Double-stranded RNA (Ribonucleic Acid) aiming at hemiptera insects as well as pesticide composition and application thereof

Abstract

The invention discloses a double-stranded RNA (Ribonucleic Acid) aiming at hemiptera insects as well as a pesticide composition and application of the double-stranded RNA. The dsRNA provided by the invention is used as a biopesticide, has the characteristics of high efficiency, specificity, fast degradation and no residue, realizes the prevention and control of brown planthopper through an RNAi mechanism, and is beneficial to reducing the use of chemical pesticides. The invention provides a brand new brown planthopper target gene as a target of RNA interference. The survival rate result shows that the genes play an important role in the survival process of the brown planthopper, are effective targets for preventing and treating the brown planthopper by using a gene silencing means, and have a wide application prospect. Correspondingly, the invention provides a plurality of dsRNA sequences aiming at the targets, and part of the sequences show unprecedented brown planthopper control efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of biological pesticides, and in particular relates to double-stranded RNA targeting hemiptera insects and a pesticide composition and use thereof. Background Art

[0002] Brown planthopper (BPH, Nilaparvata lugens) belongs to the family Hemiptera: Delphacidae, class Insecta, phylum Arthropoda. It is a monophagous pest that only lives and reproduces on rice. It sucks the phloem sap of rice, which restricts the growth and development of rice and reduces grain production. Its habit of long-distance migration makes it a wide range of damage, increasing the difficulty of prevention and control.

[0003] The damage caused by brown planthoppers includes direct and indirect aspects. The direct damage is that brown planthoppers use piercing-sucking mouthparts to suck the sap of rice, consuming water and nutrients. In severe cases, it can cause rice to wither and even fall over, resulting in a significant reduction in yield. The indirect damage is that the feeding and egg-laying of brown planthoppers leave wounds on the stems and leaves of rice, increasing the risk of water loss and pathogen invasion; at the same time, the honeydew produced by brown planthoppers is easy to breed mold, further aggravating the disease.

[0004] In agricultural production, chemical pesticides such as organophosphorus pesticides, carbamate pesticides, nicotine pesticides, pymetrozine, thiamethoxam and other chemical pesticides are often used to deal with brown planthopper pests. Reasonable application of pesticides can effectively control the number of pests and reduce harm. However, the use of chemical pesticides will cause soil and environmental pollution, kill other species in the ecological chain, and leave residues in rice, which will harm the ecology and human health. At the same time, the use of chemical pesticides will increase the drug resistance of brown planthoppers, forcing people to use higher doses of pesticides, forming a vicious circle. Therefore, it is urgent to develop new green, safe and efficient prevention and control methods.

[0005] RNA interference (RNAi) is a gene silencing technology mediated by double-stranded RNA (dsRNA). After exogenous dsRNA enters the host cell, it is cut into small RNA fragments (siRNA) by the nuclease Dicer. These siRNAs are unzipped into sense and antisense strands under the action of RNA helicase. Antisense siRNA binds to enzymes in the body to form RNA-induced silencing complexes (RISC). After RISC homologously binds to mRNA, it cuts mRNA and reduces the transcription level of the gene. RNAi technology is ubiquitous in most eukaryotic organisms, has high specificity and efficiency, and has become an important means to study gene function and control crop diseases and pests.

[0006] Many studies have shown that RNAi can play an important role in the prevention and control of brown planthoppers, that is, silencing specific genes through dsRNA can cause abnormal development, decreased fertility and even death of brown planthoppers. Green agriculture is a new concept of agricultural development proposed in recent years, which aims to increase farmers' income while protecting the ecological environment and maintaining human health. Interferon nucleic acid uses the principle of RNAi to design dsRNA for specific genes of pathogens (insects or microorganisms), silence the expression of target genes, and thus inhibit or eliminate pathogens. Due to its high efficiency, high specificity and no pesticide residues, it has great potential in replacing traditional chemical pesticides and realizing green agriculture. However, there is still an unmet demand for RNAi solutions for brown planthoppers with better control effects. Summary of the invention

[0007] The present invention provides dsRNA sequences targeting multiple brown planthopper genes. These dsRNA fragments enter the body of brown planthoppers and can effectively knock down the expression of target genes, significantly reducing the survival rate of brown planthoppers. In view of the advantages of RNA pesticides such as safety and high efficiency, the use of the dsRNA of the present invention to target potential targets of brown planthoppers can achieve green and efficient pest control goals.

[0008] In one aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 2.

[0009] In another aspect, the present invention provides a double-stranded RNA for Hemiptera insects, wherein the double-stranded RNA for Hemiptera insects comprises a sense strand and an antisense strand, wherein:

[0010] The sense strand has a nucleotide sequence as shown in SEQ ID NO: 3, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 4; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 5, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 6; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 7, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 8; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 10; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 12; or, the sense strand has a nucleotide sequence as shown in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 14.

[0011] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 3, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 4.

[0012] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 5, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 6.

[0013] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 7, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 8.

[0014] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 10.

[0015] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 12.

[0016] In another aspect, the present invention provides a double-stranded RNA against Hemiptera insects, wherein the double-stranded RNA against Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 14.

[0017] In another aspect, the present invention provides an expression vector, characterized in that the expression vector comprises the sense strand or antisense strand of the double-stranded RNA against Hemiptera insects as described in any embodiment herein.

[0018] In another aspect, the present invention provides a host cell, characterized in that the host cell comprises the sense strand or antisense strand of the double-stranded RNA against Hemiptera insects as described in any embodiment herein, or an expression vector.

[0019] In another aspect, the present invention provides a method for preparing a double-stranded RNA targeting Hemiptera insects as described in any embodiment herein, the method comprising expressing using the expression vector or host cell as described in any embodiment herein.

[0020] In one or more embodiments, the method comprises the following steps:

[0021] S1: Extract RNA from brown planthopper;

[0022] S2: cDNA was obtained by reverse transcription using RNA from brown planthopper as template;

[0023] S3: Using cDNA as a template, amplify the target sequence by PCR;

[0024] S4: clone the target sequence into the plasmid to obtain a recombinant plasmid vector;

[0025] S5: transforming the recombinant plasmid vector into competent cells, and using the competent cells transformed with the recombinant plasmid vector as host cells;

[0026] S6: culturing host cells, using an inducer to induce the host cells to express double-stranded RNA targeting Hemiptera insects, and obtaining a fermentation liquid;

[0027] S7: Purification of double-stranded RNA targeting Hemiptera insects from fermentation broth.

[0028] Preferably, in step S1, the extraction method is the Trizol method.

[0029] Preferably, in step S3, the target sequence is selected from any one of SEQ ID NOs: 15-28.

[0030] Preferably, in step S4, the plasmid is pET-30a plasmid.

[0031] Preferably, in step S4, the cloning step includes:

[0032] S4-1: Treat the plasmid with a specific endonuclease and purify it by agarose gel electrophoresis to obtain a linearized plasmid;

[0033] S4-2: Connect the product amplified by PCR in S3 to the linearized plasmid using DNA ligase to obtain a recombinant plasmid vector.

[0034] More preferably, in step S4-1, the specific endonuclease is EcoRI endonuclease.

[0035] More preferably, in step S4-1, the recombinant plasmid vector comprises two or more promoters.

[0036] Preferably, in step S5, the competent cells are HT115 (DE3).

[0037] Preferably, in step S6, the inducing agent is IPTG.

[0038] In one or more embodiments, in step S7, the purification step comprises:

[0039] S7-1: fermentation broth pretreatment;

[0040] S7-2: Positive pressure-bell jar type two-way filtration;

[0041] S7-3: Ethanol gradient precipitation.

[0042] Preferably, step S7-1 comprises the following steps:

[0043] S7-1-1: Breaking the wall;

[0044] S7-1-2: water bath;

[0045] S7-1-3: ultrasonic treatment;

[0046] S7-1-4: Use buffer A to adjust the pH of the liquid obtained in S7-1-3 to 7.9-8.1, and then centrifuge to obtain supernatant A; wherein the buffer A is an aqueous solution containing 0.15 M sodium bicarbonate, 0.014 M sodium tetraborate and 0.48 M sodium chloride, and the pH value is 8.4-8.6;

[0047] S7-1-5: Use buffer B to adjust the pH value of supernatant A to 5.9-6.1, and then centrifuge to obtain supernatant B; wherein the buffer B contains 0.15 M citric acid, 0.18 M hydrochloric acid, 0.22 M tris(hydroxymethyl)aminomethane) and 0.62 M sodium chloride aqueous solution, and the pH value is 4.4-4.6.

[0048] More preferably, in step S7-1-2, the temperature of the water bath is 45-55°C.

[0049] More preferably, in step S7-1-3, the ultrasonic treatment time is 25 to 35 minutes.

[0050] More preferably, in step S7-1-4, the centrifugation is performed at 12000-14000 rpm and 9-11° C. for 18-22 minutes.

[0051] More preferably, in step S7-1-5, the centrifugation is performed at 14000-16000 rpm and 4-6° C. for 18-22 minutes.

[0052] Preferably, step S7-2 is to filter the liquid obtained in step S7-1 using a positive pressure-bell jar type dual filtration device to obtain a filtrate.

[0053] More preferably, the pore size of the filter column used in the filtration treatment is 0.22 µm, the filter element is made of cellulose, and the pressure of the filtration treatment is 0.09-0.11 Mpa.

[0054] Preferably, step S7-3 includes the following steps:

[0055] S7-3-1: The filtrate obtained in step S7-2 is precipitated with 27-33% (v / v) ethanol and centrifuged to obtain a supernatant C;

[0056] S7-3-2: After the supernatant C is allowed to stand at 9-11°C overnight, anhydrous ethanol is added to the supernatant C under low-speed stirring until the final concentration of ethanol reaches 65-75% (v / v);

[0057] S7-3-3: Centrifuge the liquid obtained in step S7-3-2 to collect the purified dsRNA.

[0058] More preferably, in step S7-3-3, the centrifugation is performed at 14000-16000 rpm and 3-5° C. for 35-45 minutes.

[0059] In another aspect, the present invention provides a pesticide composition, comprising an effective amount of the double-stranded RNA against Hemiptera insects as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0060] In one or more embodiments, the carrier is chitosan nanoparticles.

[0061] In another aspect, the present invention provides a method for preparing a pesticide composition as described in any embodiment herein, the method comprising adding a double-stranded RNA targeting Hemiptera insects as described in any embodiment herein and a pharmaceutically acceptable carrier into a solvent.

[0062] In one or more embodiments, the method comprises the following steps:

[0063] S1: dissolving chitosan with acetate buffer to obtain chitosan acetate solution; dissolving dsRNA with sodium sulfate solution to obtain dsRNA sodium sulfate solution;

[0064] S2: slowly drop the dsRNA sodium sulfate solution into the chitosan acetate solution, mix thoroughly, incubate, and vortex after incubation to obtain a dsRNA chitosan nanoparticle preparation.

[0065] Preferably, in step S1, the pH of the acetate buffer is 4.4-4.6.

[0066] Preferably, in step S1, the concentration of chitosan in the chitosan acetate solution is 0.02% (w / v).

[0067] Preferably, in step S1, the concentration of sodium sulfate in the sodium sulfate solution is 45-55 mM.

[0068] Preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 10 to 5000 mg / L. More preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 1000 to 3000 mg / L. Further preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 2000 mg / L.

[0069] Preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetate solution used for mixing is 1:3 to 3:1. More preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetate solution used for mixing is 1:1.

[0070] Preferably, in step S2, the incubation temperature is 50-60°C; more preferably, in step S2, the incubation temperature is 55°C.

[0071] Preferably, in step S2, the incubation time is 30 to 90 seconds; more preferably, in step S2, the incubation time is 60 seconds.

[0072] Preferably, in step S2, the vortexing time is 5 to 60 seconds; more preferably, in step S2, the vortexing time is 30 seconds.

[0073] Preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 10 to 3000 mg / L. More preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 100 to 2000 mg / L. Further preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 1000 mg / L.

[0074] In another aspect, the present invention provides use of the double-stranded RNA against Hemiptera insects as described in any embodiment herein in the preparation of a pesticide for controlling Hemiptera insects.

[0075] In another aspect, the present invention provides use of the pesticide composition as described in any embodiment herein in the preparation of a pesticide for controlling Hemiptera insects.

[0076] In another aspect, the present invention provides use of the double-stranded RNA against Hemiptera insects as described in any embodiment herein in controlling Hemiptera insects.

[0077] In another aspect, the present invention provides use of the pesticide composition as described in any embodiment herein for controlling Hemiptera insects.

[0078] In another aspect, the present invention provides a method for controlling Hemiptera insects, the method comprising applying the double-stranded RNA against Hemiptera insects as described in any embodiment herein.

[0079] In another aspect, the present invention provides a method for controlling Hemiptera insects, the method comprising applying the pesticide composition as described in any embodiment herein.

[0080] Preferably, the Hemiptera insect is a Delphacidae insect. Preferably, the Hemiptera insect is selected from one or more of brown planthopper, white-backed planthopper, gray planthopper, green peach aphid, and cotton aphid. More preferably, the Delphacidae insect is brown planthopper.

[0081] The present invention has at least one of the following beneficial effects:

[0082] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present invention is a biological pesticide with the characteristics of high efficiency, specificity, rapid degradation and no residue. It can achieve the prevention and control of brown planthoppers through the mechanism of RNAi, which helps to reduce the use of chemical pesticides.

[0083] 2. The present invention provides new target genes of brown planthopper as targets for RNA interference. As can be seen from the survival rate results, these genes play an important role in the survival process of brown planthoppers and are effective targets for controlling brown planthoppers using gene silencing methods, with broad application prospects. Accordingly, the present invention provides multiple dsRNA sequences targeting these targets, and some sequences show unprecedented control efficiency of brown planthoppers.

[0084] 3. The present invention utilizes E. coli fermentation to produce dsRNA, and obtains high-purity dsRNA through positive pressure-bell-jar dual filtration and alcohol gradient precipitation. The method is low-cost, easy to operate, and can achieve large-scale production, breaking the limitations of traditional production methods and providing a feasible solution for the industrial production of dsRNA.

[0085] 4. The present invention provides a nanoparticle carrier that can quickly penetrate the body wall of pests and efficiently enter living cells, achieving a high dsRNA delivery efficiency and gene interference effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 This is the plasmid map of pET30a-GFP.

[0087] Figure 2 It is a liquid chromatography analysis spectrum of the product obtained by ethanol gradient precipitation.

[0088] Figure 3 is the survival rate of brown planthoppers 3 and 5 days after microinjection of dsRNA targeting each target. Figure 3 A in the figure is the survival rate of brown planthoppers 3 days after microinjection of dsRNA targeting each target; Figure 3 B in the figure is the survival rate of brown planthoppers 5 days after microinjection of dsRNA targeting each target.

[0089] Figure 4 The relative expression levels of mRNA levels of seven target genes were measured one day after microinjection of dsRNA targeting each target.

[0090] Figure 5 It is a schematic diagram of indoor biological testing processing.

[0091] Figure 6 These are the results of measuring the mRNA expression levels of target genes of brown planthoppers in rice seedlings treated with the seedling immersion method for 3 days in an indoor bioassay.

[0092] Figure 7 The results are as follows: The survival rate of brown planthoppers was determined 5 days after rice seedlings were treated with the seedling immersion method in an indoor bioassay.

[0093] Figure 8 These are the results of the survival rate determination of brown planthoppers after rice seedlings were treated with dsRNA preparations and acetamiprid liquid by the seedling immersion method in an indoor bioassay. DETAILED DESCRIPTION

[0094] Example 1: Target function and sequence design

[0095] The conserved domain database of the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / cdd / ?term=) was used to analyze the sequence conserved regions, and the corresponding target RNA sequences were designed for the seven gene targets of brown planthoppers using the online RNAi molecule design tool BLOCK-iT™ RNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ).

[0096]

[0097] dsRNA targeting target 1:

[0098] Sense strand (SEQ ID NO: 1)

[0099] ACGAGGGGCAAAUGAAUCACAUCCAGAUAGGGUUCCAAGUCAAACAGAAUUUCAUCAGUUUGAUUGAUAUUUGUUUCGAUGAAACCGUAUUGACGGCUAAUUACUCGCUGUAUCAAGCCAGCUACAGAAUCGCUG GUAGGCAAGUCCGGAUUUCCCAGGAUGAAUUUCAUCGCCGGAAAAUUCUACGGCGACAAUUGAAAUUUGGAAACUAUACUCGAGAAAGAAACAACGAGAAACGUUAGCCAAGAUUCUGGGAUCGGAAAAUUUAGCUAG UACUUACAUUAAAGAUGACAAAAACUACUAUCUAGCAAGAGGACAUUUAACAGCCAAAGCUGACUUUGUCUAUGGAGCUGAACAGAUGGCUACAUUCUACUACAUCAAUGUGGCGCCUCAAUGGCAAAUCAUCAA CGCUGGAAAUUGGGCUGCACUUGAAGAUAAUGUUCGCAACUACAUCAUCAACAAUAAACUGGAAGUUCUCAUCUACACCAUCCCUCACGGUGUAGCCGUAUUACCUGAUGCAGAUGGAAUCUACCAGCCUCUCUAC

[0100] Antisense strand (SEQ ID NO: 2)

[0101] GUAGAGAGGCUGGUAGAUUCCAUCUGCAUCAGGUAAUACGGCUACACCGUGAGGGAUGGUGUAGAUGAGAACUUCCAGUUUAUUGUUGAUGAUGUAGUUGCGAACAUUAUCUUCAAGUGCAGCCCAAUUUCCAGCGUUGAUGAUUUGCCAUUGAGGCGCCACAUUGAUGUAGUAGAAUGUAGCCAUCUGUUCAGCUCCAUAGACAAAGUCAGCUUUGGCUGUUAAAUGUCCUCUUGCUAGAUAGUAGUUUUUGUCAUCUUUAAUGUAAGUACUAGCUAAAUUUUCCGAUCCCAGAAUCUUGGCUAACGUUUCUCGUUGUUUCUUUCUCGAGUAUAGUUUCCAAAUUUCAAUGUCGCCGUAGAAUUUUCCGGCGAUGAAAUUCAUCCUGGGAAAUCCGACUUGCCUACCAGCGAUUCUGUAGCUGGCUUGAUACAGCGAGUAAUUAGCCGUCAAUACGGUUUCAUCGAAACAAAUAUCAAUCAAACUGAUGAAAUUCUGUUUGACUUGGAACCCUAUCUGGAUGUGAUUCAUUUGCCCCUCGU

[0102] dsRNA targeting target 2:

[0103] Sense strand (SEQ ID NO: 3)

[0104] UCAAGCUGCCAAGGAGCAUGUAUUGGCAGUUUCAAGGGAUUUCAUUUCACAGCCAAGAUUGACAUAUAAAACUGUUUGUGGUGUCAACGGCCCUUUGGUGAUCUUGGAUGAGGUCAAAUUCCCCAAGUUUGCUGAAAUUGUUCAGCUCAAACUUGCUGAUGGAACUGUUCGUUCCGGUCAAGUAUUGGAAGUCAGCGGCACUAAGGCUGUUGUACAGGUCUUCGAAGGAACUUCCGGAAUUGAUGCGAAAAACACUCUGUGUGAGUUCACCGGUGAUAUCCUUCGGACGCCAGUAUCAGAAGAUAUGCUUGGUCGUGUAUUCAACGGAAGUGGUAAGCCCAUCGACAAAGGACCUCCCAUUCUUGCCGAGGAUUAUCUCGACAUUCAAGGUCAACCCAUCAAUCCUUGGUCGCGUAUCUAUCCCGAGGAAAUGAUCCAGACUGGAAUUUCAGCCAUCGACGUCAUGAACUCGAUUGCUCGUGGCCAGAAAAUUCCCAUCUUUUCAGCUGCCGGUCUACCUCACAACGAAAUUGCUGCUCAAAUCUGUAGACAGGCUGGUCUUGUCAAACUGCCAGGAAAGUCAGUUCUCGAU

[0105] Antisense strand (SEQ ID NO: 4)

[0106] AUCGAGAACUGACUUUCCUGGCAGUUUGACAAGACCAGCCUGUCUACAGAUUUGAGCAGCAAUUUCGUUGUGAGGUAGACCGGCAGCUGAAAAGAUGGGAAUUUUCUGGCCACGAGCAAUCGAGUUCAUGACGUCGAUGGCUGAAAUUCCAGUCUGGAUCAUUUCCUCGGGAUAGAUACGCGACCAAGGAUUGAUGGGUUGACCUUGAAUGUCGAGAUAAUCCUCGGCAAGAAUGGGAGGUCCUUUGUCGAUGGGCUUACCACUUCCGUUGAAUACACGACCAAGCAUAUCUUCUGAUACUGGCGUCCGAAGGAUAUCACCGGUGAACUCACACAGAGUGUUUUUCGCAUCAAUUCCGGAAGUUCCUUCGAAGACCUGUACAACAGCCUUAGUGCCGCUGACUUCCAAUACUUGACCGGAACGAACAGUUCCAUCAGCAAGUUUGAGCUGAACAAUUUCAGCAAACUUGGGGAAUUUGACCUCAUCCAAGAUCACCAAAGGGCCGUUGACACCACAAACAGUUUUAUAUGUCAAUCUUGGCUGUGAAAUGAAAUCCCUUGAAACUGCCAAUACAUGCUCCUUGGCAGCUUGA

[0107] dsRNA targeting target 3:

[0108] Sense strand (SEQ ID NO: 5)

[0109] AAGCCCCUCUCAGAGUUCCUCGACUUUGUGCGCUAUGCCUACAUGAUCGACAACACCAUUCUGCUAAUGACAGGCACUCUCCAUCAGCGACCUGUUGACGAGGUGGCAGCCCGUUGUCACCCGCUCGGCCGCUUCCAGCAAUGGAGGCAGUACACGUGGCGUUGACUCCUCGCGAGCUCUACAACGCGGUGAUUGUGGACACGCCCCUCGCACCCUUCUUCCUCGACUGCAUCAAUGAGCACAGUCUCAACGAGGUCAAUGUCGAACUUAUACGCAACAUGCUCUACAAGGCAUAUUUGGAGAGCUUCGACAAGUUCUGCAAGAAUCUGGGUGGCAUCACAGCUGAGACGAUGUCUGAGAUACUAGCGUUCGAGUGUGACAGACGUGCCUUCAUGAUCACCAUCAACUCGUUCCGCACCGAACUGACCAAGAGUGAGCGCGCCAGUCUGUUCCCACGCUGCGGCCUGCUGCAUCCCACCGGACUGGCUGCUCUGGCUGCGGCUGACAACUAUGAACAGGUGACCUUCAUCAG

[0110] Antisense strand (SEQ ID NO: 6)

[0111] CUGAUGAAGGUCACCUGUUCAUAGUUGUCAGCCGCAGCCAGAGCAGCCAGUCCGGUGGGAUGCAGCAGGCCGCAGCGUGGGAACAGACUGGCGCGCUCACUCUUGGUCAGUUCGGUGCGGAACGAGUUGAUGGUGAUCAUGAAGGCACGUCUGUCACACUCGAACGCUAGUAUCUCAGACAUCGUCUCAGCUGUGAUGCCACCCAGAUUCUUGCAGAACUUGUCGAAGCUCUCCAAAUAUGCCUUGUAGAGCAUGUUGCGUAUAAGUUCGACAUUGACCUCGUUGAGACUGUGCUCAUUGAUGCAGUCGAGGAAGAAGGGUGCGAGGGGCGUGUCCACAAUCACCGCGUUGUAGAGCUCGCGAGGAGUCAACGCCACGUGUACUGCCUCCAUUGCUGGAAGCGGCCGAGCGGGUGACAACGGGCUGCCACCUCGUCAACAGGUCGCUGAUGGAGAGUGCCUGUCAUUAGCAGAAUGGUGUUGUCGAUCAUGUAGGCAUAGCGCACAAAGUCGAGGAACUCUGAGAGGGGCUU

[0112] dsRNA targeting target 4:

[0113] Sense strand (SEQ ID NO: 7)

[0114] AAAACUGCCGAGAAAAACGUCACCCAAUUGGAAUCAAUCAUUAUAACAAAAGCGAAAAUGGUGGUGCAAACGGCGAGACAAAAUUUCAUAUCUGAAGUGACUACUGAUAUCCACCAAAGCUUGGAAAACUGUGUAACUGAAGAUGGCUAUGCCAGCGUUCUAAAGAGUCUCAUAAUUCAAGCUCUUUGCAUGUUGCAAGAGGCAGACGUGAUAGUGCAAGUGAGAGAGCAGGACAGAGAUAUCGUAAAAUCAGCCACCAAUGAAAUGAUGGACAGGUACAAGUCUAUCACCGGACAGGACUGCAACAUCACUUUGUCCAAAAAGAAUUUGCCCGGGAAAAGUAUUGGAGGCACUGUUGUCUACAACAAACGCUGUACACUAAAGGUAGACAACACACUUUACGACAGGUUGAGAAUAGUUCUGGAACAAUCGUUGCCAAUGUUCAGGGAGUUAUUAUUCAACGA

[0115] Antisense strand (SEQ ID NO: 8)

[0116] UCGUUGAAUAAUAACUCCCUGAACAUUGGCAACGAUUGUUCCAGAACUAUUCUCAACCUGUCGUAAAGUGUGUUGUCUACCUUUAGUGUACAGCGUUUGUUGUAGACAACAGUGCCUCCAAUACUUUUCCCGGGCAAAUUCUUUUUGGACAAAGUGAUGUUGCAGUCCUGUCCGGUGAUAGACUUGUACCUGUCCAUCAUUUCAUUGGUGGCUGAUUUUACGAUAUCUCUGUCCUGCUCUCUCACUUGCACUAUCACGUCUGCCUCUUGCAACAUGCAAAGAGCUUGAAUUAUGAGACUCUUUAGAACGCUGGCAUAGCCAUCUUCAGUUACACAGUUUUCCAAGCUUUGGUGGAUAUCAGUAGUCACUUCAGAUAUGAAAUUUUGUCUCGCCGUUUGCACCACCAUUUUCGCUUUUGUUAUAAUGAUUGAUUCCAAUUGGGUGACGUUUUUCUCGGCAGUUUU

[0117] dsRNA targeting target 5:

[0118] Sense strand (SEQ ID NO: 9)

[0119] AAUGAUCCUGAAUUUGUCAAGCGCCAAGAAGCCAAGUCAUCGGCUCUUGACGAACAGCUGAAAGAGUACAUCGCCGAAUGGCGCAAACAGAGGUCAAAGGAGGAGGAUGAUCUCAAAAAGCUCAAGGAGAAACAGGCCAAGCGCAAGGUCAUGCGAGCGGAAGAAGAAAAGAAAAUGGCGGAACGCAAGAAGCAAGAGGAGGAGCGCAGAGUGAAGGAGAUCGAAGAGAAGAAACAGAGAGACAUGGAAGAGAAAAGAAAGCGCUUGGAAGAGGCCGAGAAGAAGAGACAGACAAUGAUGGCGGCUCUCAAGGACCAGAGCAAAUCGAAAGGACCCAACUUCACCGUAAACAAGAAAACAGACUUGAACAUGACCUCAGCUCAAAUGGAAAGGAACAAGACUAAGGAGCAGCUGGAGGAGGAGAAGAAGAUCUCUCUGUCGUUCCGCAUCAAGCCGUUGGCCAUCGAGAACAUGAGCAUCAACGCACUGCGCGCCAAGGCCCAGGAACUGUGGGACUGCAUCGUCAAGCUCGAAACUGAGAAGUACGAUCUGGAGGAACGCCAGAA

[0120] Antisense strand (SEQ ID NO: 10)

[0121] UUCUGGCGUUCCUCCAGAUCGUACUUCUCAGUUUCGAGCUUGACGAUGCAGUCCCACAGUUCCUGGGCCUUGGCGCGCAGUGCGUUGAUGCUCAUGUUCUCGAUGGCCAACGGCUUGAUGCGGAACGACAGAGAGAUCUUCUUCUCCUCCUCCAGCUGCUCCUUAGUCUUGUUCCUUUCCAUUUGAGCUGAGGUCAUGUUCAAGUCUGUUUUCUUGUUUACGGUGAAGUUGGGUCCUUUCGAUUUGCUCUGGUCCUUGAGAGCCGCCAUCAUUGUCUGUCUCUUCUUCUCGGCCUCUUCCAAGCGCUUUCUUUUCUCUUCCAUGUCUCUCUGUUUCUUCUCUUCGAUCUCCUUCACUCUGCGCUCCUCCUCUUGCUUCUUGCGUUCCGCCAUUUUCUUUUCUUCUUCCGCUCGCAUGACCUUGCGCUUGGCCUGUUUCUCCUUGAGCUUUUUGAGAUCAUCCUCCUCCUUUGACCUCUGUUUGCGCCAUUCGGCGAUGUACUCUUUCAGCUGUUCGUCAAGAGCCGAUGACUUGGCUUCUUGGCGCUUGACAAAUUCAGGAUCAUU

[0122] dsRNA targeting target 6:

[0123] Sense strand (SEQ ID NO: 11)

[0124] AUUGAGACAACAAAAAUCAGUAUAAUGUUGAACACCAUGGGACAGAUAUUCGAUGAAGAAGAAUUGAACGCUUUGAUCAGAGAAAAUGAUCCAGACAAAUCCGGUAGACUGAACUUUGAUGGAUUUUGCCGCAUUGCAACACAUUUCCUAGAAGAAGAUGAUGCUGAAGCUAUGCAAGAAGAAUUGAAAGAAGCCUUCAGAUUGUAUGACAAAGAAGGUAACGGUUACAUCACAACGGGAACGCUGAGGGAAAUCUUGGCCGCUCUGGAUGAUAAACUGAAUAAUGAUGAUUUAGAUGGUAUCAUUGCUGAGAUCGACACUGACGGAUCAGGCACAGUCGACUUUGAUGAAUUCAUGGAGAUGAUGACAGGAGAAUAAAUGACCUGAAACGCUAUGGAGGCAAUGCCAUAUCUAUCCCUUCCAAAAAAUCCUUCAUUAAUGCAAGAUAUAAUCUUCUUCUAUCUGAUCGAGUCUGAGGCUGGAAAACUUGUGAUUC

[0125] Antisense strand (SEQ ID NO: 12)

[0126] GAAUCACAAGUUUUCCAGCCUCAGACUCGAUCAGAUAGAAGAAGAUUAUAUCUUGCAUUAAUGAAGGAUUUUUUGGAAGGGAUAGAUAUGGCAUUGCCUCCAUAGCGUUUCAGGUCAUUUAUUCUCCUGUCAUCAUCUCCAUGAAUUCAUCAAAGUCGACUGUGCCUGAUCCGUCAGUGUCGAUCUCAGCAAUGAUACCAUCUAAAUCAUCAUUAUUCAGUUUAUCAUCCAGAGCGGCCAAGAUUUCCCUCAGCGUUCCCGUUGUGAUGUAACCGUUACCUUCUUUGUCAUACAAUCUGAAGGCUUCUUUCAAUUCUUCUUGCAUAGCUUCAGCAUCAUCUUCUUCUAGGAAAUGUGUUGCAAUGCGGCAAAAUCCAUCAAAGUUCAGUCUACCGGAUUUGUCUGGAUCAUUUUCUCUGAUCAAAGCGUUCAAUUCUUCUUCAUCGAAUAUCUGUCCCAUGGUGUUCAACAUUAUACUGAUUUUUGUUGUCUCAAU

[0127] dsRNA targeting target 7:

[0128] Sense strand (SEQ ID NO: 13)

[0129] AGAAGAAGCUCAGGUUGUUGCUGAGGAAAAAGGCUGCUGAGGAAUUGAAGAAGGAACAGGAGAGGAAAGCCGCGGAAAGGAGAAGGAUCAUCGAGGAGAGGUGUGGCAAGGCUGUUGAUCUCGAUGACGGAAGUGAAGAGAAAGUCAAGGCAACUUUAAAAACCUAUCACGACAGAAUUGGAAAAUUGGAGGAUGAAAAAUUUGACCUGGAAUAUAUUGUAAAAAAGAAAGACUUCGAGAUCGCUGACCUCAACAGCCAGGUGAAUGACCUCCGUGGUAAAUUUGUCAAGCCAACCUUGAAAAAAGUCUCCAAAUAUGAGAACAAAUUCGCCAAGCUCCAGAAGAAAGCAGCUGAAUUCAAUUUCAGAAAUCAGCUCAAAGUUGUCAAGAAGAAGGAAUUCACCUUGGAAGAAGAAGACAAGGAGAAAAAGGGAAUCGUCGAUUGGUCAAAGAAGGACGAGAAGAAGGACGGCGGAGAUGGAACACCAGCUGAAGCGACAGAAGGGGCACCCGACGACGGGGACCUGCUGGACGACG

[0130] Antisense strand (SEQ ID NO: 14)

[0131] CGUCGUCCAGCAGGUCCCCGUCGUCGGGUGCCCCUUCUGUCGCUUCAGCUGGUGUUCCAUCUCCGCCGUCCUUCUUCUCGUCCUUCUUUGACCAAUCGACGAUUCCCUUUUUCUCCUUGUCUUCUUCUUCCAAG GUGAAUUCCUUCUUCUUGACAACUUUGAGCUGAUUUCUGAAAUUGAAUUCAGCCUGCUUUCUUCUGGAGCUUGGCGAAUUUGUUCUCAUAUUUGGAGACUUUUUUCAAGGUUGGCUUGACAAAUUUACCACGGAG GUCAUUCACCUGGCUGUUGAGGUCAGCGAUCUCGAAGUCUUUCUUUUUACAAUAUAUUCCAGGUCAAAUUUUUCAUCCUCCAAUUUUCCAAUUCUGUCGUGAUAGGUUUUUAAAGUUGCCUUGACUUUCUCUU CACUUCCGUCAUCGAGAUCAACAGCCUUGCCACACCUCUCCUCGAUGAUCCUUCUCCUUUCCGCGGCUUUCCCUCCUGUUCCUUCUUCAAUUCCUCAGCAGCCUUUUUCCUCAGCAACAACCUGAGCUUCUUCU

[0132] Example 2: Construction of recombinant dsRNA expression strain

[0133] In order to prepare dsRNA for target validation, a recombinant strain for fermentation production was first constructed. Five third-instar nymphs of brown planthoppers were collected as samples, and the total RNA of brown planthoppers was extracted using the Trizol method. The extracted total RNA was used as a template for reverse transcription to synthesize cDNA. The synthesized cDNA was used as a template, and the polymerase chain reaction (PCR) technology was used to amplify the target fragments shown in Table 3 with reference to the reaction system and reaction conditions in Tables 1 and 2; for each target, only the target fragment corresponding to one of the sense strands or antisense strands needed to be amplified. Subsequently, the PCR products were separated by 1.2% agarose gel electrophoresis. The target bands were excised and recovered using a gel recovery kit, and further purified to obtain the desired product with high purity.

[0134] Table 1: PCR system

[0135]

[0136] Table 2: PCR amplification program

[0137]

[0138] Table 3: Target fragments corresponding to target RNA

[0139]

[0140] The pET-30a plasmid used in this example is commercially available.

[0141] The pET-30a plasmid was digested with EcoRI endonuclease, and the specific operation was in accordance with the reaction system shown in Table 4, and the reaction was carried out at 37°C for 1 hour. After the digestion reaction was completed, the digestion products were separated by agarose gel electrophoresis, and then the gel recovery purification method was used to obtain the purified linearized plasmid.

[0142] Table 4: Enzyme digestion system

[0143]

[0144] The recovered and purified PCR product was mixed with the pET-30a plasmid after enzyme digestion according to the ligation reaction system shown in Table 5. The reaction was carried out at 16°C for 1 hour, so that the PCR product and the linearized plasmid formed a series of recombinant plasmids of pET-30a-target 1 to pET-30a-target 7 through the principle of base complementary pairing under the action of DNA ligase. After the ligation reaction was completed, the ligation product was transformed into HT115 (DE3) competent cells by heat shock method; the HT115 (DE3) is a HT115 RNase III-deficient Escherichia coli strain with DE3 strain characteristics; HT115 (DE3) competent cells are commercially available.

[0145] The pET-30a-GFP recombinant plasmid used as a control was constructed in the same manner and transformed into HT115 (DE3) competent cells. The plasmid map of pET-30a-GFP is shown in Figure 1 The transformed cells were evenly spread on a plate containing kanamycin and cultured in a 37°C constant temperature incubator for 12-14 hours.

[0146] Table 5: Connection system

[0147]

[0148] After the culture was completed, single colonies were selected from the plate and amplified according to the colony PCR amplification system shown in Table 6. Positive clones that successfully transformed the target fragments corresponding to the targets shown in Table 3 were screened and sequenced for analysis. Specifically, since the double T7 promoter in the pET-30a plasmid was retained in the recombinant plasmid (see Figure 1), and the two T7 promoters are located at the two ends of the target fragment, respectively, and the expression directions are opposite. Therefore, the positive clone colonies transformed with the target fragment corresponding to one of the positive strands or the antisense strand can express the double-stranded RNA of the corresponding target. For the positive clones with correct sequencing results, glycerol with a final concentration of 25% is added as a protective agent to make glycerol bacteria, which are stored in an ultra-low temperature refrigerator at -80℃ for subsequent experimental research and application.

[0149] Table 6: Colony PCR system

[0150]

[0151] Example 3: Purification of dsRNA from strain fermentation products

[0152] The recombinant bacteria were cultured in LB medium. When the OD600 value of the culture solution was close to 0.4, 0.5 mM IPTG was added to induce the expression of dsRNA. The cells were collected after continuing to culture at 37°C for 14 hours. The dsRNA of the fermentation product was then extracted and purified. The purification process mainly included the steps of pretreatment of the fermentation solution, positive pressure-bell jar double filtration, and alcohol gradient precipitation. The specific operation process is as follows:

[0153] Pretreatment of fermentation broth: First, the dsRNA fermentation broth obtained after the recombinant E. coli expressing the target fragment dsRNA was broken, and then pretreated in a 50°C water bath and ultrasonic for 30 minutes. After that, the pH value of the fermentation broth was adjusted to 8 using buffer A, and centrifuged at 13,000 rpm and 10°C for 20 minutes using a tubular centrifuge to collect supernatant A. Then, the pH value of supernatant A was adjusted to 6 using buffer B, and centrifuged at 15,000 rpm and 5°C for 20 minutes, and supernatant B was collected.

[0154] The specific composition of buffer A is: 0.15 M sodium bicarbonate, 0.014 M sodium tetraborate and 0.48 M sodium chloride, and the pH value is 8.5; the specific composition of buffer B is: 0.15 M citric acid, 0.18 M hydrochloric acid, 0.22 M tris(hydroxymethyl)aminomethane) and 0.62 M sodium chloride, and the pH value is 4.5.

[0155] Positive pressure-bell jar double filtration: Then, the supernatant B was filtered using a positive pressure-bell jar double filtration device. The pore size of the filter column used was 0.22 µm, a cellulose filter element was used, and the pressure was kept stable at 0.1 Mpa.

[0156] Ethanol gradient precipitation: The liquid after bell-type filtration is precipitated with ethanol at a final concentration of 30% (v / v). Centrifuge it in a tubular centrifuge at 10,000 rpm and 4°C for 20 minutes, and collect the supernatant C. Let the supernatant C stand overnight at 10°C. After a jelly-like state is formed on its surface, stir it at a low speed of 1,000 rpm, and gradually add anhydrous ethanol to it to a final concentration of 70% (v / v). Finally, centrifuge it in a tubular centrifuge at 15,000 rpm and 4°C for 40 minutes, and collect the solid. The results of liquid chromatography analysis of the solid are shown in the figure. Figure 2 As shown, it indicates that RNA with higher purity was obtained.

[0157] Through the above steps, efficient purification of each target dsRNA was successfully achieved, providing high-quality and high-purity samples for subsequent in-depth research.

[0158] Example 4: Verification of the effect of each target dsRNA

[0159] According to the methods of Examples 2 and 3, dsRNA targeting all targets in Example 1 and GFP dsRNA were prepared, with GFP dsRNA as the control sequence; each dsRNA was dissolved in ultrapure water to a final concentration of 500 ng / μL. Brown planthopper nymphs in the third instar stage were selected as experimental subjects, and about 25 ng of dsRNA was introduced into the body of the brown planthopper by microinjection. The specific injection site was the area between the bases of the second pair of legs of the brown planthopper. In order to eliminate the interference of mechanical damage on subsequent experimental results, after completing all injection operations, the brown planthoppers were left to stand for 3 hours, and the surviving brown planthoppers were screened and transferred to glass test tubes, and fed with rice seedlings as a food source. During the feeding process, the survival status of the brown planthoppers was counted at regular intervals, and the statistical results are as follows. Figure 3 On the third day after injection, the injection survival rates of the seven targets ranged from 10.2% to 53.7%, which were significantly lower than the survival rate of the control group (89.4%, see Figure 3 , A). On the 5th day after injection, the survival rate of the control group was 68.6%, while the survival rates of the 7 targets were all lower than 26.3%, of which the survival rate of target 7 was lower than 10%, and the survival rates of brown planthoppers in targets 3 and 6 dropped to 0, which means that the control effect was 100% (see Figure 3 , B). Figure 3 The results were obtained by using the student t test to analyze whether there were significant differences between the control group and the treatment groups. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001.

[0160] Example 5: Effects of each target dsRNA on target expression level

[0161] 24 hours after microinjection, samples of brown planthoppers from the experimental group and the control group were collected to detect changes in the expression level of the target gene in the brown planthopper. To ensure the reliability and statistical significance of the experimental data, three biological replicates were set for each group of samples, and 5 brown planthopper nymphs were collected from each replicate sample.

[0162] Total RNA was extracted from brown planthopper samples using the Trizol method, and the reaction systems shown in Table 7 were prepared for reverse transcription according to the HiScript III All-in-one RTSuperMix Perfect for qPCR Kit (purchased from Vazyme). The specific reaction conditions were: incubation at 50°C for 15 minutes, followed by rapid treatment of the reaction system at 85°C for 5 seconds to complete the synthesis of cDNA. The synthesized cDNA was diluted 6 times for quantitative polymerase chain reaction (qPCR). The reaction system and parameter settings for qPCR are shown in Tables 8 and 9.

[0163] Table 7: Reverse transcription system

[0164]

[0165] Table 8: qPCR reaction system

[0166]

[0167] Table 9: qPCR reaction conditions

[0168]

[0169] Quantitative PCR data showed ( Figure 4 ), one day after microinjection, the relative mRNA expression of the seven targets decreased significantly, ranging from 16.0% to 72.1%. Among them, the knockdown effect of targets 3 and 6 was the most significant, and their relative gene expression levels dropped to 16.0% and 19.7%, respectively. Overall, the knockdown effect of the target was similar to the survival rate trend after microinjection, proving that dsRNA can successfully enter the body of brown planthoppers and induce gene knockdown through the RNA interference mechanism, thereby producing a control effect. Figure 4 The results were obtained by using the student-t test to analyze whether there were significant differences between the control group and the treatment group data for each target. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001.

[0170] Based on the experimental results of microinjection and gene knockdown, the seven target fragments can effectively cause the death of nymphs through the RNA interference mechanism, showing good control effects on brown planthopper nymphs, indicating that these genes play a key role in the survival of brown planthopper nymphs and have important potential and application value in the prevention and control strategy of brown planthoppers.

[0171] Example 6: Preparation of dsRNA Nanoparticle Formulations

[0172] In order to reduce the degradation effect of complex field environment on dsRNA, the present invention uses chitosan nanomaterials to encapsulate dsRNA, thereby preparing a dsRNA nanoparticle preparation for RNA interference. The specific operation steps are as follows:

[0173] First, prepare 0.1 M sodium acetate buffer, adjust the pH to 4.5 with acetic acid, and obtain acetic acid-sodium acetate buffer. Dissolve chitosan with acetic acid-sodium acetate buffer to prepare a chitosan acetate solution with a concentration of 0.02% (w / v) chitosan. Next, dissolve dsRNA in 50mM Na2SO4 solution to obtain a dsRNA sodium sulfate solution with a dsRNA concentration of 2000 mg / L. Subsequently, slowly add the dsRNA sodium sulfate solution to the chitosan acetate solution at a volume ratio of 1:1, mix thoroughly, and incubate at 55°C for 60 seconds. After incubation, quickly vortex the mixture at high speed for 30 seconds to generate a chitosan nanoparticle preparation of dsRNA, and the dsRNA content in the final preparation is 1000 mg / L.

[0174] Example 7: Indoor bio-test

[0175] The bioassay experiment used the seedling immersion method to treat rice seedlings. The treatment group used dsRNA (targeting targets 3 and 6, respectively) solution to immerse rice seedlings, and used a solution containing naked dsRNA and a dsRNA nanoformulation to immerse them, respectively. The dsRNA content of both groups was 1000 mg / L; the control group used water instead of dsRNA solution. The specific groups are shown in Table 10.

[0176] Table 10: Grouping of indoor biological tests

[0177]

[0178] Select fresh rice seedlings, rinse them with clean water and dry them, soak the whole rice seedling in the soaking liquid for 4 seconds, take them out, and place them in a cool and ventilated place to dry naturally. Next, wrap the roots of the rice seedlings with soaked cotton and place them in glass test tubes, with three rice plants in each test tube. Select 15 healthy and active third-instar brown planthopper nymphs raised indoors, put them in the test tubes, seal them with absorbent cotton balls, and place them on a plant culture rack at 25±2℃ with 12 hours of light and dark alternation for culture. Figure 5 As shown, each treatment was repeated 4 times, and the survival rate of brown planthoppers was investigated and counted after 5 days. The survival rate was calculated as follows: survival rate (%) = (number of surviving insects / total number of insects) × 100%.

[0179] After 3 days of treatment, samples of brown planthoppers from the treatment group and the control group were collected to detect the expression level of the target gene. Figure 6 As shown. Compared with the control group, the mRNA expression levels of each gene in the naked dsRNA treatment group decreased by 15.8%-31.9%, while the mRNA expression levels of each gene in the dsRNA preparation group decreased by 54.5%-79.3%, which was significantly different from both the control group and the naked dsRNA group. This result fully demonstrates that the nanoparticle preparation carrier prepared with chitosan can greatly enhance the silencing effect of dsRNA on the target gene and more effectively inhibit the expression of the target gene. Figure 6 The results in the table are the results of ANOVA analysis of the differences among the groups. The same letters indicate no significant differences among the groups, and different letters indicate significant differences among the groups (P<0.05).

[0180] After 5 days of treatment, the survival rate of each group of brown planthoppers was measured as follows: Figure 7 The survival rate of brown planthoppers in the control group was between 82.7% and 86.4%. In comparison, the survival rate of brown planthoppers in the naked dsRNA group decreased, while the survival rate of brown planthoppers in the dsRNA preparation group decreased significantly. Among them, the survival rate of brown planthoppers treated with the nanoformulation of target 6 was 11.6%, and the control effect of target 3 was better, with a survival rate of only 7.2%. Figure 7 The results were obtained by ANOVA analysis of the differences among the groups, where the same letters indicate no significant differences among the groups, and different letters indicate significant differences among the groups (P<0.01).

[0181] Example 8: Comparison of the effects of dsRNA preparations and conventional chemical pesticides

[0182] In order to comprehensively evaluate the control effect of dsRNA preparations, this example compares the control effect of conventional chemical pesticide acetamiprid and dsRNA preparations targeting target 3 on brown planthoppers. A 50 mg / L acetamiprid solution was prepared, and a 500 mg / L dsRNA preparation was prepared according to the method of Example 7. The nymphs of brown planthoppers were treated using the seedling immersion method of Example 7, and their survival rate was determined.

[0183] like Figure 8 As shown in the figure, after 3 days of treatment, acetamiprid and dsRNA preparations had significant lethal effects, with survival rates of about 50%. After 5 days of treatment, the survival rates of brown planthoppers in the acetamiprid and dsRNA preparation treatment groups dropped to only 9.3% and 16.3%, respectively, which were significantly lower than the survival rate of the control group (P<0.01), but there was no significant difference in survival rate between the acetamiprid and dsRNA preparation treatment groups (P>0.05). Figure 8 The results in the table are obtained by using ANOVA to analyze the differences between groups. The same letters indicate no significant differences between groups, and different letters indicate significant differences between groups (P<0.01). The above results show that the control effect of dsRNA preparations on brown planthoppers is comparable to that of the conventional chemical pesticide acetamiprid. Nevertheless, dsRNA preparations have significant advantages over traditional chemical pesticides such as acetamiprid in that they are green and pollution-free. It can be seen that RNA biological control of rice brown planthoppers is an efficient and highly potential control method, and has good development prospects in the field of agricultural pest control in the future.

[0184] The present invention has at least one of the following beneficial effects:

[0185] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present invention is a biological pesticide with the characteristics of high efficiency, specificity, fast degradation and no residue. It can achieve the prevention and control of brown planthoppers through the mechanism of RNAi, which helps to reduce the use of chemical pesticides, improve the quality of agricultural products, meet consumers' demand for green and pollution-free food, and open up a new path for the green and sustainable development of agriculture.

[0186] 2. The present invention provides a new brown planthopper target gene as a target for RNA interference. As can be seen from the survival rate results, these genes play an important role in the survival process of brown planthoppers, and are effective targets for the prevention and control of brown planthoppers using gene silencing methods, and have broad application prospects. Accordingly, the present invention provides multiple dsRNA sequences targeting these targets, and some sequences show unprecedented brown planthopper control efficiency. These dsRNAs can accurately interfere with the key genes of brown planthoppers, thereby effectively inhibiting their reproduction and survival and reducing damage to crops; compared with the dsRNA of the prior art, the dsRNA sequence provided by the present invention has a better control effect, which is conducive to reducing the amount of dsRNA used, thereby reducing the cost of control, and creating favorable conditions for the promotion and application of nucleic acid pesticides.

[0187] 3. Currently, most studies use in vitro transcription kits to synthesize a small amount of dsRNA. The present invention uses E. coli fermentation to produce dsRNA, and obtains high-purity dsRNA through positive pressure-bell-shaped double filtration and alcohol gradient precipitation. This method is low-cost, easy to operate, and can achieve large-scale production, breaking the limitations of traditional production methods and providing a feasible solution for the industrial production of dsRNA.

[0188] 4. The present invention uses a nanoparticle carrier that can quickly penetrate the body wall of pests and efficiently enter living cells, achieving high dsRNA delivery efficiency and gene interference effect. This nanoparticle carrier provides new technical reserves for RNA preparation research and development and pest control.

Claims

1. A double-stranded RNA targeting Hemiptera insects, characterized in that: The double-stranded RNA targeting Hemiptera insects comprises a sense strand and an antisense strand, wherein: the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO:

2.

2. An expression vector, characterized in that: The expression vector comprises the sense strand or antisense strand of the double-stranded RNA targeting Hemiptera insects as claimed in claim 1.

3. A host cell, characterized in that The host cell comprises the sense strand or antisense strand of the double-stranded RNA against Hemiptera insects as claimed in claim 1, or the expression vector as claimed in claim 2.

4. A method for preparing the double-stranded RNA targeting Hemiptera insects as claimed in claim 1, the method comprising using the expression vector as claimed in claim 2 for expression, or using the host cell as claimed in claim 3 for expression.

5. The method according to claim 4, characterized in that The method comprises the following steps: S1: Extract RNA from brown planthopper; S2: cDNA was obtained by reverse transcription using RNA from brown planthopper as template; S3: Using cDNA as a template, amplify the target sequence by PCR; S4: clone the target sequence into the plasmid to obtain a recombinant plasmid vector; S5: transforming the recombinant plasmid vector into competent cells, and using the competent cells transformed with the recombinant plasmid vector as host cells; S6: culturing host cells, using an inducer to induce the host cells to express double-stranded RNA targeting Hemiptera insects, and obtaining a fermentation liquid; S7: Purification of double-stranded RNA targeting Hemiptera insects from fermentation broth.

6. The method according to claim 5, characterized in that In step S7, the purification step includes: S7-1: fermentation broth pretreatment; S7-2: Positive pressure-bell jar type two-way filtration; S7-3: Ethanol gradient precipitation.

7. A pesticide composition, characterized in that: The pesticide composition comprises an effective amount of the double-stranded RNA targeting Hemiptera insects as claimed in claim 1, and a pharmaceutically acceptable carrier, solvent or excipient.

8. The pesticide composition according to claim 7, characterized in that The carrier is chitosan nanoparticles.

9. A method for preparing the pesticide composition according to claim 7 or 8, characterized in that: The method comprises adding the double-stranded RNA targeting Hemiptera insects as claimed in claim 1 and a pharmaceutically acceptable carrier, solvent or excipient into a solvent.

10. The method according to claim 9, characterized in that The method comprises the following steps: S1: dissolving chitosan with acetate buffer to obtain chitosan acetate solution; dissolving dsRNA with sodium sulfate solution to obtain dsRNA sodium sulfate solution; S2: slowly drop the dsRNA sodium sulfate solution into the chitosan acetate solution, mix thoroughly, incubate, and vortex after incubation to obtain a dsRNA chitosan nanoparticle preparation.

11. Use of the double-stranded RNA against Hemiptera insects as claimed in claim 1 in the control of Hemiptera insects.

12. Use of the pesticide composition according to claim 7 or 8 in controlling Hemiptera insects.

Images