F1 seedlings of the pMa08455 promoter group were all colored, while the F1 seedlings of the pMa06901 promoter group did not produce coloring points. After that, the F1 seedlings of the pMa08455 promoter group were further cultured, and GUS staining analysis was performed on all tissues of the F1 tobacco after they were fully matured. The results showed that all tissues of the F1 tobacco were all colored, which was consistent with its constitutive promoter characteristics. The phenomenon that the transcription effects of the mulberry endogenous constitutive promoters pMa08455, pMa06901 and 35S promoter are different in the experiment may be due to the difference in transcriptional activity between promoters in different species and within the same species; and the difference between the two mulberry constitutive promoters may be due to the difference in the cis-acting elements of the two mulberry endogenous constitutive promoters, or it may be due to the fact that the transgenic GUS copy number is reduced to a level insufficient to maintain stable expression during the self-pollination of transgenic tobacco. The results of the present invention show that the promoter pMa08455 is suitable for plant genetic transformation and can be used for the study of mulberry gene function.

[0025] In some embodiments of the present invention, a mulberry constitutive promoter is disclosed, which is the promoter pMa08455 with a sequence as shown in SEQ ID NO: 1 or the promoter pMa06901 with a sequence as shown in SEQ ID NO: 2; preferably, the promoter pMa08455 with a sequence as shown in SEQ ID NO: 1.

[0026] In other embodiments of the present invention, disclosed is a use of a mulberry constitutive promoter in plant genetic transformation or mulberry gene function research.

[0027] In other embodiments of the present invention, a recombinant expression vector carrying the above-mentioned mulberry constitutive promoter is disclosed.

[0028] In some embodiments, the expression vector in the recombinant expression vector is a pBI121 plasmid.

[0029] In some of the embodiments, the recombinant expression vector carries a reporter gene, which facilitates researchers to visually track and quantitatively analyze the temporal and spatial specificity of gene expression. By connecting the reporter gene to the promoter and constructing it on the expression vector, after transforming the plant cells, with the help of the promoter's efficient driving ability, researchers can use equipment such as fluorescence microscopes to intuitively observe the expression position and intensity of the reporter gene in plant tissues, providing a strong basis for understanding the gene expression regulation mechanism.

[0030] In some embodiments, the reporter gene is the GUS gene.

[0031] In some embodiments, the recombinant expression vector is pBI121-pMa08455-GUS or pBI121-pMa06901-GUS, preferably pBI121-pMa08455-GUS.

[0032] In other embodiments of the present invention, the application of the above-mentioned recombinant expression vector in plant genetic transformation or mulberry gene function research is disclosed.

[0033] In other embodiments of the present invention, an engineered bacterium transformed with the above-mentioned recombinant expression vector is disclosed.

[0034] In other embodiments of the present invention, the application of the above-mentioned engineering bacteria in plant genetic transformation and mulberry gene function research is disclosed.

[0035] The mulberry trees and tobacco used in the following examples were all cultivated in Southwest University and identified as Morus albavar. Pendula, Nicotiana benthamiana, and Nicotiana tabacum. Plant genomic DNA extraction kit, universal DNA purification and recovery kit, and plasmid mini-extraction kit were purchased from Guangzhou Feiyang Biotechnology Co., Ltd.; GUS dye solution was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; 6-BA and IAA plant hormones were purchased from PhytoTechnology; Agar was purchased from Aladdin; sucrose, M404, MES, acetosyringone (As), and kanamycin were purchased from Shanghai Shenggong Biotechnology Co., Ltd.; cephalosporin was purchased from Sigma; DNA molecular weight MakerBM 5000+ was purchased from Beijing Bomade Gene Technology Co., Ltd.; Trans1-T1 Phage Resistant Chemically Competent Cell was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction endonucleases HindⅢ and BamHI were purchased from Thermo Fisher Scientific; Seamless Cloning and Assembly Kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; GV3101 Chemically Competent Cell was purchased from Shanghai Weidi Biotechnology Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0036] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0037] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] Example 1 Cloning of the mulberry constitutive promoter

[0039] The following steps are involved:

[0040] 1. Take leaves of Morus alba, use plant genomic DNA extraction kit to extract Morus alba genomic DNA, use Arabidopsis thaliana AtUBQ10 gene sequence (AT4G05320) as query reference, search for homologous mulberry candidate genes in mulberry genome database, and successfully screen out 2 mulberry ubiquitin genes Ma08455 and Ma06901 (homologous comparison Figure 1As shown). Then, the promoter sequences pMa08455 and pMa06901, which are 1500bp upstream of the Ma08455 and Ma06901 genes, were cloned using the genomic DNA of Sang. The promoter sequences were submitted to the PlantCare website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) for cis-acting element prediction. Then, the same type of response elements were given the same label using the Excel screening tool, and the text information was organized into text information suitable for TBtools visualization. Then, TBtools was used to visualize the cis-acting elements, as shown in Figure 1. Figure 2 shown.

[0041] from Figure 2 It can be seen that pMa08455 contains more salicylic acid (SA, which plays an obvious role in plant disease resistance, drought resistance, cold resistance, salt and alkali resistance, and also promotes seed germination and fruit ripening) and auxin response elements as-1, CAAT-box; light response elements AT1-motif and MRE (play an important role in promoting plant growth and enhancing stress resistance, and can stabilize and enhance gene expression); drought and ABA response elements MYC, ABRE; and Wbox (plays an important role in promoting plant growth and enhancing stress resistance, and can stabilize and enhance gene expression) and mechanical damage response element WUN-motif that can enhance plant abiotic stress resistance; while pMa06901 has more abscisic acid response elements AAGAA-motif, light response elements GT1-motif and LAMP-element, gibberellin response element P-box, auxin response element TGA-element, etc.

[0042] 2. PCR amplification was performed using the constitutive promoter pMa08455 and the 1500bp sequence upstream of pMa06901 as templates, using the constitutive promoter primer pair 1 (SEQ ID NO:3 and SEQ ID NO:4) and primer pair 2 (SEQ ID NO:5 and SEQ ID NO:6) designed by Snapgene4.0. The PCR amplification reaction system was: ddH2O 7μL, 2×PrimeSTARHSDNAPolymerase 10μL, DNA template 1μL, upstream and downstream primers (10μM) 1μL each, a total of 20μL system. The PCR amplification reaction program was: 98℃2min; 98℃15s, 55℃15s, 72℃30s, 31 cycles; 72℃2min; 12℃ storage.

[0043] Table 1

[0044]

[0045] 3. The PCR amplification products were detected by 1.1% agarose gel electrophoresis, and the target DNA fragments were recovered by gel excision, namely the promoter fragment pMa08455 (nucleotide sequence as shown in SEQ ID NO: 1) and pMa06901 (nucleotide sequence as shown in SEQ ID NO: 2), which were stored at -20°C for future use.

[0046] SEQ ID NO:1

[0047] aactcgaatcaacaaactaaatggattctaaaattatcattttaactatatttagttctctgcattttcttttaaaaaaaaatttgaatt

[0048] taaaaagtttccgtcaaaatttgaatgcaaatcaaaattacttatttaaacacatacaagtaaacagattatgtgtttttatcagct

[0049] cctctcaatttgaatttaaatgtcataagcggtatatcaacttccatttggttcatagattagaactatgtgattataattattttcga

[0050] tttatatgtattttttatgagaaaaaatactgtagtaaattacgaatcataatttaaatcaggaaacgaattcttttactaaacatcg

[0051] tgtataattgttgaatttaaacttgaaattaagatgaagaattattaaactagaaaataaaatcaattattgactttcaacttttaatt

[0052] gttattattttttggcaactttttattatttattagtaaaaggacaattattattcttttctttttcttttgtgctaagtaaactacattatcct

[0053] tgaaaaagtcctctatcctccaccaacttgtgcgatcaagtagctatttccgctacctttttttttttaatttttaatttatttaattaat

[0054] taacttctattaattttttaataaatgaattactttttcatttcttttaagtttttaggtttaacagatttgatctccaaaaacttgtttttga

[0055] gaaaaagagattcatttttaattgatcattcgtaatttattacattatttttcttataaaaaagacacataaata

[0056] aaaaatagttcaaatcacatggttcgaattagaagacatttgttttctatatcatttttaattctaaatcataattcataattatttacg

[0057] atattttctttaaaaaaaaatatacataaaataaaaataattctgaaccataattttaaatatataaacaaaaacatctcctaattaattt

[0058] ctaaattattttacaaagtcgatgtttcctaacataacagatgacgtgaaactgacgaagcctccccccacttgttccaaatatt

[0059] tttctctttgagaatatcaaacttaaaattcaaataacgaaagtgctttttcttttttttttttttgagaaaaacaaaaaagtggtt

[0060] gtcaatattaaattaaaattaaataaatactttttgaacaaaaacgagtggttgtccgcaaattcgttgtatctagtcaagactgg

[0061] aaatttcctgacgaccagaaaattctttattaaaaaccaaacaaaaaaaaaactagataaatctaggccgttcgataattttccg

[0062] ccgactctattgaccgctcatcaccgcatccctcttcctatatagaggacctcctcttccccgttttcctcacattcatcacaga

[0063] aattggtaaaaaaaaaccctgttgtttcaatcactctctcaaaatctgtcagtttctcttcaatctcttctgaaaat

[0064] SEQ ID NO:2

[0065] acagagagatgtcatcgactatttacaaagttgatttaagccatctccagcaacttaggcggtctaggctggagattggaaa

[0066] aaaacaaaacaaaaaattcctcttcaaagcttcaaaagagatttcctgaagaggaaattaaaaaaataaaaaaaataata

[0067] ataaaaaaaaataaagatattaaggaaactagtatgggccccagtgtcaattttgagttagagaaacagatattctagcttttt

[0068] ccaaaaaataaataatccaacaaaaaataaaatacaaaaaaaaaaaaaaaacaaatataccaaacttgccgtgtcaaccga

[0069] gagtttgacaactcatttctacacgcgccatgctttcattggctaaaactgtgttgacgtaactgaatcacatatctccttatcat

[0070] ataaatggagccccaaacgcaaccctaattcctcattttcatagtacgcaagtttattttggttgtgaatcaaacgaatccaag

[0071] caaaaaaattcttcaaggtaacgaatttttctctattttcgctcttttcttgattgtatgctttcttttcttttcgttcggtgaaaaatttag

[0072] gtataaagaagcgaaattgtgctctgtttgatcatcttttcgtttctgtttgatcgaacttgccgattaggatcttttgctttattctaat

[0073] gattctaaagctgcagatctgataattcttatgggaaatttaactcgtgtgtacgagattttcttttctgacacttgatatggaattt

[0074] taaaatttaagtcgttttgatattttttttttgtcgattcctgttgatctgaccttttccttcagcaaaagaatgaatctttgatttttgttt

[0075] ggtcgagttatttattcttttttgctgcaattatgatcatgtcgaagtttggtcgagttattttggtcgagttaatggatctttgatttt

[0076] ctttctttcttttttttatctgacctttttccggcagcgaaaaatgaatcgatggtttaatattgtagtttcgttgatatatttttggta

[0077] cgcatttttaaatatatatatatatatatatatctgaaggttgttttcttgaaacgatagaatcttatctgattgacgatactatttg

[0078] gttttgatttgatttcgttgatgctgtgtgggacttttgggaaaagaatatacaatttgtttactgattaaccaattctatgtcgaaa

[0079] atatagggggatttgatgccgttttataataaccaattaaactgataaaattccttttgaaaataaattgatcgtaaatctttctttta

[0080] tgtgttttttatgttttttttttttttttttttttttcgttttgtgtgaatttcttggtagattttggttataattttttttcattattatttatcattg

[0081] attgatggaaattcttcatttttttttttggctaaatttccgggtaggcttttgttctaagttatgttatcattcattattgatag

[0082] Example 2 Construction of recombinant expression vector and acquisition of engineered bacteria

[0083] The pBI121 plasmid was double-digested with restriction endonucleases HindIII and BamHI, and the target vector fragment was recovered by gel excision. The promoter fragments of pMa08455 and pMa06901 recovered in Example 1 were After homologous recombination between the Seamless Cloning and Assembly Kit and the recovered vector fragment (homologous recombination reaction system: 2× Basic Assembly Mix 5 μL, pBI121 vector fragment 2 μL, promoter fragment 2 μL, ddH2O 1 μL, 50°C reaction for 20 min), the recombinant product was transformed into Trans1-T1 competent cells. One day later, a single clone colony was picked for PCR detection, and after being sent to the company for sequencing verification, the correct bacterial solution was expanded and cultured to extract the plasmid, which was the recombinant expression vector pBI121-pMa08455-GUS and pBI121-pMa06901-GUS.

[0084] The recombinant expression vectors pBI121-pMa08455-GUS and pBI121-pMa06901-GUS were respectively transferred into Agrobacterium competent GV3101, inverted and cultured at 28°C for two days, and single clones were picked and cultured in YEB liquid medium (Kan 50μg / mL, Rif 50μg / mL) for one activation culture. The bacterial liquid PCR was used to detect whether the plasmid was transferred into Agrobacterium, and the correct Agrobacterium strain (i.e., Agrobacterium transformed with the recombinant expression vector) was verified, and it was stored in 50% glycerol in a -80°C refrigerator for subsequent experiments. The pBI121 plasmid (which contains the 35S-GUS part, represented by pBI121-p35S-GUS in the following examples) was used as a control. The maps of the recombinant expression vectors driven by different promoters are shown in the following figure. Figure 3 shown.

[0085] Example 3 Analysis of transient expression activity of different promoters in tobacco and mulberry leaves

[0086] Take 200 μL of Agrobacterium tumefaciens transformed with the recombinant expression vectors pBI121-pMa08455-GUS, pBI121-pMa06901-GUS, and pBI121-p35S-GUS constructed in Example 2, add them to 20 mL YEB liquid culture medium (Kan 50 μg / mL, Rif 50 μg / mL), and activate and culture at 28°C, 220 rpm until the bacterial solution OD 600 About 0.6-0.8; centrifuge at 5000rpm for 10min to collect the cells, discard the supernatant, resuspend in Buffer (weigh MgCl22.03 g, MES2.13g, add ddH2O to 1000mL, adjust pH to 5.4 with 1M NaOH, autoclave at 121℃ for 20min, cool and store at room temperature), adjust OD 600 1.0. After being placed in the dark at room temperature for 3 hours, the 1mL needleless syringe was used to infiltrate and inject into the back of Nicotiana benthamiana leaves at the 4-6 leaf stage. After the injection, the tobacco was kept in a light-proof and moisturizing environment. After 3 days, the leaves were taken for GUS staining, and the transcriptional activity of the promoter was judged by the expression results of GUS. Each recombinant expression vector was repeated 3 times in technology and 3 times in biology. Among them, the GUS dye solution was prepared: after the X-Gluc solvent melted at room temperature, all the solvent was added to 1 tube of X-Gluc dry powder, and the powder was oscillated and mixed to dissolve to obtain 50×GUS dye concentrate; before use, the GUS dye concentrate was diluted 50 times with GUS dye buffer to prepare GUS dye solution, which was prepared and used immediately. Staining steps: Soak the infected leaves in the GUS dye solution and keep warm at 37°C overnight; the stained leaves were transferred to 95% ethanol for decolorization 2-3 times until the negative control material turned white. Observe the leaves after complete decolorization with the naked eye, and the blue dots on the white background are the GUS expression sites.

[0087] The results of transient transformation experiments of Nicotiana benthamiana are as follows Figure 4 As shown in the results of GUS staining, it can be seen that there is no significant difference between the pMa08455 promoter and the pMa06901 promoter and the p35S promoter in the control group, indicating that the two selected mulberry constitutive endogenous promoters are the same as the p35S promoter commonly used in plant gene function research in tobacco and have high transcriptional activity.

[0088] The resuspended bacterial solution was vacuum infiltrated into the first pair of true leaves of Morus altissima (0.6 kg / cm 2 , 10min), then washed with distilled water to remove residual bacterial liquid, placed in a culture dish to moisturize and culture in the dark for 3 days, and after 3 days, the leaves were taken for GUS staining, and the transcriptional activity of the promoter was judged by the expression results of GUS. Each recombinant expression vector was repeated 3 times in technology and 3 times in biology.

[0089] The results of the mulberry leaf transient transformation experiment are as follows Figure 5 As shown in the figure, the GUS staining results show that the pMa08455 promoter has a significant color difference compared with the p35S promoter and the pMa06901 promoter, indicating that the transcription activity of the pMa08455 promoter is the highest in mulberry leaves, and the transcription effect in mulberry trees is significantly stronger than that of the p35S promoter commonly used in plant gene function research, and can be used in subsequent mulberry genetic transformation and gene function research.

[0090] The results of this example show that the two cloned mulberry constitutive promoters were verified in Nicotiana benthamiana and can be used for plant genetic transformation. However, their transcriptional activities in mulberry leaves are different. Promoter pMa08455 has the highest transcriptional activity in mulberry and was selected for subsequent research.

[0091] Example 4 Stable transformation of mulberry constitutive promoter in tobacco and progeny activity analysis

[0092] In order to further test the function of promoters pMa08455 and pMa06901 in genetic transformation, the recombinant expression vectors pBI121-pMa08455-GUS and pBI121-pMa06901-GUS constructed in Example 2 were transformed into Agrobacterium, and stable transformation and progeny activity analysis were carried out in tobacco. The specific steps are as follows:

[0093] 1. pBI121-pMa08455-GUS and pBI121-pMa06901-GUS were transformed into Agrobacterium GV3101 respectively, and Agrobacterium was cultured according to the method of Example 3. After centrifugation of the bacterial solution, the bacterial cells were collected and resuspended in Buffer (4.44 g of M404 inorganic salt, 30 g of sucrose, ddH2O was added to 1000 mL, pH was adjusted to 5.4 with 1 M NaOH, and sterilized at 121 ° C for 15 min. After cooling, As (acetosyringone) was added to a final concentration of 100 μM and placed at room temperature for use). Adjust OD 600 is 0.6.

[0094] 2. Take the American tobacco leaves from the tissue culture environment and cut them into pieces about 0.25cm 2 The large and small leaf discs were placed in the resuspended bacterial solution, and the explants were removed after gentle shaking for 15 minutes. The surface bacterial solution was absorbed with sterile filter paper. Then it was inoculated on a co-culture medium (sucrose 30g / L+M4044.43 g / L+6-BA) with a layer of filter paper on the surface.

[0095] 2mg / L+IAA 0.5mg / L+Agar 7.0g / L+AS 100μmol / L, pH 5.8, 121°C, high pressure sterilization for 20min), and cultured in the dark at 24°C for two days.

[0096] 3. Two days later, transfer the explants to screening medium (sucrose 30 g / L + M4044.43 g / L + 6-BA 2 mg / L + IAA 0.5 mg / L + Agar 7.0 g / L + cephalosporin 300 mg / L + kanamycin 50 mg / L, pH 5.8, 121°C, autoclave for 20 min) for differentiation culture, subculture once every month until resistant buds appear, cut them off and transfer them to rooting medium (sucrose 30 g / L + M4044.43 g / L + 6-BA 2 mg / L + IAA 0.5 mg / L + NAA 0.5 mg / L + Agar 7.0 g / L, pH 5.8, 121°C, autoclave for 20 min) for culture until complete plants are formed. When the resistant seedlings are strong enough and about 4 cm long, remove the root agar and put it in water for 1 day to harden the seedlings. Transplant it to grow outdoors and analyze the regenerated leaves by GUS staining. Figure 6 As shown, leaves of tobacco transformed with the pMa08455 promoter had stronger pigmentation sites, indicating stronger transcriptional activity, while leaves of tobacco transformed with the pMa06901 promoter had weaker GUS expression activity.

[0097] 4. Since the GUS gene in the recombinant expression vector does not contain introns during the constitutive promoter activity analysis experiment, there may be an illusion that Agrobacterium stains blue. It is necessary to prove that the offspring of the stably transformed positive tobacco plants still have the parental phenotype and eliminate the residual interference of Agrobacterium. The transgenic tobacco plants continued to grow and flower and self-pollinate. The mature seeds were harvested and germinated in the greenhouse soil to obtain the F1 generation. After 10 days of growth, the F1 seedlings were subjected to GUS staining analysis. The results are as follows: Figure 7 The results showed that about 3 / 4 (62 / 85) of the F1 seedlings transformed with the pMa08455 promoter were stained blue and the staining results were obvious, which was consistent with Mendel's law of segregation. However, the F1 seedlings transformed with the pMa06901 promoter did not produce any colored spots (0% (0 / 60)).

[0098] 5. When the positive plants (Positive) grown from the F1 generation seeds of Nicotiana tabacum and the separated negative plants (Null) grow to maturity, various tissue parts in the same growth state are taken for GUS staining and photographed. Figure 8 The results showed that the staining was attached in all tissues of tobacco transformed with the pMa08455 promoter, indicating that the transcriptional activity of the mulberry endogenous constitutive promoter pMa08455 was stable and widely expressed.

[0099] 2. When the positive plants (Positive) grown from the F1 generation seeds of Nicotiana tabacum and the separated negative plants (Null) grow to maturity, various tissue parts in the same growth state are taken for GUS staining and photographed. Figure 8 The results showed that the staining was attached in all tissues of tobacco transformed with the pMa08455 promoter, indicating that the mulberry promoter pMa08455 is an endogenous constitutive promoter, and its transcriptional activity is stable and widely expressed.

[0100] The results of this example show that the mulberry constitutive promoter pMa08455 has high transcriptional activity and is suitable for plant genetic transformation, which is of great significance for the establishment of a mulberry genetic transformation system and the study of mulberry gene function.

[0101] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0102] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A mulberry constitutive promoter, characterized in that It is the promoter pMa08455 whose sequence is shown in SEQ ID NO: 1 or the promoter pMa06901 whose sequence is shown in SEQ ID NO: 2; preferably, it is the promoter pMa08455 whose sequence is shown in SEQ ID NO:

1.

2. Use of the mulberry constitutive promoter according to claim 1 in plant genetic transformation or mulberry gene function research.

3. A recombinant expression vector carrying the mulberry constitutive promoter according to claim 1.

4. The recombinant expression vector according to claim 3, characterized in that The expression vector in the recombinant expression vector is a pBI121 plasmid.

5. The recombinant expression vector according to claim 3, characterized in that: The recombinant expression vector carries a reporter gene.

6. The recombinant expression vector according to claim 5, characterized in that The reporter gene is the GUS gene.

7. The recombinant expression vector according to claim 6, characterized in that The recombinant expression vector is pBI121-pMa08455-GUS or pBI121-pMa06901-GUS, preferably pBI121-pMa08455-GUS.

8. Use of the recombinant expression vector according to any one of claims 3 to 7 in plant genetic transformation or mulberry gene function research.

9. An engineered bacterium transformed with the recombinant expression vector according to any one of claims 3 to 7.

10. Use of the engineering bacteria according to claim 9 in plant genetic transformation and mulberry gene function research.

Images