Perilla PfDof29 gene for regulating and controlling synthesis of vegetable fatty acid and grease, recombinant expression vector, recombinant bacterium and application

Abstract

The invention belongs to the technical field of plant molecular biology, and particularly relates to a purple perilla PfDof29 gene for regulating and controlling synthesis of vegetable fatty acid and grease, a recombinant expression vector, recombinant bacteria and application. Functional research is carried out on a perilla PfDof29 transcription factor regulation and control oil biosynthesis mechanism, and the result shows that perilla PfDof29 can remarkably improve the total oil content of tobacco plant leaves, can be specifically combined with a PfFAD8 promoter and mediate a molecular regulation and control mechanism of perilla polyunsaturated fatty acid, and the total oil content of tobacco plant leaves can be remarkably improved. A theoretical basis is laid for deep analysis of a perilla frutescens Dof transcription factor mediated oil biosynthesis function and a regulation mechanism thereof, and an excellent gene resource is provided for oil yield increase and quality improvement of oil crops such as perilla frutescens.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and specifically relates to a perilla PfDof29 gene, a recombinant expression vector, a recombinant bacterium and applications thereof for regulating the synthesis of plant fatty acids and oils. Background Art

[0002] Perilla (Perilla frutescens L.) is an annual herbaceous plant belonging to the genus Perilla of the Lamiaceae family. It has high medicinal and edible value and is also a special oil crop. Perilla seed oil is rich in a large number of unsaturated fatty acids, among which α-linolenic acid, abbreviated as α-LNA, has a content of more than 65%, making it one of the most abundant plant resources known to contain α-linolenic acid. Its content is much higher than that of common oil crops such as soybeans (Glycine max) and peanuts (Arachis hypogaea). α-linolenic acid is an essential fatty acid for the human body, which has the effects of promoting brain development and protecting the cardiovascular and cerebrovascular systems. Perilla is a natural and sustainable functional oil resource with great development value in the field of medicine and food homology. Plant lipid metabolism and stress response are regulated by multiple regulatory pathways. Transcription factors, namely TFs, are one of the important participants in this complex regulatory network. They coordinate and mediate multiple biological processes by regulating the expression of related target genes. Therefore, it is necessary to discover a coding gene from Perilla to encode factors that can regulate plant fatty acid and oil synthesis. Summary of the invention

[0003] To solve the above problems, the present invention provides a Perilla PfDof29 gene, a recombinant expression vector, a recombinant bacterium and applications for regulating the synthesis of plant fatty acids and oils, which are used to encode factors that can regulate the synthesis of plant fatty acids and oils.

[0004] The present invention is achieved through the following technical solutions:

[0005] A Perilla PfDof29 gene for regulating the synthesis of plant fatty acids and oils, wherein the nucleotide sequence of the Perilla PfDof29 gene is shown in SEQ ID NO.1.

[0006] A recombinant expression vector comprises the coding gene and a backbone plasmid connected to the coding gene.

[0007] Preferably, the backbone plasmid is pCAMBIA1303.

[0008] Preferably, the method for constructing the recombinant expression vector is to amplify the Perilla PfDof29 gene using a specific primer pair, recover the PCR product and connect it with the backbone plasmid pCAMBIA1303 to obtain the recombinant expression vector.

[0009] Preferably, the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.29 and SEQ ID NO.30.

[0010] A recombinant bacterium is obtained by transforming the recombinant expression vector into an engineered bacterium.

[0011] Preferably, the engineered bacteria is Agrobacterium tumefaciens GV3101.

[0012] The application of the Perilla PfDof29 gene, the recombinant expression vector or the recombinant bacteria in increasing the total oil content of plant leaves.

[0013] Preferably, the plant is tobacco.

[0014] Preferably, the total oil content of plant leaves is increased by mediating the key fatty acid gene PfFAD8 to regulate plant lipid biosynthesis.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention provides a perilla PfDof29 gene, and the nucleotide sequence of the perilla PfDof29 gene is shown in SEQ ID NO. 1. The present invention screens and identifies for the first time the perilla PfDof differential gene seed highly expressed gene PfDof29, uses molecular biological means to construct a plant overexpression vector, and analyzes the total oil content of the overexpressed tobacco through Agrobacterium-mediated tobacco genetic transformation, and further screens and identifies the fatty acid key gene PfFAD8 significantly related to the expression of the PfDof29 gene to study the regulation mechanism of transcription factors, and constructs a prey vector and a bait vector respectively, and verifies whether PfDof29 can directly bind to the AAAG element of the PfFAD8 gene promoter and whether it can regulate the biosynthesis of polyunsaturated fatty acids in perilla seeds through a yeast single hybridization test. The results showed that the Perilla PfDof29 gene can significantly increase the total oil content of tobacco plant leaves, and can specifically bind to the PfFAD8 promoter to mediate the molecular regulation mechanism of Perilla polyunsaturated fatty acids. The present invention lays a theoretical foundation for in-depth analysis of the oil biosynthesis function mediated by Perilla Dof transcription factor and its regulation mechanism, and provides excellent gene resources for increasing the oil yield and improving the quality of oil crops such as Perilla.

[0017] The present invention explores the regulatory effect of PfDofs transcription factor on the synthesis and accumulation of polyunsaturated fatty acids in Perilla from the genome, transcriptome and molecular biology levels, preliminarily clarifies the PfDof29-mediated oil synthesis regulation mechanism, and provides new ideas for further improving the content and quality of Perilla seed oil. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 Analysis of the spatiotemporal expression characteristics of the differentially expressed genes of Perilla frutescens PfDofs of the present invention;

[0020] Figure 1 In the figure, A is the relative expression of PfDof1; B is the relative expression of PfDof2; C is the relative expression of PfDof5; D is the relative expression of PfDof12; E is the relative expression of PfDof14; F is the relative expression of PfDof18; G is the relative expression of PfDof25; H is the relative expression of PfDof29; I is the relative expression of PfDof37; J is the relative expression of PfDof54; K is the relative expression of PfDof56;

[0021] Figure 2 For PCR amplification of the PfDof29 gene of the present invention, M: 2000 bp Marker; 1: PfDof29 gene;

[0022] Figure 3 This is the pCAMBIA1303-PfDof29 DH5αPCR bacterial test of the present invention, M: 2000II bp Marker; 1-5: positive monoclonal identification;

[0023] Figure 4 This is the double enzyme digestion verification of the pCAMBIA1303-PfDof29 vector of the present invention; in the figure, M: 15000bp Marker; 1: 1303 empty plasmid, 2: pCAMBIA1303-PfDof29 double enzyme digestion verification;

[0024] Figure 5 This is the tobacco genetic transformation process mediated by Agrobacterium of the present invention;

[0025] Figure 5 In the figure, A: tobacco leaves after infection; B: dedifferentiation and induction of callus; C: callus bud formation; D: rooting culture; E: growth culture; F: seedling hardening and transplanting;

[0026] Figure 6 To detect the genomic level and transcriptional level of tobacco genetic transformation of the present invention;

[0027] Figure 6In the figure, A is the detection of tobacco genetic transformation genome level; B is the detection of tobacco genetic transformation transcription level; M in A and B: 2000II bp Marker; 1: empty plasmid, 2: wild tobacco, 3-7: PfDof29-transformed tobacco lines;

[0028] Figure 7 The total oil content of the transgenic tobacco leaves of the present invention. In the figure, WT: wild tobacco; OE1, OE2 and OE3: PfDof29 transgenic strains; the difference is extremely significant, P < 0.05;

[0029] Figure 8 This is the correlation analysis between the fatty acid related genes of the present invention and the Perilla PfDofs transcription factor;

[0030] Fig. 9 For the PCR amplification of the PfFAD8 promoter of the present invention, M: 2000 bp Marker; 1: PfFAD8 promoter;

[0031] Fig.10 This is a self-activation verification of the perilla PfFAD8 bait vector of the present invention; the figure shows the growth of the positive control group pHIS2-p53+pGAD53m and the negative control group pHIS2-proPfFAD8+pGADT7 on the culture medium of 0mmol / L, 10mmol / L, 30mmol / L, 40mmol / L, 50mmol / L and 70mmol / L 3-AT respectively; the yeast cell dilution OD 600 The value is 0.2, and it is diluted 10 times, 100 times and 1000 times in sequence, that is, 10 0 , 10 -1 , 10 -2 , 10 -3 Gradient spot coating on defective medium;

[0032] Fig.11 It is a yeast single hybrid of the recombinant plasmid of the present invention; the figure shows the growth of the negative control group pHIS2-proPfFAD8+pGADT7, the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 and the positive control strain pHIS2-p53+pGAD53m on the culture medium of 50mmol / L 3-AT respectively;

[0033] Fig.12 For the PCR amplification of the PfFAD8 gene of the present invention, M: 2000 bp Marker; 1: PfFAD8;

[0034] Fig.13 This is the pYES2.0 vector map of the present invention;

[0035] Fig.14This is a double enzyme digestion verification diagram of pYES2.0-PfFAD8 of the present invention, in which M: 8000bp Marker; 1: pYES2.0 empty plasmid, 2: pYES2.0-PfFAD8 double enzyme digestion verification;

[0036] Fig.15 This is the PCR bacterial test of wild yeast INVSc1 transformed with pYES2.0-PfFAD8 of the present invention, M: 2000II bpMarker; 1-5: positive single clone identification;

[0037] Fig.16 is the total lipid content of the transgenic yeast of the present invention; WT: wild Saccharomyces cerevisiae INVSc1; EV: pYES2.0 empty vector; OE1-OE3: three technical replicates of transgenic yeast;

[0038] Fig.17 This is the oil droplet observation of the PfFAD8 transgenic yeast pYES2.0-PfFAD8 and the wild-type yeast INVSc1 of the present invention; DIC, Biodipy and Merge are three different observation channels for oil droplet staining, DIC is bright field, Biodipy is dark field, and Merge is superposition. DETAILED DESCRIPTION

[0039] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0041] The inventive concept of the present invention is as follows:

[0042] Transcription factors, or TFs, are one of the important players involved in this complex regulatory network, which coordinates and mediates multiple biological processes by regulating the expression of related target genes. Therefore, it is necessary to discover a gene encoding a factor that can regulate the synthesis of plant fatty acids and oils from Perilla.

[0043] Based on this, the first aspect of the present invention provides a Perilla PfDof29 gene, the nucleotide sequence of the Perilla PfDof29 gene is shown in SEQ ID NO.1.

[0044] The second aspect of the present invention provides a recombinant expression vector, the encoding gene in the recombinant expression vector and a backbone plasmid connected to the encoding gene.

[0045] The third aspect of the present invention provides a recombinant bacterium, wherein the recombinant bacterium is obtained by transforming the recombinant expression vector according to claim 2 into an engineered bacterium.

[0046] The perilla PfDof29 gene, recombinant expression vector and recombinant bacteria can increase the total oil content of plant leaves.

[0047] The present invention screened and identified for the first time the gene PfDof29 highly expressed in the seeds of the perilla PfDof differential gene, used molecular biological methods to construct a plant overexpression vector, and analyzed the total oil content of the overexpressed tobacco through Agrobacterium-mediated tobacco genetic transformation. In order to study the regulatory mechanism of transcription factors, the key fatty acid gene PfFAD8 significantly related to the expression of the PfDof29 gene was further screened and identified, and the prey vector and the bait vector were constructed respectively. The yeast single hybridization test was used to verify whether PfDof29 could directly bind to the AAAG element of the PfFAD8 gene promoter and whether it could regulate the biosynthesis of polyunsaturated fatty acids in perilla seeds. The results show that the perilla PfDof29 gene can significantly increase the total oil content of tobacco plant leaves, and can specifically bind to the PfFAD8 promoter to mediate the molecular regulatory mechanism of perilla polyunsaturated fatty acids. The present invention lays a theoretical foundation for in-depth analysis of the oil biosynthesis function and its regulatory mechanism mediated by the perilla Dof transcription factor, and provides excellent gene resources for improving the oil yield and quality of oil crops such as perilla.

[0048] The nucleotide sequence of the Perilla PfDof29 gene is shown in SEQ ID NO.1, which is:

[0049]

[0050] The nucleotide sequence of the PfFAD8 gene is shown in SEQ ID NO.2:

[0051]

[0052] The technical solution of the present invention will be further described below in conjunction with specific embodiments.

[0053] Example 1: Analysis of spatiotemporal expression characteristics of PfDofs differentially expressed genes in Perilla frutescens and cloning of PfDof29 gene in Perilla frutescens

[0054] 1. Extraction of total RNA: Use EASYspin Plant RNA Rapid Extraction Kit to extract total RNA from seeds 10d, 20d, 30d, and 40d after flowering. Use ultra-micro nucleic acid analyzer to detect RNA concentration and purity. Use 1% agarose gel electrophoresis to detect RNA integrity.

[0055] 2. Synthesis of cDNA: Using the RNA of perilla seeds at different stages as template, 5×All-In-OneMasterMix reverse transcription kit was used to obtain cDNA by reverse transcription according to the kit instructions.

[0056] 3. Design primers: Primer information is shown in Table 1.

[0057] Table 1 PfDofs differential gene quantitative primer information

[0058]

[0059]

[0060] 4. Analysis of spatiotemporal expression characteristics of 11 differentially expressed genes

[0061] PCR reaction: The amplification system is shown in Table 2.

[0062] Table 2 PCR amplification system

[0063]

[0064] The reaction procedure was 94°C for 30 s; 94°C for 5 s, 60°C for 15 s, 72°C for 10 s, 2 to 4 steps for 45 cycles. -ΔΔCT The relative expression level of PfDofs gene in different tissues and seeds of Perilla at different stages was calculated by this method.

[0065] 5. Cloning of Perilla PfDof29 Gene

[0066] The full-length primer sequences are shown in Table 3.

[0067] Table 3 Full-length primer information

[0068] Primer name Primer sequence, 5'-3' SEQ ID NO.27: ORF-PfDof29-F ATGAAGGAAGCCAAGGAGCC SEQ ID NO.28: ORF-PfDof29-R CTAGGCACCCTCTTGAAAGGTAAT

[0069] PCR reaction: The amplification system is shown in Table 4.

[0070] Table 4 PCR amplification system

[0071]

[0072] PCR program: 98°C, 1 min; 98°C, 10 s; 60°C, 5 s; 72°C, 8 s; 2 to 4 steps, 30 cycles; 72°C, 1 min.

[0073] 6. Recovery and purification of target fragments

[0074] After the PCR reaction, the PfDof29 amplification product was detected by gel electrophoresis, and the correct target band was cut and recovered and stored at -20°C for subsequent experiments.

[0075] 7. Vector Construction

[0076] 7.1 Double enzyme digestion

[0077] BamHI and Kpn I restriction endonucleases were used to double digest the pCAMBIA1303 empty plasmid, and the reaction program was: 37°C for 30 min, 4 cycles; 85°C for 20 min. The primer information is shown in Table 5.

[0078] The restriction enzyme system used for constructing the pCAMBIA1303 expression vector is shown in Table 6:

[0079] Table 5 Primer information

[0080] Primer name Primer sequence, 5'-3' SEQ ID NO.29:1303-PfDof29-F CAGGTCGACTCTAGAGGATCCATGAAGGAAGCCAAGGAGCC SEQ ID NO.30:1303-PfDof29-R GGTTTAAACGAGCTCGGTACCCTAGGCACCCTCTTGAAAGGTAAT

[0081] Table 6 Enzyme digestion system

[0082] 10×NEBBuffer 5μL B H 1μL KqI 1μL pCAMBIA1303 empty plasmid 10μL <![CDATA[ddH2O]]> Make up to 50 μL

[0083] 7.2 Reorganization

[0084] The enzyme cleavage product was detected by agarose gel electrophoresis, and the band was purified and recovered, and prepared according to the system shown in Table 7, and reacted in a metal bath at 50°C for 10 minutes.

[0085] Table 7 Preparation system

[0086] 10×T4 Ligase Buffer 5μL Enzyme-cut vector fragment 3μL Enzyme digestion of target gene fragment 1μL <![CDATA[ddH2O]]> Make up to 10 μL

[0087] 8 Colon transformation

[0088] 8.1 Preparation and transformation of competent E. coli

[0089] The activated E. coli DH5α bacterial suspension was inoculated into 50 mL of LB liquid medium (without antibiotics) and cultured at 37°C overnight with shaking until the OD 600=0.4, pour the bacterial solution into a 50ml centrifuge tube in a clean bench and quickly place it on ice for 30 minutes, centrifuge at 5000rpm for 8 minutes, discard the supernatant as much as possible, add 10mL of pre-cooled 0.1M CaCl2 solution, mix gently and centrifuge to remove the supernatant, then add 2mL of 0.1M CaCl2 solution containing 15% volume fraction of glycerol to the plaque to resuspend the bacterial solution, and distribute it into 1.5ml sterile centrifuge tubes per 100μL competent cells, and store at -80℃ for later use.

[0090] Add 10 μL of recombinant culture to the thawed competent E. coli cells on ice, mix gently, place on ice for 30 minutes, then quickly place the centrifuge tube in a 42°C metal bath for 90 seconds, and then place on ice for 5 minutes. Add 800 μL of LB medium (without antibiotics) to the competent cells, and culture at 37°C, 200 rpm for 45 minutes. Use a pipette to evenly spread 20 μL of bacterial solution on an LB solid screening plate containing 50 μg / mL kanamycin, and culture at 37°C in the dark for 12 hours until a single clone appears.

[0091] 8.2 Positive monoclonal screening

[0092] A single colony was picked from the LB solid screening plate with a 1μ sterile pipette tip and inoculated into 800μL LB medium containing 50μg / mL kanamycin, and cultured with shaking for about 6h until the bacterial solution became turbid. The bacterial solution was tested by PCR, and the primers used were shown in Table 5. The PCR program was 94℃, 3min; 94℃, 30s, 60℃, 30s, 72℃, 90s, 30cycles; 72℃, 5min.

[0093] Part of the positive bacterial solution was sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing, and part of it was stored for subsequent experiments.

[0094] 9. Results and Analysis

[0095] Using the total cDNA mixed samples of seeds 10d, 20d, 30d, and 40d after flowering as templates, the temporal and spatial expression characteristics of PfDofs differential genes in Perilla frutescens showed that the PfDof29 gene was expressed most highly in the early and middle stages of different seed developmental periods, and 11 differential genes were expressed most highly in different stages of seeds, such as Figure 1 As shown, it is speculated that it may regulate seed oil biosynthesis. The full-length primer amplified a band of about 1338 bp in length, as shown in Figure 2 The recombinant product was transformed into E. coli, and single clones were obtained by kanamycin screening. Positive clones were identified by PCR. Figure 3The bacterial solution was sent to the company for sequencing, and the results showed that it was consistent with the ORF sequence of the Perilla PfDof29 gene, with only two base mutations and no changes in the protein sequence, confirming that the cloning was successful.

[0096] Example 2: Construction of Perilla PfDof29 Genome Expression Vector and Genetic Transformation of Tobacco

[0097] 1. Construction of plant recombinant expression vector

[0098] The Agrobacterium tumefaciens GV3101 strain and pCAMBIA1303 empty plasmid used in the present invention are stored in the Institute of Molecular Agriculture and Bioenergy of Shanxi Agricultural University.

[0099] 2. Preparation of competent cells of Agrobacterium, transformation of Agrobacterium and identification of positive strains

[0100] 2.1 Preparation of competent Agrobacterium tumefaciens GV3101

[0101] Inoculate Agrobacterium tumefaciens GV3101 strain in 50 mL LB medium (containing 50 μg / mL rifampicin), inoculate a new bottle of 50 mL LB medium (containing 50 μg / mL rifampicin) after activation, and culture in the dark at 28°C in a shaking incubator until OD 600 The cell was collected by centrifugation in 50 mL sterile centrifuge tubes at a concentration of 0.4, and the supernatant was discarded. The precipitate was resuspended with 10 mL of pre-cooled NaCl (0.15 mol / L) and centrifuged again. The supernatant was discarded. The precipitate was resuspended with 10 mL of CaCl2 (20 mM) containing 15% glycerol by volume. The competent cells were divided into 200 μL per tube and stored in a -80 ℃ refrigerator for later use.

[0102] 2.2 Freeze-thaw transformation of Agrobacterium

[0103] Take 5 μL of pCAMBIA1303-PfDof29 recombinant plasmid and add it to 200 μL competent cells melted on ice, put it in an ice bath for 5 minutes, freeze it in liquid nitrogen for 5 minutes, and then quickly transfer it to a 37°C metal bath for heat shock for 5 minutes. After cooling to room temperature, add 800 μL of LB liquid culture medium (without antibiotics), shake and culture at 28°C and 175 rpm for 4 hours, draw 30 μL and apply it to a solid LB screening plate (containing 50 μg / mL rifampicin and 50 μg / mL kanamycin), and culture it in a 28°C incubator for 48 hours.

[0104] 2.3 Screening of positive transformants

[0105] A single clone was picked and inoculated into 1 mL of LB medium (containing 50 μg / mL rifampicin and 50 μg / mL kanamycin), cultured overnight at 28°C and 200 rpm, and a positive PCR test was performed on the bacterial solution. The detection primers are shown in Table 5, and the PCR detection operation is referred to Example 1. The bacteria were stored in 50% glycerol for subsequent experiments.

[0106] 3. Genetic transformation of tobacco

[0107] 3.1 Agrobacterium-mediated genetic transformation of tobacco

[0108] GV3101 Agrobacterium carrying the recombinant plasmid pCAMBIA1303-PfDof29 was inoculated into LB liquid medium (50 μg / mL rifampicin, 50 μg / mL kanamycin) and cultured overnight at 28°C with shaking until the bacterial liquid (OD 600 ≈0.6). Pour all the bacterial solution into a 50mL sterile centrifuge tube, centrifuge at 5000rpm for 8min, discard the supernatant and collect the bacteria, and resuspend the bacterial plaque in 50mL MS liquid culture medium. Select the leaves of 6-week-old tobacco sterile seedlings with good growth, remove the main veins and leaf edges in a clean bench under a sterile environment, and cut into about 0.5cm 2 The leaves of different sizes were spread on the pre-culture medium (MS, 3% sucrose, 0.75% agar, 1 mg / L 6-BA, 0.1 mg / L NAA, pH = 5.8) for 72 hours. After the pre-culture, the leaves were immersed in the Agrobacterium solution for 8 minutes, washed with sterile water for 1 minute, and the surface moisture of the leaves was absorbed with sterile filter paper. The leaves were spread on the MS pre-culture medium with the front side facing up, and incubated for 48 hours in the dark with tin foil. The leaves were transferred to a screening medium for culture (MS, 3% sucrose by mass, 0.75% agar by mass, 1 mg / L 6-BA, 0.1 mg / L NAA, pH=5.8, 500 mg / L Cef, 5 mg / L Hyg), and the screening medium was changed irregularly until callus tissue was differentiated at the edge of the leaves and grew into young shoots. The young shoots were transferred to a rooting medium (1 / 2 MS, 3% sucrose by mass, 0.75% agar by mass, pH=5.8, 500 mg / LCef), and a well-developed root system was grown therefrom. The seedlings were then transferred to nutrient soil for culture.

[0109] 3.2 Identification of transgenic tobacco at the genomic and transcriptional levels

[0110] Take the transgenic tobacco leaves, quickly place them in liquid nitrogen, extract tobacco leaf DNA by CTAB method, use DNA as amplification template, full-length primers, as shown in Table 5, perform PCR amplification, and detect the target band by 1% agarose gel electrophoresis to detect whether the target gene has been transferred into tobacco. From the plants with successful DNA detection, extract RNA from leaves again, reverse transcribe into cDNA, and use RT-PCR to evaluate whether the target gene is effectively expressed at the transcription level. Refer to Example 1 for PCR system and procedure.

[0111] 3.3 Determination of total oil content in transgenic tobacco

[0112] Take the leaves of the successfully identified transgenic tobacco plants, freeze-dry them and grind them into powder. Weigh 50 mg of the freeze-dried tobacco powder and place it in a 50 mL centrifuge tube. Add 7.5 mL of a mixture of V methanol: V chloroform = 2:1 to it. Extract at 37°C 200rpm for 24 hours and then centrifuge to collect the upper organic phase into a new centrifuge tube. Add 7.5 mL of a mixture of V methanol: V chloroform = 2:1 to the precipitate again. Repeat the extraction for 12 hours and collect the upper organic phase. Mix the upper organic phases collected twice and add 5 mL of chloroform solution and 9 mL of 1% NaCl solution by volume. Mix thoroughly to make V chloroform: V methanol: V water = 2:2:1.8. Centrifuge and collect the lower organic phase into a clean, weighed empty glass finger tube (m0). Put it in an oven to dry the organic reagent, and the oil will remain on the wall of the finger tube, and weigh it again (m1). Yeast total fatty acid content = (m1-m0) / 0.05. Each sample was repeated 3 times.

[0113] 4. Results and Analysis

[0114] 4.1 As Figure 4 As shown, the pCAMBIA1303-PfDof29 recombinant plasmid was double-digested with BamHI and KpnI. According to the position of the Marker, the length of the vector fragment after double digestion is roughly more than 12000bp, and the length of the target gene fragment is between 1338bp, which is consistent with the expected result. Therefore, it is considered that the plant expression vector containing the target gene is successfully constructed.

[0115] The plasmid that was successfully verified by double enzyme digestion was sent to the company for sequencing and comparison. The analysis results showed that the sequence was correct, with only 2 base mutations and no changes in the protein sequence, proving that the Perilla PfDof29 gene had been successfully connected to the pCAMBIA1303 vector and the recombinant vector was successfully constructed.

[0116] 4.2 The single clone cultured from the screening plate of transformed Agrobacterium was cultured. After PCR verification, gel electrophoresis showed that the position of the band was consistent with the expected position, indicating that the Agrobacterium transformation was successful.

[0117] 4.3 Genetic transformation of tobacco was performed using the Agrobacterium-mediated leaf disc method, with hygromycin as a selection marker, such as Figure 5 As shown in Figure 2, the PfDof29 gene was transferred into tobacco, and the expression of the target gene was detected by electrophoresis at the genome level and transcription level. The results are as follows Figure 6 As shown, the electrophoresis band is consistent with the length of the target gene, indicating that the target gene has been successfully expressed in tobacco.

[0118] 4.4 Take the transgenic tobacco leaves, freeze-dry them in vacuum, grind them into powder, and extract the total oil content. Figure 7 As shown, compared with wild tobacco leaves, the total lipid content of tobacco leaves transformed with the PfDof29 gene increased significantly, by 5.15% to 5.46%, indicating that the expression of the Perilla PfDof29 gene promoted the accumulation of total oil content in tobacco leaves.

[0119] Example 3: YIH reveals that the PfDof29 gene can specifically bind to the PfFAD8 gene promoter

[0120] 1. Correlation analysis between PfDof29 transcription factor and key genes for oil accumulation

[0121] The fatty acid desaturase genes FAD6 and FAD8, the biotin carboxylase carrier protein gene BCCP1, and the stearoyl-ACP desaturase genes FAB2 and SAD2, which may be regulated by the PfDof29 transcription factor, were selected. The promoter sequences of these genes are shown in Table 8. The correlation between the expression of downstream fatty acid genes in Perilla frutescens and the expression of the highly expressed PfDofs transcription factor in seeds was analyzed using the Kidio online software. Figure 8 shown.

[0122] Table 8 Downstream gene promoter sequence

[0123]

[0124]

[0125] 2. Construction of bait vector and prey vector

[0126] 2.1 Sequence analysis of the promoter of Perilla frutescens PfFAD8

[0127] The PfFAD8 promoter sequence was obtained from the Perilla genome database, and the promoter cis-acting elements were predicted in Plant CARE.

[0128] 2.2 Construction of prey vector and bait vector

[0129] Design full-length primers pGADT7-PfDof29-F and pGADT7-PfDof29-R; PfFAD8 promoter primers pHIS2-proPfFAD8-F and pHIS2-proPfFAD8-R, see Table 9; double-digest the prey vector pGADT7 with restriction endonucleases Xma I and BamHI, and double-digest the bait vector pHIS2 with EcoR I and Sac I. Connect PfDof29 to the prey vector pGADT7 by homologous cloning, and the construction method of the recombinant vector is shown in Example 1. The promoter sequence of the PfFAD8 gene containing the AAAG element was amplified from the perilla seed DNA as shown in Fig. 9 As shown, the bait vector pHIS2-proPfFAD8 was constructed by connecting it to the pHIS2 vector through recombination transformation.

[0130] Table 9 Primer sequences

[0131]

[0132] 2.3 Yeast one-hybrid

[0133] The pHIS2-P53 and pGAD53m plasmids were co-transformed into Y187 yeast competent cells as the positive group of the study. The bait vector pHIS2-proPfFAD8 was co-transformed with the empty vector pGADT7 and the prey vector pGADT7-PfDof29 into Y187 yeast competent cells, respectively, and spread on SD / -Leu / -Trp dual-deficient medium. The cells were cultured in the dark at 30°C for 2 days, and single clones were picked for propagation. The successfully transformed negative control pHIS2-proPfFAD8+pGADT7 strain and the positive control pHIS2-p53+pGAD53m strain were diluted and resuspended to OD 600 = 0.2, press 10 0 , 10 -1 , 10 -2 , 10 -3The concentrations of 0mmol / L, 10mmol / L, 30mmol / L, 40mmol / L, 50mmol / L and 70mmol / L 3-AT were spotted on SD / -Trp / -Leu / -His triple-deficient culture medium, respectively. After incubation at 30℃ in the dark for 3 days to screen the optimal self-activation concentration, the negative control group pHIS2-proPfFAD8+pGADT7 and the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 and pHIS2-p53+pGAD53m positive control after successful transformation were diluted and spotted on the 3-AT SD / -His / -Leu / -Trp triple-deficient solid culture medium screened for self-activation, and incubated at 30℃ in the dark for 3 days.

[0134] 3. Results and analysis

[0135] Downstream genes whose promoters contain AAAG elements were screened and identified from the Perilla genome, as shown in Table 8. Analysis of their promoters revealed that they contain multiple AAAG elements. We further speculated whether they are regulated by the PfDof transcription factor. We analyzed the correlation between these five genes and the PfDof transcription factor highly expressed during seed development. The results are shown in Table 8. Figure 8 As shown, PfFAB2 is positively correlated with multiple transcription factors, and is more significantly positively correlated with PfDof5 and PfDof12. PfFAD8 is significantly correlated with PfDof29, PfFAD6 is more significantly positively correlated with PfDof12, PfBCCP1 is more significantly negatively correlated with PfDof2, and PfSAD2 is more significantly positively correlated with PfDof12 and PfDof14. The present invention selects PfDof29, the transcription factor with the highest expression level in seeds, as the research target, and speculates that the PfFAD8 gene is regulated by the transcription factor PfDof29. The results of bait vector self-activation are shown in Figure 2. Fig.10 As shown, the strains can grow normally on the culture medium with 0mmol / L, 10mmol / L, 30mmol / L, and 40mmol / L 3-AT. The positive control can grow normally on the culture medium with 50mmol / L 3-AT, and the growth of the negative control pHIS2-proPfFAD8+pGADT7 is inhibited. 50mmol / L 3-AT is used as the optimal concentration for self-activation of yeast bait carriers. The negative control group pHIS2-proPfFAD8+pGADT7, the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29, and the positive control pHIS2-p53+pGAD53m after successful transformation were diluted into concentration gradients and spotted on 50mmol / L 3-AT-deficient SD / -His / -Leu / -Trp solid culture medium. The results are shown in Fig.11As shown, the positive strain can grow normally, the growth of the negative control pHIS2-proPfFAD8+pGADT7 is inhibited, and the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 can grow normally, indicating that PfDof29 can bind to the promoter AAAG element of PfFAD8, thereby interacting with the PfFAD8 gene and regulating the lipid biosynthesis of Perilla seeds.

[0136] Example 4

[0137] 1. Construction of pYES2.0-PfFAD8 yeast heterologous expression vector

[0138] According to the coding sequence (CDS) of the Perilla PfFAD8 gene, the nucleotide sequence of the Perilla PfFAD8 gene is shown in SEQ ID NO.2, and the primer information is shown in Table 10. A high-fidelity enzyme is used for PCR amplification. The amplification procedure and system refer to Example 1. The specificity of the amplification and the size of the target fragment are verified by electrophoresis analysis of 1% agarose gel. The target DNA fragment is recovered by gel cutting after electrophoresis and purified. The purification process uses EasyPure PCR Purification Kit to ensure the purity and stability of the DNA fragment. The purified fragment is stored at -20°C for subsequent experiments. Double enzyme digestion of pYES2.0 is performed using restriction endonucleases Sac I and Xba I. The PfFAD8 fragment is connected to the corresponding pYES2.0 linearized vector, and the enzyme connection system and Escherichia coli transformation (LB solid screening plate resistance: ampicillin) steps refer to Example 1. The positive Escherichia coli detected by PCR is sequenced and treated for bacteria preservation for subsequent experiments.

[0139] Table 10 Primer information

[0140] Primer name Primer sequence, 5'-3' SEQ ID NO.35: pYES2.0-PfFAD8-F attaagcttggtaccgagctcATGGCGAGTTGGGTGTTATCA SEQ ID NO.36: pYES2.0-PfFAD8-R tacatgatgcggccctctagaTCAATTCAGCTCAGGATCGGTC

[0141] 2. Preparation and transformation of competent yeast

[0142] 2.1 Cultivation of yeast strains

[0143] INVSc1 Saccharomyces cerevisiae is an ideal protein expression strain with resistance to ampicillin and kanamycin, and grows best at 30°C in YPD medium. INVSc1 Saccharomyces cerevisiae is a His, Leu, Trp and Ura auxotrophic strain, so it cannot grow in defective medium lacking histidine, leucine, tryptophan and uracil. The pYES2.0 vector is ampicillin resistant and contains the URA3 site, which allows it to grow on a medium lacking uracil. Therefore, positive transformants can be screened using a medium lacking uracil (SC-URA) supplemented with kanamycin.

[0144] 2.2 Preparation and transformation of competent yeast

[0145] The yeast competent state preparation was carried out according to the yeast transformation kit. The transformation method is as follows: prepare the premix (Y3350μL; recombinant plasmid 1000 / ng; ddH2O supplemented to 360μL), mix thoroughly with the pipette tip, then add to the competent cells, and repeatedly suspend the competent cells. Heat shock at 30℃ in a metal bath for 1h, mix once every 10min, centrifuge at 13000rpm for 1min, discard the supernatant, and resuscitate the competent state with YPD plus medium. Shake and culture at 30℃ for 1h, centrifuge at 13000rpm for 1min, centrifuge the reaction solution to remove the supernatant, add 200μL of sterile deionized water to the precipitate, mix well, and then draw 20μL to apply on SC-URA solid medium (containing 2% glucose by volume) containing kanamycin (50μg / mL), and invert and culture at 30℃ for 2 days.

[0146] 2.3 Positive identification of recombinant yeast

[0147] Single colonies grown on the SC-URA screening plate cultured for 2 days were picked and placed in 5 mL SC-URA liquid culture medium (containing 2% glucose and 50 μg / mL kanamycin by volume), and cultured at 30°C with shaking until the bacterial solution became turbid. PCR detection was performed using the homology arm primers in Table 10 to identify the positive recombinant bacterial solution.

[0148] Before testing yeast, the cell wall needs to be broken. Pipette the bacterial solution into 1.5 mL, centrifuge at 13000 rpm for 1 min, remove the supernatant, add 500 μL ddH2O and centrifuge again to collect the cells. Centrifuge at 13000 rpm for 1 min and discard the supernatant. Add 200 μL TE buffer to the precipitate, place in a metal bath at 100°C, react for 10 min, ice bath for 10 min, centrifuge at 13000 rpm for 10 min, and collect the supernatant for PCR detection.

[0149] 2.4 Inducible expression of transgenic yeast

[0150] Take 50 μL of the positive monoclonal strain and inoculate it into SC-URA medium containing 2% galactose and 50 μg / mL kanamycin, and culture it at 30°C and 200 rpm on a shaker for 48 h until OD 600 =1.0. After centrifugation (5000 rpm, 8 min), the supernatant was discarded, the bacterial precipitate was washed twice with sterile deionized water, and the yeast cells were collected. After vacuum drying and freezing, they were ground into powder and stored in a centrifuge tube at room temperature for later use.

[0151] 2.5 Total lipid content and oil droplet staining observation of transgenic yeast

[0152] The transgenic yeast cells after induced expression were cultured at 30°C and 200 rpm in a shaking incubator for 48 h and resuspended in sterile water to OD 600 =0.2, draw 200 μL of bacterial solution, add 200 μL of BODIPY 505 / 515 working solution, and stain for 30 minutes in the dark. Draw 20 μL of the stained bacterial solution under dim light conditions to prepare slides, and use a laser confocal microscope to observe the number and size of oil droplets in yeast cells. Weigh 50 mg of freeze-dried transgenic yeast powder to extract its total oil content, and determine the total oil content of transgenic yeast, method example 2.

[0153] 3. Results and analysis

[0154] 3.1 The cloned target fragment PfFAD8 was Fig.12 As shown, with pYES2.0 vector, such as Fig.13 The clones were connected as shown, selected by ampicillin and tested positive by PCR. Fig.14 The pYES2.0-PfFAD8 recombinant plasmid was double-digested with Sac I and Xba I to verify the results. According to the Marker, it can be roughly judged that the vector fragment length is between 5000bp and 6000bp, and the target gene fragment length is about 1317bp, which is consistent with the expected result. Therefore, it is basically determined that the yeast recombinant vector containing the PfFAD8 gene is successfully constructed. The constructed vector was sent to a sequencing company for sequencing, and the results showed that there was no base mutation, proving that the PfFAD8 gene was successfully cloned.

[0155] 3.2 The constructed pYES2.0-PfFAD8 recombinant plasmid was transformed into INVSc1 Saccharomyces cerevisiae. The PCR test results were as follows: Fig.15 As shown, gel electrophoresis showed that the yeast detection band of the pYES2.0-PfFAD8 recombinant vector was around 1317 bp, and the bands obtained by electrophoresis were consistent with the expected length, indicating that the pYES2.0-PfFAD8 recombinant plasmid had been successfully transferred into the INVSc1 yeast.

[0156] 3.3 Weigh 50 mg of freeze-dried transgenic yeast powder and extract the total oil content. Fig.16 As shown in Figure 2, compared with wild Saccharomyces cerevisiae, the total lipid content of yeast transformed with the PfFAD8 gene increased significantly, by 1.94% to 2.12%, and the number of oil droplets increased significantly, as shown in Figure 2. Fig.17 As shown, it indicates that the Perilla PfFAD8 gene can significantly improve the yeast's ability to synthesize lipids.

[0157] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0158] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A Perilla PfDof29 gene for regulating plant fatty acid and oil synthesis, characterized in that: The nucleotide sequence of the Perilla PfDof29 gene is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the coding gene according to claim 1 and a backbone plasmid connected to the coding gene.

3. The recombinant expression vector according to claim 2, characterized in that: The backbone plasmid is pCAMBIA1303.

4. The recombinant expression vector according to claim 2, characterized in that: The method for constructing the recombinant expression vector is to use a specific primer pair to amplify the Perilla PfDof29 gene, recover the PCR product and connect it with the backbone plasmid pCAMBIA1303 to obtain the recombinant expression vector.

5. The recombinant expression vector according to claim 4, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.29 and SEQ ID NO.

30.

6. A recombinant bacterium, characterized in that: The recombinant bacteria are obtained by transforming the recombinant expression vector described in claim 2 into engineered bacteria.

7. The recombinant bacterium according to claim 6, characterized in that The engineered bacteria is Agrobacterium tumefaciens GV3101.

8. Use of the Perilla PfDof29 gene for regulating plant fatty acid and oil synthesis as claimed in claim 1, the recombinant expression vector as claimed in claim 2 or the recombinant bacteria as claimed in claim 6 in increasing the total oil content of plant leaves.

9. The use according to claim 8, characterized in that The plant is tobacco.

10. The use according to claim 8, characterized in that The total oil content of plant leaves is increased by regulating plant lipid biosynthesis through mediating the key fatty acid gene PfFAD8.

Images