Genetic transformation method of agrobacterium tumefaciens-mediated saccharomyces cerevisiae spores of tremella auramtialba

Abstract

The invention belongs to the technical field of bioengineering, and relates to a genetic transformation method of agrobacterium tumefaciens-mediated tremella auramtialba yeast spores. The method comprises the following steps: activating a tremella aurantialba spore strain by using a YMG liquid culture medium, then centrifugally collecting, and determining that a transformant is screened by using hygromycin with the final concentration of 5g / mL; monoclone of agrobacterium AGL1 containing transformed plasmids is selected and inoculated into an LB liquid culture medium to be activated, and agrobacterium infection liquid is obtained after toxicity induction; activated spores are collected and pre-cultured with an IM liquid culture medium, and tremella aurantialba spore liquid is obtained; uniformly mixing the agrobacterium infection solution and the tremella aurantialba spore solution, pretreating, and coating on an IM plate for co-culture; flushing the co-culture plate, collecting and mixing flushing fluid, coating the flushing fluid on a YMG screening plate, and screening out transformants. According to the invention, the agrobacterium tumefaciens-mediated tremella auramtialba genetic transformation system is established by taking the tremella auramtialba spore yeast as a receptor material for the first time, and the problem of lack of a genetic transformation method in molecular biology research of the tremella auramtialba is solved.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a genetic transformation method of yeast-like spores of Auricularia australis mediated by Agrobacterium. Background Art

[0002] Golden ear belongs to the large fungus of the phylum Basidiomycetes. Its fruiting body is composed of Golden ear fungus ( Naematelia aurantialba ) and Lederma lucidum ( Stereum hirsutum ) formed a heterogeneous complex, usually orange or yellow colloid. Tremella fuciformis fruiting bodies are rich in Tremella fuciformis polysaccharides, and a large number of studies have confirmed that the polysaccharide has strong biological and pharmacological functions. The significant medicinal and nutritional value of Tremella fuciformis polysaccharides give it huge market development potential. At present, there are reports on factory cultivation of Tremella fuciformis in China. In recent years, with the rapid development of the edible fungus industry worldwide, it has also brought about many scientific problems in breeding, such as strain degeneration. The development of strains based on traditional breeding methods is not only long-term, inefficient and unpredictable, but can no longer meet the demand of the edible fungus market for high-yield and high-quality varieties; however, the use of emerging modern molecular biology technologies such as RNA interference and gene editing can not only quickly, efficiently and accurately improve genetic traits, but also effectively overcome the disadvantages of traditional breeding methods, providing new solutions for edible fungus breeding.

[0003] Genetic transformation methods are an important prerequisite for the targeted improvement of agronomic traits of varieties through molecular breeding. At present, the reported genetic transformation of edible fungi mainly includes Agrobacterium-mediated method, polyethylene glycol-mediated method, liposome-mediated method and electroporation transformation method; the receptor materials used are mainly hyphae, fruiting body tissues and protoplasts. As a dimorphic fungus with yeast and hyphae states, the yeast-like spores of A. auriculariae can be quickly obtained by basidiospore budding, but the conditions for hyphae formation are relatively special and difficult to collect. At the same time, the existing research reports on A. auriculariae mostly focus on the analysis of its physiological functions, and due to the lack of effective genetic transformation methods, there is almost no exploration at the molecular level. Therefore, establishing a genetic transformation operation method based on A. auriculariae yeast-like spores can not only provide technical support for the molecular biology research of A. auriculariae, but also clarify whether the yeast-like spores can be used as an ideal receptor material.

[0004] References can be found at: [1] YANG Y, DONG C. Fruiting Body Heterogeneity, Dimorphism andHaustorium-like Structure of Naematelia aurantialba (Jin Er Mushroom) [J].Journal of fungi (Basel, Switzerland), 2024, 10(8). [2] YAN Y, WANG M, CHEN N, et al. Isolation, structures,bioactivities, application and future prospective for polysaccharides fromTremella aurantialba: A review [J]. Frontiers in immunology, 2022, 13:1091210. [3] YANG Y, LIU Q, ZHANG Z, et al. First Report of Bacterial BrownRot Disease Caused by Ewingella americana on Cultivated Naemateliaaurantialba in China [J]. Plant disease, 2023. [4] PéREZ G, LOPEZ-MOYA F, CHUINA E, et al. Strain Degeneration inPleurotus ostreatus: A Genotype Dependent Oxidative Stress Process WhichTriggers Oxidative Stress, Cellular Detoxifying and Cell Wall Reshaping Genes[J]. Journal of fungi (Basel, Switzerland), 2021, 7(10). [5] WANG F, LI F, HAN L, et al. High-Yield-Related Genes Participatein Mushroom Production [J]. Journal of fungi (Basel, Switzerland), 2024, 10(11). [6] LI W, ZOU G, BAO D, et al. Current Advances in the FunctionalGenes of Edible and Medicinal Fungi: Research Techniques, FunctionalAnalysis, and Prospects [J]. Journal of fungi (Basel, Switzerland), 2024, 10(5). Summary of the invention

[0005] The purpose of the present invention is to provide a method for genetic transformation of yeast-like spores of golden ear fungus mediated by Agrobacterium. The method uses hygromycin resistance gene as a screening marker for the first time, and golden ear yeast-like spores as a receptor material to achieve the establishment of its genetic transformation method, confirming that golden ear yeast-like spores can be applied to genetic manipulation, providing strong technical support for the mining and research of golden ear functional genes, and also laying a molecular level operation foundation for the improvement and development of agronomic traits of golden ear varieties.

[0006] In order to achieve the above purpose, the technical solution adopted by the present invention is as follows: A method for genetic transformation of yeast-like spores of Auricularia auricularia mediated by Agrobacterium, comprising the following steps: (1) Pick the Bacillus aurantii strain that was activated and cultured on a YMG plate at 23°C for 3 days, inoculate it into YMG liquid medium, and culture it in a shaking incubator at 25°C for 3 days. Take a sample, count it, and adjust the cell number to 1×10 7 / mL, with hygromycin resistance gene as selection marker, a final concentration of 5 µg / mL hygromycin was determined for transformant selection; (2) Pick a monoclonal colony of Agrobacterium tumefaciens AGL1 containing the transformation plasmid, inoculate it into LB liquid medium containing rifampicin and kanamycin, and culture it in a shaking incubator at 28°C for 24 h. Collect the Agrobacterium by centrifugation and induce virulence using IM liquid medium. Measure and adjust its absorbance OD 600 is 0.8, and the Agrobacterium infection solution is obtained; (3) After activating and collecting the Auricularia auricularia spores according to the method described in step (1), they were pre-cultured in IM liquid culture medium on a shaker at 25°C for 5 h, and samples were taken for counting and the cell number was adjusted to 1×10 7 / mL, and obtain the Auricularia auricularia spore solution; (4) The Agrobacterium infection solution obtained in step (2) and the A. auricularia spore solution obtained in step (3) are mixed at a volume ratio of 1:1, spread on an IM plate after pre-infection, and inverted in a 28°C constant temperature incubator in the dark for co-culture for 4 days to transfer the transformation plasmid into the yeast-like spores of A. auricularia spores; (5) Rinse the co-cultured IM plates with Tween 20, collect and mix the rinse fluid, and spread it on YMG selection plates containing 5 µg / mL hygromycin and 300 µg / mL cefotaxime to select transformants.

[0007] Furthermore, the Auricularia aurantifolia spore strain described in step (1) is a yeast-like budding spore formed by budding of basidiospores.

[0008] Furthermore, the composition of the YMG plate in step (1) is: 10 g / L glucose, 10 g / L malt extract, 4 g / L yeast extract, and 20 g / L agar. The composition of the YMG liquid culture medium is: 10 g / L glucose, 10 g / L malt extract, and 4 g / L yeast extract.

[0009] Furthermore, the composition of the IM liquid culture medium in step (2) is: K2HPO4 2 g / L, KH2PO4 1.45 g / L, NaCl 0.3 g / L, MgSO4·7H2O 0.6 g / L, CaCl2·2H2O 0.01 g / L, FeSO4·7H2O 0.001 g / L, (NH4)2SO4 0.5 g / L, glucose 2 g / L, glycerol 5 mL / L, acetosyringone 0.039 g / L, 2-(N-morpholine)ethanesulfonic acid 8.5 g / L, pH 5.6; the IM plate in step (4) is prepared by adding 20 g / L of agar to the IM liquid culture medium.

[0010] Furthermore, the conditions for inducing Agrobacterium virulence using IM liquid culture medium in step (2) are: 28° C., 150 rpm shaking culture for 5 h.

[0011] Furthermore, after the Agrobacterium infection solution and the Auricularia auricularia spore solution are mixed in step (4), the pre-infection conditions are: 25°C, 80 rpm shaking culture for 30 min.

[0012] The beneficial effects of the present invention are as follows: The present invention uses the yeast-like spores of Auricularia auriculariae as a receptor material, and for the first time determines that 5 µg / mL of hygromycin can be used for the screening of its transformants. At the same time, the transformation plasmid is successfully transferred into the yeast-like spores of Auricularia auriculariae through an Agrobacterium-mediated transformation method.

[0013] The present invention establishes for the first time a genetic transformation operation system of Golden Auricularia auricularia based on the Agrobacterium-mediated method, which solves the problem of lack of genetic transformation technology in the molecular biology research of Golden Auricularia auricularia, and lays a technical foundation for the subsequent mining and research of functional genes of Golden Auricularia auricularia, as well as the directional breeding, improvement and development of germplasm resources of Golden Auricularia auricularia varieties through genetic methods.

[0014] The method of the present invention also proves that the yeast-like spores of Auricularia auriculariae can be used as a receptor material for genetic transformation operations, which can effectively overcome the disadvantage that it is difficult to obtain mycelium of Auricularia auriculariae. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a schematic diagram of microscopic observation of yeast-like spores of Auricularia auricularia; Figure 2 The results are the test results of the sensitivity of Auricularia auricularia spores to hygromycin; Figure 3 Schematic diagram of regenerated colonies cultured for 14 days for transformation plate screening; Figure 4 The electrophoresis results of the hygromycin gene fragments detected in 20 transformants are shown; Figure 5 For 20 transformants gus The electrophoresis results after the detection of gene fragments; Figure 6 For 20 transformants gfp The electrophoresis results after the detection of gene fragments; Figure 7 The GUS staining results of two wild-type Bacillus aurantii strains and seven transformants are shown; Figure 8 The results of fluorescence microscopy observation of a wild-type Bacillus aurantii strain and two transformants. DETAILED DESCRIPTION

[0016] The contents of the present invention are explained more clearly and completely below in conjunction with the embodiments.

[0017] Obviously, the embodiments described below are only some embodiments of the present invention and are not intended to limit the protection scope of the present invention. For those skilled in the art, other similar embodiments can be obtained based on the records of the claims of the present invention without creative work.

[0018] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the technical field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0019] The sources of reagents and the method for preparing the culture medium in the embodiment of the present invention are as follows: Transformation plasmid pCAMBIA1303-gpdA-Gus-GFP-TrpC-Hygro: a product of Changsha Aibiwei Biotechnology Co., Ltd.; gpdA is the promoter of the Aspergillus nidulans 3-phosphoglyceraldehyde dehydrogenase gene; GUS is the β-glucuronidase gene; GFP is the green fluorescent protein gene; trpC is the promoter of the Aspergillus nidulans tryptophan synthesis gene; Hygro is the hygromycin resistance gene.

[0020] Agrobacterium AGL1 competent cells: product of Wuhan Miaoling Biotechnology Co., Ltd.

[0021] GUS staining kit: product of Beijing Lanjieke Technology Co., Ltd.

[0022] Hygromycin B: a product of Yisheng Biotechnology (Shanghai) Co., Ltd.

[0023] LB liquid / solid culture medium: product of Sangon Biotech (Shanghai) Co., Ltd.; kanamycin and rifampicin with a final concentration of 50 µg / mL and 25 µg / mL were added to the LB resistance culture medium.

[0024] The composition of YMG solid culture medium is: glucose 10g / L, malt extract 10g / L, yeast extract 4g / L, agar 20g / L.

[0025] The composition of YMG liquid culture medium is: glucose 10g / L, malt extract 10g / L, yeast extract 4g / L.

[0026] The composition of IM liquid medium is: K2HPO4 2g / L, KH2PO4 1.45g / L, NaCl 0.15g / L, MgSO4·7H2O 0.3g / L, CaCl2·2H2O 0.01 g / L, FeSO4·7H2O 0.001g / L, (NH4)2SO40.5g / L, glucose 2 g / L, glycerol 5mL / L, acetosyringone 0.039g / L, 2-(N-morpholine)ethanesulfonic acid 8.5g / L, pH 5.6.

[0027] The composition of IM co-culture medium is: K2HPO4 2g / L, KH2PO4 1.45g / L, NaCl 0.15g / L, MgSO4·7H2O 0.3g / L, CaCl2·2H2O 0.01 g / L, FeSO4·7H2O 0.001g / L, (NH4)2SO40.5g / L, glucose 2 g / L, glycerol 5mL / L, acetosyringone 0.039g / L, 2-(N-morpholino)ethanesulfonic acid 8.5g / L, pH 5.6, agar 20g / L. Example 1

[0028] The genetic transformation method of yeast-like spores of Auricularia auricularia mediated by Agrobacterium is as follows: (1) Cultivation, collection and hygromycin sensitivity determination of A. truncatula 1) Pick the Auricularia aurantiaca spore strain that was activated and cultured on a YMG plate at 23°C for 3 days, inoculate it into YMG liquid medium, and culture it in a shaking incubator at 25°C for 3 days. Take samples, count them, and adjust the spore count to 1×10 7 Pieces / mL. Figure 1 The diagram is a microscopic observation diagram of the cultured yeast-like spores of Auricularia auricula. The Auricularia auricula spore strain is a yeast-like spore formed by the budding of basidiospores. The strain is from Yunnan Junshijie Biotechnology Co., Ltd., the strain name is JSJ-J2F1001C, and it is preserved in the General Microbiological Center of the China Microbiological Culture Collection Administration, the strain name is JSJ-J2F1001C, and the classification name is Auricularia auricula Naematelia aurantialba , the deposit number is CGMCC No.41096, and the deposit date is January 25, 2024.

[0029] 2) Set up YMG plates containing 5 different concentration gradients of hygromycin (0, 5, 10, 15, 20 µg / mL final concentration) and 300 µg / mL final concentration of ceftriaxone to determine the sensitivity of B. aureus to hygromycin, with at least 3 biological replicates for each concentration.

[0030] 3) Take 100 µL of the prepared Bacillus aurantii liquid and spread it evenly on the hygromycin selection plate, place it in a 23℃ constant temperature incubator, and observe the colony regeneration for 20 consecutive days. Figure 2 The results of the assay showed that a final concentration of 5 µg / mL hygromycin could be used for transformant screening.

[0031] (2) Agrobacterium-mediated transformation of Tricholoma australis yeast spores 1) Preparation of Agrobacterium infection medium a. The transformed plasmid was transferred into the Agrobacterium strain AGL1 by freeze-thaw method, and after the bacterial solution was confirmed by PCR, it was stored in a -80℃ refrigerator with a volume ratio of 30% glycerol; b. Streak the Agrobacterium strain AGL1 containing the transformation plasmid on an LB resistance plate and culture at 28°C for 2 days. Pick a single clone and inoculate it into 5 mL of LB culture medium containing antibiotics and culture it in a shaking incubator at 200 rpm and 28°C for 24 hours. c. Centrifuge the bacterial solution at 5000 rpm for 10 min at room temperature, remove the supernatant and resuspend it in 5 mL of IM solution, continue centrifugation at 5000 rpm for 10 min, and resuspend it in 5 mL of IM solution; d. Take 2 mL of the resuspension and measure its absorbance OD 600 The concentration of the culture medium was adjusted to 0.4, and the culture was continued in a shaking incubator at 200 rpm and 28 °C for about 5 h. The OD 600 And adjust it to 0.8 for standby use.

[0032] 2) Preparation of the Yeast-like Bacillus spore solution The yeast-like spore strain of Auricularia auricularia obtained in step (1) was centrifuged at 5000 rpm for 10 min at room temperature to collect the spores, resuspended in IM liquid culture medium, and pre-cultured in a shaker at 150 rpm and 25°C for 5 h. The cells were counted and the number of spores was adjusted to 1×10 using IM liquid. 7 pcs / mL for future use.

[0033] 3) Agrobacterium-mediated infection and transformation a. Mix 1 mL of the prepared Agrobacterium infection solution with 1 mL of Bacillus aurantii solution, and pre-infect for 30 min at 25°C and 80 rpm in a shaker; b. Take 300 µL of the mixture and spread it on two IM solid plates, wrap them with tin foil and place them upside down in a 28°C constant temperature incubator for dark culture for 4 days; c. Rinse two IM co-culture plates with 2 mL of 0.05% Tween-20, collect the rinse solution and mix it, take 200 μL and apply it on the YMG screening plate containing 5 μg / mL hygromycin and 300 μg / mL cefotaxime, set up the control treatment, and invert and culture it in a 23℃ constant temperature incubator. After about 14 days, visible regenerated colonies can be observed in the resistance screening plate. Figure 3 .

[0034] (3) Molecular identification of transformants a. ITS detection: After obtaining the above-mentioned T0 generation transformants, samples were taken and PCR amplified using the universal fungal identification primers ITS1 and ITS4. The sequencing comparison results confirmed that the obtained transformants were all Auricularia auriculariae; b. Detection of target gene fragments: Three pairs of different detection primers were designed based on the backbone sequence of the transformation plasmid, targeting the hygromycin resistance gene, gus Genes and gfp Gene. Among them, the amplification product size corresponding to the detection primer of hygromycin resistance gene is 463bp, see Figure 4 The electrophoresis results of the detection of hygromycin gene fragments in 20 transformants are shown. The primer sequences are the following NO.1 sequence and NO.2 sequence: F: 5´—AGCGTCTCCGACCTGATG—3´ (NO.1); R: 5´—CGACGGACGCACTGACGG—3´ (NO.2); gus The size of the amplified product corresponding to the gene detection primer is 231 bp, see Figure 5 The 20 transformants shown gus The electrophoresis results after the detection of gene fragments. The primer sequences are the following NO.3 sequence and NO.4 sequence: F: 5´—TGTAGAAACCCCAACCCGTG—3´ (NO.3); R: 5´—CCTGCCCAACCTTTCGGTAT—3´ (NO.4); gfp The size of the amplified product corresponding to the detection primer of the gene is 250bp, see Figure 6 The 20 transformants shown gfp The electrophoresis results after the detection of the gene fragments showed that the primer sequences were the following NO.5 sequence and NO.6 sequence: F: 5´—CCATGCCTGAGGGATACGTG—3´ (NO.5); R: 5´—TTGTGGCGGGTCTTGAAGTT—3´ (NO.6).

[0035] Twenty T0 generation transformants regenerated after transformation were randomly selected and subjected to PCR detection using three pairs of primers. In the experiment, the diluted transformation plasmid was used as the positive control, three strains of Bacillus aurantii strains with different genetic backgrounds were used as the negative control, and water addition and no water addition treatments were used as blank controls. The electrophoresis results after PCR amplification showed that fragments corresponding to the three genes were successfully detected in 19 of the 20 transformants.

[0036] The transformants obtained after resistance plate screening and the analysis of the molecular detection results of the transformants showed that the selected target transformation plasmid had been transferred into the yeast-like spores of the recipient material, A. auricularia aurea, through the Agrobacterium-mediated transformation method, and had been successfully integrated into the genome of A. auricularia aurea.

[0037] (4) Phenotypic analysis of transformants 1) GUS staining analysis: After obtaining the above molecular detection results, spore colonies corresponding to 7 positive transformants were randomly selected and placed in 1.5mL centrifuge tubes, and wild-type Auricularia auriculariae spore strains were used as negative controls. The staining solution was prepared according to the operating procedures of the GUS staining kit, and 500µL of the staining solution was added to each sample to be tested. After being mixed with a pipette, the samples were placed in a 23℃ constant temperature incubator for 5 days. It was observed that the spore materials corresponding to the positive transformants were all dyed light blue. After decolorization according to the requirements of the staining kit, the blue result could still be observed by the naked eye, as shown in Figure 2. Figure 7 Shown are the GUS staining results of two wild-type B. aurantii strains and seven transformants.

[0038] The above results show that the exogenous gus The gene was not only integrated into the genome of the Auricularia auricularia spore transformant, but also could be expressed normally in the body of the transformant.

[0039] 2) Fluorescence microscopy analysis: Based on the above experimental basis, two positive transformants after GUS staining and one wild-type strain as a control were randomly selected for GFP green fluorescence microscopy observation and analysis. The results showed that under the same excitation light conditions, weak green fluorescence could be observed in both transformants, but no obvious fluorescence signal appeared in the wild-type material as a control. Figure 8 Shown are the results of fluorescence microscopy observation of a wild-type Bacillus aurantii strain and two transformants.

[0040] The above results show that although the GFP green fluorescence is not particularly obvious, it is sufficient to serve as supporting data to prove that the introduced exogenous gfp The gene has been integrated into the genome of Bacillus aurantii and can be expressed normally in the cell.

[0041] The present invention uses the yeast-like spores of Auricularia auricularia as the receptor material for the first time and successfully establishes its genetic transformation operation system, which provides basic technical support for the mining and research of the functional genes of Auricularia auricularia, and also lays a foundation for the targeted breeding and improvement of strains based on genetic means, as well as the development of new germplasm resources, and has good application prospects.

Claims

1. A method for genetic transformation of yeast-like spores of Auricularia auricularia mediated by Agrobacterium, characterized in that: Here are the steps: (1) Pick the Bacillus aurantii strain that was activated and cultured on a YMG plate at 23°C for 3 days, inoculate it into YMG liquid medium, and culture it in a shaking incubator at 25°C for 3 days. Take a sample, count it, and adjust the cell number to 1×10 7 / mL, with hygromycin resistance gene as selection marker, a final concentration of 5 µg / mL hygromycin was determined for transformant selection; (2) Pick a monoclonal colony of Agrobacterium tumefaciens AGL1 containing the transformation plasmid, inoculate it into LB liquid medium containing rifampicin and kanamycin, and culture it in a shaking incubator at 28°C for 24 h. Collect the Agrobacterium by centrifugation and induce virulence using IM liquid medium. Measure and adjust its absorbance OD 600 is 0.8, and the Agrobacterium infection solution is obtained; (3) After activating and collecting the Auricularia auricularia spores according to the method described in step (1), they were pre-cultured in IM liquid culture medium on a shaker at 25°C for 5 h, and samples were taken for counting and the cell number was adjusted to 1×10 7 / mL, and obtain the Auricularia auricularia spore liquid; (4) The Agrobacterium infection solution obtained in step (2) and the A. auricularia spore solution obtained in step (3) are mixed at a volume ratio of 1:1, spread on an IM plate after pre-infection, and inverted in a 28°C constant temperature incubator in the dark for co-culture for 4 days to transfer the transformation plasmid into the yeast-like spores of A. auricularia spores; (5) Rinse the co-cultured IM plates with Tween 20, collect and mix the rinse fluid, and spread it on YMG selection plates containing 5 µg / mL hygromycin and 300 µg / mL cefotaxime to select transformants.

2. The method for genetic transformation of yeast-like spores of Auricularia auriculariae mediated by Agrobacterium according to claim 1, characterized in that: The Auricularia aurantifolia spore strain described in step (1) is a yeast-like budding spore formed by budding of basidiospores.

3. The method for genetic transformation of yeast-like spores of Auricularia auriculariae mediated by Agrobacterium according to claim 1, characterized in that: The composition of the YMG plate in step (1) is: 10 g / L glucose, 10 g / L malt extract, 4 g / L yeast extract, and 20 g / L agar; the composition of the YMG liquid culture medium is: 10 g / L glucose, 10 g / L malt extract, and 4 g / L yeast extract.

4. The method for genetic transformation of yeast-like spores of Auricularia auriculariae mediated by Agrobacterium according to claim 1, characterized in that: The composition of the IM liquid culture medium described in step (2) is: K2HPO4 2g / L, KH2PO4 1.45g / L, NaCl 0.3g / L, MgSO4·7H2O 0.6g / L, CaCl2·2H2O 0.01 g / L, FeSO4·7H2O 0.001g / L, (NH4)2SO4 0.5g / L, glucose 2 g / L, glycerol 5mL / L, acetosyringone 0.039g / L, 2-(N-morpholine)ethanesulfonic acid 8.5g / L, pH 5.6; the IM plate described in step (4) is prepared by adding 20g / L of agar to the IM liquid culture medium.

5. The method for genetic transformation of yeast-like spores of Auricularia auriculariae mediated by Agrobacterium according to claim 1, characterized in that: The conditions for inducing Agrobacterium virulence using IM liquid culture medium in step (2) are: 28° C., 150 rpm shaking culture for 5 hours.

6. The method for genetic transformation of Auricularia australis yeast-like spores mediated by Agrobacterium according to claim 1, characterized in that: After the Agrobacterium infection solution and the Auricularia auricularia spore solution are mixed in step (4), the pre-infection conditions are as follows: 25°C, 80 rpm shaking incubator for 30 min.

Images