A ramie high-temperature inducible promoter and application thereof

Abstract

The present application relates to the technical field of plant genetic engineering, and provides a ramie high-temperature inducible promoter and application thereof, wherein the nucleotide sequence of the promoter is shown as SEQ ID NO:1. The ramie high-temperature inducible promoter is rich in temperature-related cis-acting elements (CCAAT-Box), and further has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif), and can be used as an effective tool for creating high-temperature-resistant plant varieties through genetic engineering.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a ramie high-temperature inducible promoter and application thereof. BACKGROUND

[0002] Ramie [Boehmeria nivea (L.) Gaudich.], a perennial herb of the family Urticaceae, is one of the important bast fiber economic crops in China, and is mainly applied in the pharmaceutical industry, food industry and light industry. Long-term research has found that the fiber quality of ramie harvested in summer is significantly lower than that in spring, and temperature is the key factor leading to the difference. Therefore, it is of great significance to use molecular biology means to mine high-temperature inducible promoters for improving the heat resistance of ramie by using genetic engineering technology to adapt to the global warming climate trend and the increasingly unfavorable planting environment.

[0003] The MYB (v-myb avian myeloblastosis viral oncogene homolog) gene family is one of the most important transcription factor families in higher plants, and plays an important role in regulating the growth and development of plants, biological and non-biological stress response. Under external stress conditions, MYB transcription factors regulate the response of plants to adverse stress through various mechanisms such as regulating gene expression, participating in hormone signaling pathways, regulating secondary metabolism and improving antioxidant capacity. For example, under high-temperature stress, lily LlMYB305 activates LlHSC70 promoter activity to participate in plant heat tolerance, and Arabidopsis AtMYB30 regulates oxidative and heat stress response through Annexin-mediated cytoplasmic calcium signaling.

[0004] In the transcriptional regulation mechanism of plant stress resistance, the cis-acting elements of the promoter play a crucial role. In recent years, many plant stress inducible promoters have been successfully cloned and identified, but there is no report on the high-temperature inducible promoter of ramie. Therefore, it is of great significance to isolate and identify the endogenous high-temperature inducible promoter of ramie for creating new ramie varieties with high-temperature resistance by using genetic engineering methods, and also provides a new idea and tool for plant stress resistance genetic engineering. SUMMARY

[0005] Therefore, the present application provides a ramie high-temperature inducible promoter and application thereof, which can be used for plant stress resistance genetic engineering.

[0006] The technical scheme of the present application is implemented as follows: In a first aspect, the present application provides a ramie high-temperature inducible promoter, and the nucleotide sequence of the promoter is shown as SEQ ID NO: 1.

[0007] In a second aspect, the application provides an application of a ramie high-temperature inducible promoter in starting expression of a target gene in a plant tissue under high-temperature induction.

[0008] Based on the above technical solution, preferably, the ramie high-temperature inducible promoter drives up-regulated expression of a reporter gene GUS in the transgenic Arabidopsis thaliana under high-temperature induction.

[0009] In a third aspect, the application provides a target gene expression vector comprising the ramie high-temperature inducible promoter.

[0010] Based on the above technical solution, preferably, the target gene is a beta-glucuronidase gene, and the expression vector is pBI121::BnMYB6 pro ::GUS.

[0011] In a fourth aspect, the application provides a method for constructing a transgenic plant with high-temperature induction expression of a transgene, comprising the following steps:

[0012] S1, constructing an expression vector of the target gene;

[0013] S2, connecting the promoter of claim 1 to the expression vector of step S1, and then transforming the Agrobacterium;

[0014] S3, mediating the transformed Agrobacterium strain to transform a plant, to obtain the transgenic plant with high-temperature induction expression of the transgene.

[0015] The ramie high-temperature inducible promoter and the application thereof have the following beneficial effects relative to the prior art:

[0016] The ramie high-temperature inducible promoter of the application is derived from a R2R3 type transcription factor gene BnMYB6 cloned from ramie Huazan No.5, which is rich in temperature-related cis-acting elements (CCAAT-Box), and further has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif). The recombinant vector containing the promoter driving GUS expression is transformed into Arabidopsis thaliana by Agrobacterium-mediated method, to obtain a transgenic Arabidopsis thaliana. Comparative analysis proves that the transgenic Arabidopsis thaliana can express the reporter gene more efficiently under high-temperature induction than under non-high-temperature conditions, so that the transgenic Arabidopsis thaliana obtains the ability to express the GUS gene which is not possessed by non-transgenic Arabidopsis thaliana, and can express more highly under high-temperature induction. It is shown that the ramie BnMYB6 gene promoter of the application is a high-temperature inducible promoter, which can be used as an effective tool for creating high-temperature resistant plant varieties through genetic engineering. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to make the technical solutions of the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or the prior art description will be briefly introduced below. Obviously, the accompanying drawings in the following description only illustrate some of the embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0018] Figure 1 PCR electrophoresis map of BnMYB6 gene promoter of Huazan No.5 ramie, M- Marker; lane 1-BnMYB6 gene promoter amplification result.

[0019] Figure 2 Double enzyme electrophoresis map of pBI121, M- Marker; lane 1-6-double enzyme cleavage result.

[0020] Figure 3 BnMYB6 pro ::GUS recombinant vector bacterial liquid PCR detection. M- Marker; lane 1-6-6 positive single colonies randomly picked.

[0021] Figure 4 BnMYB6 pro ::GUS transgenic Arabidopsis line (BnMYB6 pro ::GUS-1; BnMYB6 pro ::GUS-8; BnMYB6 pro ::GUS-12) under high temperature of 35℃ for different treatment time. Scale = 1mm.

[0022] Figure 5 BnMYB6 pro ::GUS transgenic Arabidopsis under high temperature of 35℃ for different treatment time, figure A is the relative expression level of BnMYB6 pro ::GUS-1, figure B is the relative expression level of BnMYB6 pro ::GUS-8, figure C is the relative expression level of BnMYB6 pro ::GUS-12. * indicates that there is a significant difference, p<0.05; ** indicates that there is a very significant difference, p<0.01. DETAILED DESCRIPTION

[0023] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, but not all the embodiments of the present application. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative work belong to the protection scope of the present application.

[0024] The applicant's laboratory cloned a R2R3 type transcription factor gene BnMYB6 from ramie Huayan No. 5, and found that high temperature treatment can significantly increase the expression level of the gene in the stem bark of ramie. Further research and analysis found that the BnMYB6 gene promoter is rich in temperature-related cis-acting elements, and also has elements related to drought (LTRE), dehydration (CATNTG motif) and wound induction (AG motif). After searching, no relevant reports on the gene promoter sequence and its biological function have been found so far.

[0025] Further, the present application uses the ClonExpress system to connect the BnMYB6 gene promoter to the GUS expression vector pBI121 through homologous recombination reaction, and verifies the function of the BnMYB6 gene promoter through the Arabidopsis transformation system. Experiments prove that the BnMYB6 gene promoter of ramie Huayan No. 5 described in the present application can up-regulate the expression of target genes under high temperature induction conditions, and is expected to be used for the creation of transgenic high-temperature-resistant plants.

[0026] The ramie high-temperature inducible promoter and its application of the present application will be further described in detail below in combination with the embodiments.

[0027] Example 1: Obtaining of the BnMYB6 gene promoter of ramie Huayan No. 5

[0028] The 5' regulatory region of the BnMYB6 gene was identified based on the ramie genome database, and the upstream sequence of 1452 bp of the gene was determined, and the promoter primers were designed as follows:

[0029] Upstream primer: 5'-ATTTTTCTCTCTTGTATCCAG-3';

[0030] Downstream primer: 5'-GCTTTTTTTGTGTGTATAGGTAAA-3'.

[0031] Genomic DNA of Ramie Huazan No.5 was extracted by Ezup Column Plant Genomic DNA Extraction Kit (Shanghai Biomed, B518261-0100) with the tender leaves of Ramie Huazan No.5 as the material. The genomic DNA was diluted to 100 ng / μL and used as the template for promoter amplification. The BnMYB6 gene promoter was amplified by using high-fidelity enzyme PrimeSTAR Max DNA Polymerase (Takara).

[0032] 1.1 Extraction of Ramie Genomic DNA

[0033] (1) Preheat Buffer PCB and β-mercaptoethanol in water bath to 65°C;

[0034] (2) Take 100 mg of fresh plant tissue and grind it into powder in liquid nitrogen, and then transfer it to a 1.5 ml centrifuge tube;

[0035] (3) Quickly add 600 μL of 65°C preheated Buffer PCB and 12 μL of β-mercaptoethanol. Shake well, place in a 65°C water bath for 25 min, and mix occasionally;

[0036] (4) Add 600 ml of chloroform and mix well. Centrifuge at 12000 rpm for 5 min. Absorb the upper aqueous phase into a clean 1.5 ml centrifuge tube;

[0037] (5) Add Buffer BD equal to the volume of the upper aqueous phase, invert and mix 3-5 times. Add anhydrous ethanol equal to the volume of the upper aqueous phase. Mix well and then use a pipette to add it all to the adsorption column. Let it stand at room temperature for 2 min, centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0038] (6) Put the adsorption column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0039] (7) Put the adsorption column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0040] (8) Put the adsorption column back into the collection tube and centrifuge at 12000 rpm for 2 min;

[0041] (9) Take out the adsorption column and put it into a new 1.5 ml centrifuge tube. Add 50 μL of TE Buffer to the center of the adsorption membrane, let it stand at room temperature for 3 min, and centrifuge at 12000 rpm for 2 min;

[0042] (10) The centrifuged solution was added back to the adsorption column, and left at room temperature for 3 min, and centrifuged at 12000 rpm for 2 min;

[0043] (11) The obtained DNA solution was stored at -20°C.

[0044] 1.2 Cloning of BnMYB6 gene promoter

[0045] The reaction system (25 μL system) of high-fidelity enzyme PrimeSTAR Max DNA Polymerase amplification: DNA 2 μL, PrimeSTAR Max Premix (2x) 12.50 μL, primer F 0.5 μL, primer R 0.5 μL, ddH2O 9.55 μL.

[0046] Amplification procedure: 98°C for 5 min, (98°C for 10 s, 60°C for 5 s, 72°C for 90 s) for 35 cycles, 72°C for 10 min, 4°C for removal.

[0047] After the reaction, the reaction solution was immediately removed, and 1.5% TAE agarose gel electrophoresis was used to detect the reaction solution, and the results are shown in Figure 1 .

[0048] 1.3 Purification and recovery of the promoter fragment

[0049] The PCR (Promega, A9281) product was purified by using a nucleic acid purification kit SV Gel and PCR Clean-Up System.

[0050] (1) The same volume of membrane binding solution was mixed with the PCR product, and the mixture was moved into the SV column assembly, incubated at room temperature for 1 min, centrifuged at 16000 g for 1 min, and the empty collection tube was placed back;

[0051] (2) 700 μL of membrane washing solution was added to the SV column, centrifuged at 16000 g for 1 min, and the empty collection tube was placed back;

[0052] (3) Repeat the washing step with 500 μL of membrane washing solution, and centrifuge the SV column assembly at 16000 g for 5 min;

[0053] (4) The column assembly was centrifuged again for 1 min to fully evaporate the residual ethanol;

[0054] (5) The SV column was moved into a clean 1.5 ml microcentrifuge tube, 30 μL of ddH2O was added to the center of the column, incubated at room temperature for 1 min, and then centrifuged at 16000 g for 1 min to collect the DNA solution.

[0055] 1.4 Connect BnMYB6 promoter on pEASY Blunt Zero Cloning Vector, 37℃ for 15 min.

[0056] Reaction system (5 μL): promoter recovery fragment 0.5 μL, pEASY-Blunt Zero Cloning Vector 1 μL, ddH2O 3.5 μL.

[0057] 1.5 Transformation of E. coli plasmid

[0058] (1) Add the ligation product to 100 μL of E. coli DH5α competent cells (add the ligation product when the competent cells are just thawed), mix gently, and ice bath for 20-30 min.

[0059] (2) 42℃ water bath heat shock for 30 s, immediately placed on ice for 2 min.

[0060] (3) Add 250 μL of LB medium equilibrated to room temperature, 200 rpm, 37℃ for 1 h.

[0061] (4) 1500g centrifugation for 1 min, discard part of the supernatant, retain 100-150 μL, suspend the bacterial body, take all the bacterial liquid and spread on LB / Kana solid medium (Kana 100 mg / L), 37℃ for overnight culture.

[0062] 1.6 Positive clone detection

[0063] Select the clone and inoculate in LB / Kana liquid medium (Kana 100 mg / L), 200 rpm, 37℃ for about 6 h. Take 1 μL of bacterial liquid in 25 μL PCR system, and identify positive clones with M13 Forward Primer and M13 Reverse Primer.

[0064] Reaction system (25 μL): bacterial liquid 1 μL, EasyTaq 0.2 μL, 10×Easy Taq Buffer 2.5 μL, dNTPmix 0.5 μL, M13 Forward Prime 1 μL, M13 Reverse Primer 1 μL, ddH2O 18.8 μL.

[0065] Amplification program: 95℃ for 5 min, (95℃ for 10 s, 60℃ for 30 s, 72℃ for 90 s) for 35 cycles, 72℃ for 10 min, 4℃ for removal.

[0066] After the reaction is completed, the reaction liquid is immediately removed, and 1.5% TAE agarose gel electrophoresis is used to detect the reaction liquid.

[0067] 1.7 DNA sequencing

[0068] The PCR positive bacterial solution was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing, and the sequencing results were obtained. The promoter DNA sequence is shown in the sequence table SEQ ID NO: 1.

[0069]

[0070] 1.8 Promoter sequence analysis of BnMYB6 gene of Ramie Huayun No.5

[0071] The BnMYB6 gene promoter sequence was submitted to the PLACE online analysis tool for promoter sequence analysis (https: / / www.dna.affrc.go.jp / PLACE / ?action=newplace). The BnMYB6 gene promoter sequence of Ramie Huayun No.5 is rich in temperature-related cis-acting elements, in addition to elements related to drought, dehydration and other inducements, and there is a wound-induced “AG motif” element near the TATA box region (as shown in Table 1). In summary, it is preliminarily judged that the promoter of BnMYB6 gene may be a temperature-sensitive inducible promoter.

[0072] Table 1 Elements rich in BnMYB6 gene promoter of Ramie Huayun No.5

[0073]

[0074] Example 2 BnMYB6 pro Construction of GUS expression vector and Agrobacterium transformation

[0075] The BnMYB6 promoter sequence amplified according to Example 1 was designed to add a linker primer, the upstream primer added a Hind III enzyme cutting site, and the downstream primer added a BamH I enzyme cutting site:

[0076] BnMYB6 pro -F: 5’- GACCATGATTACGCCAAGCTT ATTTTTCTCTCTTGTATC CAG-3’.

[0077] BnMYB6 pro -R: 5’- GGACTGACCACCCGGGGATCC GCTTTTTTTGTGTGTAT AGGTAAA-3’.

[0078] 2.1 PCR cloning to obtain BnMYB6 promoter fragment with linker

[0079] The reaction system (25 μL system) of high-fidelity enzyme PrimeSTAR Max DNA Polymerase amplification: DNA 2 μL, PrimeSTART Max Premix (2×) 12.50 μL, BnMYB6 pro -F 0.5 μL, BnMYB6 pro -R 0.5 μL, ddH2O 9.5 μL.

[0080] The amplification procedure is as follows: 98°C 5 min, (98°C 10 s, 60°C 5 s, 72°C 90 s) for 35 cycles, 72°C 10 min, 4°C removal.

[0081] After the reaction, the reaction solution was immediately removed, and the reaction solution was detected by 1.5% TAE agarose gel electrophoresis and the product was purified and recovered (operation same as 1.3).

[0082] 2.2 Double enzyme digestion of GUS expression vector pBI121

[0083] The GUS expression vector pBI121 used in the experiment has a 35s promoter for the reporter gene GUS, and has restriction enzyme cutting sites Hind III and BamH I at both ends. The endonuclease Hind III and BamH I were used for double enzyme digestion.

[0084] Double enzyme digestion system (20 μL): GUS expression vector pBI121 15 μL, Hind III 2 μL, BamH I 1 μL, 10x FastDigest Buffer 2 μL.

[0085] Enzyme digestion procedure: 37°C for 30 min, 80°C for 5 min, 16°C removal.

[0086] After the reaction, the reaction solution was immediately removed, and the reaction solution was detected by 1.5% TAE agarose gel electrophoresis, and the enzyme digestion electrophoresis result is shown in Figure 2 , and the short fragment of about 900 bp is the 35s promoter.

[0087] 2.3 Purification and recovery of linearized GUS expression vector pBI121

[0088] The long and short fragments after double enzyme digestion were separated by agarose gel electrophoresis, and the gel recovery kit SV Gel and PCR Clean-Up System was used to cut and recover the long fragment by PCR (Promega, A9281).

[0089] (1) Cut the single DNA band of interest from the agarose gel (try to remove the excess part) and put it into a clean centrifuge tube, and weigh it.

[0090] (2) According to the weight of the gel cut in the previous step, mix 100 mg with 100 μL membrane binding solution according to the standard of 100 mg plus 100 μL membrane binding solution, and then move the mixed solution into the SV column assembly, incubate at room temperature for 1 min, then centrifuge at 16000g for 1 min, empty the collection tube and put it back;

[0091] (3) Add 700 μL membrane washing solution to the SV column, centrifuge at 16000g for 1 min, empty the collection tube and put it back;

[0092] (4) Repeat the washing step with 500 μL membrane washing solution, centrifuge the SV column assembly at 16000g for 5 min;

[0093] (5) Centrifuge the column assembly again for 1 min to fully evaporate the residual ethanol;

[0094] (6) Move the SV column into a clean 1.5 ml microcentrifuge tube, add 30 μL ddH2O to the center of the column, incubate at room temperature for 1 min, then centrifuge at 16000g for 1 min to collect the DNA solution.

[0095] 2.4 Recombination reaction of promoter fragment and linearized vector

[0096] Using the homologous recombination kit ClonExpress II One Step Cloning Kit (Vazyme, C112), the promoter fragment obtained in step 2.1 was connected to the linearized GUS expression vector pBI121 obtained in step 2.3 by homologous recombination, and the reaction system (10 μL) was as follows: insert 1 μL, linearized GUS expression vector 6 μL, Exnase II 1 μL, 5×CE II Buffer 2 μL.

[0097] Put the reaction system into a PCR instrument, react at 37°C for 30 min, and then cool the product on ice for standby.

[0098] 2.5 Transformation of E. coli plasmid

[0099] (1) Add the ligation product to 100 μL of E. coli DH5α competent cells (add the ligation product when the competent cells are just thawed), mix gently, and incubate on ice for 20-30 min.

[0100] (2) Heat shock at 42°C for 30 s, and immediately place on ice for 2 min.

[0101] (3) Add 250 μL of LB medium equilibrated to room temperature, and incubate at 200 rpm and 37°C for 1 h.

[0102] (4) Centrifuge at 1500g for 1 min, discard part of the supernatant, retain 100-150 μL, suspend the bacterial cells, and take all the bacterial solution to spread on LB / Kana solid medium (Kana 100 mg / L), and incubate at 37°C overnight.

[0103] 2.6 Positive clone detection

[0104] In order to facilitate the detection and sequencing verification of the recombinant plasmid, we designed primers VT-F and VT-R respectively upstream and downstream of the original CaMV35S promoter according to the sequence of pBI121 vector. The use of VT-F / VT-R can facilitate the detection of whether the foreign DNA sequence has been recombined into the pBI121 vector, and at the same time, the use of this pair of primers for sequencing verification of the recombinant plasmid can determine whether the sequence on the recombinant is consistent with the target sequence.

[0105] VT-F: 5'-CCCCAGGCTTTACACTTTATGCTT-3',

[0106] VT-R: 5'-CGCTGATCAATTCCACAGTTTTCG-3'.

[0107] The single clone was inoculated in LB / Kana liquid medium (Kana 100 mg / L) and cultured at 200 rpm and 37°C for about 6 hours. 1 μL of bacterial solution was taken in 25 μL of PCR system, and positive clone PCR detection was performed using VT-F / VT-R.

[0108] Reaction system (25 μL): 1 μL of bacterial solution, 0.2 μL of EasyTaq, 2.5 μL of 10x Easy Taq Buffer, 0.5 μL of dNTPmix, 1 μL of Primer F, 1 μL of Primer R, and 18.8 μL of ddH2O.

[0109] Amplification program: 95°C for 5 min, (95°C for 10 s, 30°C for 5 s, 72°C for 90 s) for 35 cycles, 72°C for 10 min, and 4°C for removal.

[0110] After the reaction was completed, the reaction solution was immediately removed, and 1.5% TAE agarose gel electrophoresis was used to detect the reaction solution, and the detection results are shown in Figure 3 .

[0111] 2.7 DNA sequencing

[0112] The positive clone was cultured for sequencing, and after the sequencing results were fed back and it was confirmed that the recombinant sequence was correct, the promoter DNA sequence was as shown in the sequence table SEQ ID No. 1. The construction of the recombinant plasmid of BnMYB6 promoter was completed, and the next step experiment was prepared.

[0113] 2.8 Extraction of recombinant plasmid DNA

[0114] The high-purity plasmid small extraction kit (Tiangen Biochemical Technology Co., Ltd., DP107) was used to extract the recombinant plasmid DNA.

[0115] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CP4 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.

[0116] (2) Take 5-15 ml of the overnight culture and add it to a centrifuge tube, centrifuge at 12000 rpm for 1 min, and try to remove the supernatant.

[0117] (3) Add 500 μL of solution P1 to the centrifuge tube containing the bacterial cell precipitate, and use a pipette or vortex to thoroughly suspend the bacterial cell precipitate.

[0118] (4) Add 500 μL of solution P2 to the centrifuge tube, and gently invert it 6-8 times to fully lyse the bacterial cells.

[0119] (5) Add 700 μL of solution P3 to the centrifuge tube, and immediately gently invert it 6-8 times to thoroughly mix it. At this time, a white flocculent precipitate will appear. Centrifuge at 12000 rpm for 10 min, and at this time a precipitate will form at the bottom of the centrifuge tube.

[0120] (6) Add the supernatant collected in the previous step to the adsorption column CP4 in several portions, taking care not to aspirate the precipitate. Centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0121] (7) Add 600 μL of rinse solution PW to the adsorption column CP4, centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CP4 in the collection tube.

[0122] (8) Repeat step (7).

[0123] (9) Place the adsorption column CP4 in the collection tube, and centrifuge at 12000 rpm for 2 min, in order to remove the residual rinse solution from the adsorption column.

[0124] (10) Place the adsorption column CP4 in a clean centrifuge tube, and add 100-300 μL of elution buffer EB dropwise to the middle of the adsorption membrane, and let it stand at room temperature for 2-5 min, and centrifuge at 12000 rpm for 2 min, and collect the plasmid solution in the centrifuge tube.

[0125] 2.9 Plasmid transformation of Agrobacterium GV3101

[0126] (1) Take the GV3101 Agrobacterium competent cells from the -80°C refrigerator, and quickly insert them into an ice box to dissolve them.

[0127] (2) Add 1 μL of recombinant plasmid DNA sample and mix gently, and then stand on ice box for 5 min, in liquid nitrogen for 5 min, in 37°C water bath for 5 min, and in ice bath for 5 min.

[0128] (3) Add 900 μL of LB liquid medium without antibiotics, mix evenly, and shake culture at 28°C for 2-3 h.

[0129] (4) Centrifuge at 6000 rpm for 1 min to collect bacteria, take about 100 μL of supernatant, resuspend the bacterial block by gently blowing, and spread on LB / Kana / Rif solid medium (Kana 100 mg / L, Rif 50 mg / L), and invert and place in a 28°C incubator for culture for 2-3 d.

[0130] 2.10 PCR verification of transformed Agrobacterium

[0131] BnMYB6 pro Agrobacterium carrying the recombinant vector of GUS was screened. Single clones were selected and inoculated in 500 μL of LB / Kana / Rif (Kana 100 mg / L, Rif 50 mg / L) liquid medium, and cultured at 200 rpm and 37°C for about 24 h. 1 μL of bacterial solution was taken in 25 μL of PCR system, and positive clones were identified by VT-F / VT-R.

[0132] Reaction system (25 μL): bacterial solution 1 μL, EasyTaq 0.2 μL, 10×Easy Taq Buffer 2.5 μL, dNTPmix 0.5 μL, Primer F 1 μL, Primer R 1 μL, and ddH2O 18.8 μL.

[0133] Amplification program: 95°C for 5 min, (95°C for 10 s, 30°C for 5 s, and 72°C for 90 s) for 35 cycles, 72°C for 10 min, and 4°C for removal.

[0134] After the reaction, the reaction solution was immediately removed, and 1.5% TAE agarose gel electrophoresis was used to detect the reaction solution.

[0135] The bacterial solution that passed the detection and verification was cultured in large scale, the bacterial solution after the large-scale culture was mixed with 50% glycerol at 1:1, and the mixture was frozen at -80°C for subsequent experiments.

[0136] Example 3. Verification of the function of the BnMYB6 gene promoter of ramie in Arabidopsis thaliana

[0137] 3.1 Infection of Arabidopsis thaliana by flower immersion method

[0138] (1) The first 1 cm to 5 cm long primary inflorescence was cut off. Osmotic transformation was performed within one week after pruning.

[0139] (2) One week before infiltration, the bacteria saved in the ultra-low temperature refrigerator in step 2.10 were activated. One day before infiltration, the activated Agrobacterium GV3101 containing the expression vector plasmid was added into 300 ml LB / Kana / rif (Kana 100 mg / L, rif 20 mg / L) liquid medium, and cultured in a 28°C, 200 rpm shaker until the OD 600 was about 0.8-1.0, and the plants were fully watered one day before infiltration so that the stomata of the plants were fully open at the time of infiltration.

[0140] (3) 25°C, 4000 rpm centrifugation for 20 min, resuspend the bacteria in a resuspension solution (5% sucrose + 300 μL / L silwet-77) to an OD 600 of about 0.8-1.0, and mix well.

[0141] (4) Before infection, cut off the fruit pods and fully opened flowers on the plants, immerse the aerial part of the plants in the bacteria solution for 20-30 s, and gently shake.

[0142] (5) After soaking, cover with plastic wrap to keep moist, remove the plastic wrap after 1 d of dark culture, and transfer the material to a growth chamber.

[0143] (6) After infiltration, the Arabidopsis plants were cultured under normal culture conditions until the seeds matured, and the seeds were harvested.

[0144] 3.2 Sterilization of transgenic Arabidopsis seeds

[0145] (1) Take an appropriate amount of Arabidopsis seeds in a 1.5 ml centrifuge tube, add 1 ml of distilled water, wash for 20 s, and let stand until the seeds settle at the bottom of the tube. Discard the distilled water and repeat 3 times.

[0146] (2) Add 1 ml of 75% ethanol and wash for 3 min. Let stand until the seeds settle at the bottom of the tube. Discard the 75% ethanol.

[0147] (3) Add 1 ml of anhydrous ethanol and wash for 3 min. Let stand until the seeds settle at the bottom of the tube. Discard the anhydrous ethanol.

[0148] (4) Add 1 ml of distilled water and wash for 20 s. Let stand until the seeds settle at the bottom of the tube. Discard the distilled water and repeat 5 times.

[0149] (5) Add 1 ml of distilled water and mix well. Finally, use a syringe to suck the seeds into the MS / Kana (Kana 100 mg / L) solid medium and evenly spread them. Discard the excess distilled water in the medium. Grow under the conditions of 25°C, 16 h light / 22°C, 8 h dark.

[0150] 3.3 Screening of transgenic Arabidopsis

[0151] (1) Harvest the mature seeds of transformed Arabidopsis thaliana on MS / Kana (Kana 100 mg / L) solid medium for screening, and the seedlings are green and normal in growth state, which can be determined as primary screening positive lines.

[0152] (2) A part of the primary screening positive lines are transplanted to the nutrient soil for continuous growth.

[0153] (3) The T1 generation seeds are harvested after the positive plants mature. After sterilization, the T1 generation seeds are screened on MS / Kana (Kana 100 mg / L) solid medium, and the proportion of transgenic seedlings with Kana resistance is slightly increased. The positive plants are cultured to maturity to obtain T2 generation seeds, and the kanamycin screening step is repeated.

[0154] (4) After two generations of screening, the positive plant rate reaches a high proportion, and T3 generation pure lines are gradually obtained.

[0155] 3.4 Analysis of BnMYB6 promoter induced expression under high temperature treatment in transgenic Arabidopsis thaliana

[0156] Select full T3 generation BnMYB6 pro ::GUS transgenic Arabidopsis thaliana homozygous line (BnMYB6 pro ::GUS-1, BnMYB6 pro ::GUS-8, BnMYB6 pro ::GUS-12) seeds are cultured for 15d and then transferred to a 35℃ artificial climate box for high temperature treatment. At 0h, 2h, 4h, and 6h of treatment, GUS histochemical staining is performed on plants picked using GUS staining kit gusblue kit (Beijing Huaiyouyang Biological Technology Co., Ltd., CAT: GT0391), and the results show that Figure 4 ), relative to the untreated condition, the GUS staining degree in T3 generation BnMYB6 pro ::GUS transgenic Arabidopsis thaliana is enhanced, indicating that the expression of GUS gene is enhanced, and further indicating that the promoter of BnMYB6 gene has high temperature induction function and can be used as a promoter tool for genetic engineering research to create high temperature resistant plant varieties.

[0157] 3.5 Analysis of GUS gene expression of BnMYB6 gene promoter under high temperature treatment in transgenic Arabidopsis thaliana

[0158] Select full T3 generation BnMYB6 pro ::GUS transgenic Arabidopsis thaliana homozygous line (BnMYB6 pro ::GUS-1, BnMYB6 pro ::GUS-8, BnMYB6pro ::GUS-12) seeds, the seedlings cultured for 15 d after germination were transferred to a 35 °C artificial climate box for high temperature treatment, and whole plants of Arabidopsis were taken at 0 h (control), 2 h, 4 h and 6 h after treatment, respectively, and total RNA was extracted by Trizol method, as follows:

[0159] (1) Take the liquid tube in the incubator, take the sample from the ultra-low temperature refrigerator and quickly put it into liquid nitrogen;

[0160] (2) Wear a mask and gloves, pour a little liquid nitrogen into the mortar to make it low temperature, and repeat once;

[0161] (3) Take about 100 mg of sample in the mortar with pre-cooled tweezers, quickly grind it into a non-particulate powder, and constantly add liquid nitrogen to keep it low temperature during the process to prevent RNA degradation;

[0162] (4) Put the sample into a pre-cooled 1.5 ml enzyme-free centrifuge tube and add 1 ml Trizol reagent, mix quickly or shake;

[0163] (5) Place on ice, label, and stand for 5 min;

[0164] (6) Put the centrifuge tube into a pre-cooled high-speed centrifuge, 12000 rpm, 4 °C, 10 min.

[0165] (7) Prepare a new 1.5 ml enzyme-free centrifuge tube, add 400 μL of refrigerated chloroform, and place on ice;

[0166] (8) Take the supernatant into a 1.5 ml enzyme-free centrifuge tube containing chloroform, mix gently for 2 min, stand on ice for 5 min, and put into the centrifuge, 12000 rpm, 4 °C, 10 min.

[0167] (9) Repeat steps (7)-(8)

[0168] (10) Prepare a new 1.5 ml enzyme-free centrifuge tube, take the supernatant into a 1.5 ml enzyme-free centrifuge tube, and add an equal volume of isopropanol stored at -20 °C to the centrifuge tube, mix gently, stand at -20 °C for 30 min to precipitate RNA, and centrifuge at 12000 rpm, 4 °C, 10 min.

[0169] (11) Discard the supernatant, add 400 μL of 75% ethanol for washing, mix gently with a pipette, and centrifuge at 12000 rpm, 4 °C, 3 min.

[0170] (12) Discard the supernatant, add 400 μL of anhydrous ethanol, mix gently, and centrifuge at 12000 rpm, 4 °C, 2 min.

[0171] (13) Discard the supernatant, dry on a clean bench for 5 min, and add 20 μL of enzyme-free water.

[0172] (14) Concentration, -80℃ refrigerator preservation.

[0173] The cDNA was obtained by reverse transcription using the reverse transcription kit TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Beijing Zison Biotechnology Co., Ltd., AT311-03). The reaction system (10 μL) was as follows: Total RNA 2.5 μL, Anchored Oligo Primer 0.5 μL, 2xTS Reaction Mix 5 μL, TransScript RT / RI Enzyme Mix 0.5 μL, gDNA Remover 0.5 μL, and ddH2O 1 μL.

[0174] The amplification program was as follows: 42℃ for 30 min, 85℃ for 10 s, and 16℃ for 30 min.

[0175] The obtained cDNA was used as a template for fluorescence quantitative PCR using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02). Meanwhile, GUS gene was used as a target gene, and Arabidopsis Actin2 gene was used as an internal reference gene. The primer sequences were designed as follows:

[0176] qGUS-F: 5'-CTCCTACCGTACCTCGCATTAC-3',

[0177] qGUS-R: 5'-GCCTCTTCGCTGTACAGTTCTT-3',

[0178] qAtActin2-F: 5'-GCCATCCAAGCTGTTCTCTC-3',

[0179] qAtActin2-R: 5'-CAGTAAGGTCACGTCCAGCA-3'.

[0180] The reaction system (10 μL) was as follows: cDNA 1 μL, ChamQ Universal SYBR qPCR Master Mix 5 μL, Prmier F 0.5 μL, Prmier R 0.5 μL, and ddH2O 3 μL.

[0181] The amplification program was as follows: 95℃ for 30 min, 40 cycles of (95℃ for 10 s, 60℃ for 30 s), 95℃ for 15 s, 60℃ for 1 min, and 95℃ for 15 s.

[0182] The results showed thatFigure 5 T3 generation BnMYB6 after high temperature treatment pro GUS transgenic Arabidopsis line (BnMYB6 pro GUS-1; BnMYB6 pro GUS-8; BnMYB6 pro GUS-12) rapidly triggered the expression of GUS within 2h; at 4h, the expression level of GUS gene decreased; at 6h, the expression level of GUS gene increased again, indicating that BnMYB6 pro The application discloses a high-temperature inducible promoter BnMYB6, which drives the up-regulated expression of a reporter gene in transgenic Arabidopsis.

[0183] The above merely describes the preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A ramie high temperature inducible promoter, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO:

1.

2. Use of the ramie high-temperature inducible promoter according to claim 1 to promote the expression of a target gene in plant tissues under high-temperature induction conditions, characterized in that: The ramie high temperature inducible promoter drives the reporter gene GUS to up-regulate expression in transgenic Arabidopsis under high temperature induction conditions.

3. A target gene expression vector comprising the ramie high temperature inducible promoter according to claim 1.

4. The expression vector according to claim 3, wherein: The target gene is β-glucuronidase gene, and the expression vector is pBI121::BnMYB6 pro ::GUS.

5. A method for constructing a transgenic plant with a high temperature-induced reporter gene GUS expression, characterized in that: The following steps are involved: S1, construction of the expression vector of the target gene; S2, connecting the promoter of claim 1 to the expression vector of step S1, and then transforming it into Agrobacterium; S3, using the transformed Agrobacterium strain to mediate plant transformation to obtain transgenic plants expressing the transferred gene inducible by high temperature reporter gene GUS.

Images